CN103834738A - Method for extracting and detecting IncRNA in gastric juice - Google Patents
Method for extracting and detecting IncRNA in gastric juice Download PDFInfo
- Publication number
- CN103834738A CN103834738A CN201410088376.2A CN201410088376A CN103834738A CN 103834738 A CN103834738 A CN 103834738A CN 201410088376 A CN201410088376 A CN 201410088376A CN 103834738 A CN103834738 A CN 103834738A
- Authority
- CN
- China
- Prior art keywords
- gastric juice
- extraction
- lncrna
- rna
- downstream primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for extracting and detecting IncRNA in gastric juice. The method comprises the following steps: gastric juice extraction, gastric juice pretreatment, trichloromethane extraction, isopropanol participation, ethanol washing, drying a ribonucleic acid (RNA), RNA reverse transcription, polymerase chain reaction (PCR) detection and the like. Compared with the prior art, the method has the advantages that the impurities such as polysaccharide, mucoprotein and the like in the gastric juice are removed by the steps of gastric juice pretreatment, trichloromethane extraction, isopropanol participation, ethanol washing, drying a ribonucleic acid, RNA reverse transcription, and PCR detection. High-quality and high-yield extraction of the IncRNA in the gastric juice is achieved on the basis of simplifying experimental operation steps; fluorescent quantitative RT-PCR detection of the target IncRNA is achieved; reduced glyceraldehyde-phosphate dehydrogenase (GAPDH) is found out to be a good exterior parameter gene in the gastric juice by Ct value analysis of the GAPDH on 130 cases of gastric samples; a GAPDH reference Ct value range for judging the total RNA mass of the gastric juice is also proposed on the basis; and the method has great significance on further research of the occurrence regularity of IncRNA in the gastric juice and the relationship between the occurrence regularity of IncRNA in the gastric juice and the physiological status and the disease.
Description
Technical field
The present invention relates to extraction and the detection method of a kind of lncRNA, relate in particular to extraction and the detection method of lncRNA in a kind of gastric juice.
Background technology
Nearly 2～30,000 of the gene of coded protein in human body, only account for 2% of human genome, all the other 98% not the genomic dna of coded protein be considered at first not have function, be the rubbish in organism, be commonly called " junk DNA " (junk DNA).But current research shows, most transcribed generation non-coding RNA (the noncoding RNA of these junk DNAs, ncRNA),, along with the generally application of high-throughput genome sequencing technology, it is ncRNA that people are surprised to find in mammalian cell approximately 98% transcript.In these ncRNA molecules, have and comprise current people known " special (housekeeping) " ncRNA (as tRNA and rRNA etc.), little ncRNA (as microRNA and piRNA etc.), more be wait further investigation long-chain non-coding RNA (long noncoding RNA, lncRNA) molecule.
LncRNA refers to that a class transcript length is greater than 200 Nucleotide (nucleotide, nt) and does not possess the RNA molecule of coded protein function.This quasi-molecule generally has the sequential element of high conservative, specific space secondary structure, shear-form and Subcellular Localization, and particularly the many members in them are found to have tissue or cell-specific.This conservative property and specificity have determined that lncRNA has biological function widely, relate to the vital processes such as chromosome structure dynamic change, telomere maintain, subcellular structure composition, genomic imprinting, dosage compensation effect.Just because of this, lncRNA can not be considered to the by product that " noise " that genome transcribes and rna plymerase ii are transcribed again, learns the New n cRNA molecule of function but a class has important biomolecule.
For the research of ncRNA constitutional features and biological function, be unable to do without extraction, RNA quality evalution and the detection thereof of each pseudo body fluid ncRNA.At present in gastric juice the extraction of ncRNA with detection method as the Chinese invention patent application of an application number 201010606089.8 (notification number is CN102127601A) " detection method of miRNA in a kind of gastric juice " discloses operation steps, specifically comprise gastric juice extraction and sodium hydroxide solution neutralization, tryptic digestion, add Trizol reagent and mix the steps such as standing, RNA release, chloroform extraction, isopropanol precipitating, washing with alcohol, RNA reverse transcription and PCR detection.
Aforesaid method has solved the interference problem that in gastric juice, acidity, polysaccharide and Saliva Orthana etc. extract miRNA.But, because Trizol reagent is only suitable for the extraction of the total RNA of tissue samples, moreover miRNA molecule is much smaller than lncRNA molecule, the former only has more than 20 nt, if the method that adopts similar extraction miRNA obviously exists operation steps complexity, defect that RNA productive rate is low for the extraction of gastric juice lncRNA.Under room temperature, lncRNA character is more unstable simultaneously, and in gastric juice, has a considerable amount of nucleases, so lncRNA very easily degrades in extraction.Above factor all can have a strong impact on the quality of gastric juice lncRNA.
In addition, in gastric juice, lncRNA abundance is low, and extraction and detection difficulty to gastric juice lncRNA are larger, still imperfect extraction so far, detects lncRNA technological method in gastric juice.
Summary of the invention
Technical problem to be solved by this invention is extraction and the detection method that lncRNA in a kind of gastric juice is provided for above-mentioned prior art present situation, the method can be removed the interference of the impurity such as polysaccharide and Saliva Orthana in gastric juice, realize lncRNA high quality in gastric juice, high-content extraction, and the lncRNA extracting has been carried out to fluorescence quantitative RT-RCR detection.
The present invention solves the problems of the technologies described above adopted technical scheme: the extracting method of lncRNA in this gastric juice, comprises the steps:
(1) adopt RNA extraction agent to extract the total RNA of human gastric juice, with reverse transcription reagent, RNA extracting solution is carried out to reverse transcription reaction and obtain cDNA;
(2) the cDNA solution of step (1) is carried out to pcr amplification reaction, then detect and increase with quantitative real time PCR Instrument;
It is characterized in that: in step (1), adopt extractant Trizol LS gastric juice to be carried out to the extraction of RNA, and carry out pcr amplification reaction by lncRNA specific amplification upstream and downstream primer or GAPDH amplification upstream and downstream primer pair cDNA solution in step (2).
Wherein, the concrete steps of described step (1) are:
A, gastric juice extract: with stomach tube extraction human gastric juice 3～6ml on an empty stomach, put into centrifuge tube, centrifugal 3 minutes of 3000rpm under room temperature, transfers to another without in RNA enzyme centrifuge tube, as on ice by supernatant;
B, gastric juice pre-treatment: gastric juice 250～350 μ l that get step a are placed in 2ml without RNA enzyme centrifuge tube, add the Trizol LS reagent of 3 times of volumes, vortex oscillation 10 seconds, room temperature leaves standstill 5 minutes, at 4 DEG C, centrifugal 10 minutes of 12000rpm, transfers to supernatant liquid one new in RNA enzyme centrifuge tube;
C, chloroform extraction: in the supernatant liquor of step b, add 0.2～0.3ml trichloromethane, vortex oscillation 10 seconds, leaves standstill 5 minutes under room temperature, at 4 DEG C, centrifugal 15 minutes of 12000rpm, draws upper water and moves into mutually new in RNA enzyme centrifuge tube;
D, isopropanol precipitating: add the isopyknic Virahol of water at the middle and upper levels with step c, after mixing, under 4 DEG C of conditions, leave standstill 20 minutes, then centrifugal 10 minutes of 12000rpm at 4 DEG C, abandoning supernatant must precipitate;
E, washing with alcohol: in the precipitation of steps d, adding massfraction is 75% ethanol 1ml, put upside down for several times, and centrifugal 5 minutes of 12000rpm, abandons supernatant at 4 DEG C;
F, dry RNA: previous step is abandoned after supernatant, again centrifugal 2 minutes of 12000rpm at 4 DEG C; Abandon supernatant, under room temperature, be dried 1～2 minute, add 10 μ l without RNA enzyme water dissolution, obtain RNA extracting solution ,-80 DEG C save backup;
G, RNA reverse transcription: with reverse transcription reagent, the RNA extracting solution of step f is carried out to reverse transcription reaction and obtain cDNA solution, put-20 DEG C and save backup;
H, PCR detect: the cDNA solution to step g carries out pcr amplification reaction, and amplification upstream and downstream primer is lncRNA specific amplification upstream and downstream primer or GAPDH amplification upstream and downstream primer, then detect with quantitative real time PCR Instrument.
Further, in described step (2), lncRNA specific amplification upstream and downstream primer is respectively RMRP amplification upstream and downstream primer.
Further, in described step (2), lncRNA specific amplification upstream and downstream primer is respectively AA174084 amplification upstream and downstream primer.
Further, in described step (2), GAPDH specific amplification upstream primer is:
5 ' ACCCACTCCTCCACCTTTGAC3 '; With GAPDH specific amplification downstream primer be: 5 ' TGTTGCTGTAGCCAAATTCGTT3 '.
Further, described RMRP amplification upstream primer is: 5 ' ACTCCAAAGTCCGCCAAGA3 '; With RMRP amplification downstream primer be: 5 ' TGCGTAACTAGAGGGAGCTGAC3 '.
Further, described AA174084 amplification upstream primer is: 5 ' CTGGTTCTTCATCCCTGCTATG3 '; With AA174084 amplification downstream primer be: 5 ' CCTGCTCCTCTTTGTGTTCTCT3 '.
Further, the pcr amplification reaction condition of described step (2) is: 95 DEG C of denaturations 5 minutes; Then 94 DEG C of sex change 15 seconds, 55 DEG C of annealing 30 seconds, 70 DEG C are extended 30 seconds, totally 45 circulations.
As preferably, in described step (1), the additional proportion of gastric juice and extractant Trizol LS is 1:2.5～3.5.
Analyze by the Ct value to 130 routine gastric juice GAPDH, find that the Ct value mean of 250 μ l gastric juice sample GAPDH is about 32.3, and work as the Ct of sample cDNA
gAPDHbe worth≤34 o'clock, target lncRNA can well be increased.Therefore, extracting the up-to-standard term of reference of gastric juice RNA with this technological method is: Ct
gAPDHvalue≤34.
And; validity and the practicality of the detection gastric juice lncRNA relative level method of setting up for proved invention; the present invention has detected normal or slight gastritis (normal mucosa or minimal gastritis; NMMG), stomach ulcer (gastric ulcer; GU), atrophic gastritis (atrophic gastritis; AG) relative level of gastric juice lncRNA and in cancer of the stomach (gastric cancer, GC) patient.Result shows that the method can detect the relative level of lncRNA in gastric juice effectively; And the horizontal indifference of AA174084 in normal or slight gastritis, stomach ulcer and patients with atrophic gastritis gastric juice, and level in Gastric Juice from Patients Suffering from Stomach Carcinoma obviously raises, and shows the Close relation with cancer of the stomach.The cutoff value of AA174084 in gastric juice is fixed on to 4.24, and the sensitivity of its diagnosis of gastric cancer is 59%, and specificity is that after 85%, ROC tracing analysis, AUC value is 0.723.
Above result shows that the method can detect the relative level of lncRNA in gastric juice effectively, and AA174084 may become new diagnosing gastric cancer mark simultaneously.
Compared with prior art, the invention has the advantages that: the human gastric juice lncRNA that is a kind of novelty extracts and detection method, by to gastric juice Trizol LS pre-treatment, chloroform extraction, isopropanol precipitating, 75% washing with alcohol, RNA reverse transcription and PCR detecting step, remove polysaccharide in gastric juice, the impurity such as Saliva Orthana, lncRNA high quality in having realized gastric juice on the basis of simplifying experimental implementation step, the extraction of high yield, realize target lncRNA fluorescence quantitative RT-RCR has been detected, analyze by the Ct value to 130 routine gastric juice sample GAPDH, find that GAPDH is a good outer ginseng gene in gastric juice, GAPDH for judging the total RNA quality of gastric juice is proposed again on this basis with reference to Ct value scope, method provided by the invention, occurrence law to lncRNA in further research gastric juice and having great importance with physiological status and the pathogenetic relation of disease.
Brief description of the drawings
Fig. 1 is the RMRP amplification curve diagram in two gastric juice samples of embodiment 1;
Fig. 2 is the RMRP melting profile in two gastric juice samples of embodiment 1;
Fig. 3 is the AA174084 amplification curve diagram in two gastric juice samples of embodiment 2;
Fig. 4 is the AA174084 melting profile in two gastric juice samples of embodiment 2;
Fig. 5 is the GAPDH amplification curve diagram in two gastric juice samples of embodiment 3;
Fig. 6 is the GAPDH melting profile in two gastric juice samples of embodiment 3;
Fig. 7 is the level comparison of GAPDH in Healthy People, patients w ith peptic ulcer disease, patients with atrophic gastritis and each phase Gastric Juice from Patients Suffering from Stomach Carcinoma;
Fig. 8 is AA174084 level in normal or slight gastritis, stomach ulcer, atrophic gastritis and Gastric Juice from Patients Suffering from Stomach Carcinoma;
Fig. 9 is the ROC tracing analysis of patients with gastric cancer and non-Gastric Juice from Patients Suffering from Stomach Carcinoma AA174084 level.
Embodiment
Below in conjunction with the drawings and embodiment the invention will be further described.
Embodiment 1
In gastric juice, the extraction of lncRNA and a detection method, comprise the steps:
A, gastric juice extract: with stomach tube extraction gastric juice 5ml on an empty stomach, put into the centrifuge tube without RNase, centrifugal 3 minutes of 3000rpm under room temperature, transfers to another without in RNA enzyme centrifuge tube, as on ice by supernatant;
B, gastric juice pre-treatment: get previous step gastric juice 300 μ l and be placed in 2ml without RNA enzyme centrifuge tube, add Trizol LS reagent 900 μ l, vortex oscillation 10 seconds, room temperature leaves standstill 5 minutes, at 4 DEG C, centrifugal 10 clocks of 12000rpm, sample is divided into two-layer, and upper strata is the pink liquid that homogenizes, lower floor is the relatively dark thick impurity layer of color, the supernatant liquid of 1000 μ l is transferred to one newly without in RNA enzyme centrifuge tube, abandon precipitation, with the impurity such as Polysaccharide removing and Saliva Orthana;
C, chloroform extraction: add 0.2ml trichloromethane, vortex oscillation 10 seconds, left standstill under room temperature after 5 minutes, and centrifugal 15 minutes of 12000rpm at 4 DEG C, draws upper water and move into mutually one newly without in RNA enzyme centrifuge tube;
D, isopropanol precipitating: add in without RNA enzyme centrifuge tube in previous step and the Virahol of described upper water equal volume, after mixing, under 4 DEG C of conditions, leave standstill 20 minutes, centrifugal 10 minutes of 12000rpm at 4 DEG C, abandoning supernatant must precipitate;
E, 75% washing with alcohol: in above-mentioned precipitation, adding massfraction is 75% ethanol 1ml, put upside down for several times, and centrifugal 5 minutes of 12000rpm, abandons supernatant at 4 DEG C;
F, dry RNA: previous step is abandoned after supernatant, centrifugal 2 minutes of 12000rpm at 4 DEG C again, visible tube wall residual liquid comes together in the pipe end, slowly exhaust after residual liquid with 100 μ l pipettors, see the translucent white RNA precipitation of a needle point size, under room temperature condition dry 1 minute, add 10 μ l without RNase water dissolution, piping and druming, obtains RNA extracting solution repeatedly, and-80 DEG C save backup;
G, RNA reverse transcription: the RNA extracting solution of previous step is carried out to reverse transcription reaction with GoScript reverse transcription test kit (being purchased from Promega company of the U.S.), obtain cDNA solution, put-20 DEG C and save backup, concrete operations are carried out according to this test kit specification sheets: in 0.5ml centrifuge tube, add 9.5 μ l RNA extracting solutions, 1 μ l Oligonucleolide primers, 1 μ l random primer, 1 μ l dNTP, 2 μ l MgCl
2, 1 μ l reversed transcriptive enzyme, 4 μ l reaction buffers and 0.5 μ l RNA enzyme inhibitors; Then 25 DEG C insulation 5 minutes, 42 DEG C 1 hour, then 70 DEG C insulation 15 minutes, add 80 μ l without RNase water, just obtain cDNA solution, put-20 DEG C and save backup;
H, PCR detect: use
qPCR Master Mix detection kit (being purchased from Promega company of the U.S.) is carried out quantitative fluorescent PCR (instrument is purchased from Stratagene company of the U.S.) to the cDNA solution of upper step, the primer of amplification is RMRP specific amplification upstream and downstream primer, concrete operations are carried out according to detection kit and quantitative real time PCR Instrument specification sheets: in the transparent quantitative fluorescent PCR reaction tubes of thin-walled, add respectively the each 1 μ l of RMRP specific amplification upstream and downstream primer, 12.5 μ l
qPCR Master Mix detection kit, 5.5 μ l are without RNase water and 5 μ l cDNA; PCR reaction conditions is: 95 DEG C of denaturations 5 minutes; Then 94 DEG C of sex change 15 seconds, 55 DEG C of annealing 30 seconds, 70 DEG C are extended 30 seconds, totally 45 circulations; Curve analysis: 95 DEG C 1 minute, 55 DEG C 30 seconds; Then be slowly warming up to 95 DEG C, temperature rise rate is 0.2 DEG C/sec.Finally obtain RMRP amplification curve as shown in Figure 1 and RMRP melting curve as shown in Figure 2, the Ct value that can obtain two detected gastric juice samples from amplification curve is respectively 27.84 and 31.49, from melting curve, can recognize that this curve is narrower simple spike, can find out that the RMRP of each gastric juice sample is all by specific amplification, there is no the interference of primer dimer and assorted band.
Basic identical with embodiment 1 method, difference is just in step h, the upstream and downstream primer of amplification replaces RMRP by AA174084 specific amplification upstream and downstream primer, detection obtains amplification curve and the melting curve of AA174084 expression level in gastric juice, as accompanying drawing 3 and 4, the Ct value that can obtain two detected gastric juice samples from amplification curve is respectively 31.42 and 32.65 respectively; From melting curve, can recognize that this curve is narrower simple spike, can find out that the AA174084 of each gastric juice sample is all by specific amplification, there is no the interference of primer dimer and assorted band.
Embodiment 3
Basic identical with embodiment 1 method, difference is just in step h, the upstream and downstream primer of amplification replaces RMRP by GAPDH specific amplification upstream and downstream primer, detection obtains the amplification curve of GAPDH expression level in gastric juice, as accompanying drawing 5 and 6, the Ct value that can obtain two detected gastric juice samples from amplification curve is respectively 28.26 and 32.45 respectively; From melting curve, can recognize that this curve is narrower simple spike, can find out that the GAPDH of each gastric juice sample is all by specific amplification, there is no the interference of primer dimer and assorted band.The Ct of this routine sample cDNA
gAPDHvalue≤34, RNA (being cDNA) is up-to-standard.In addition, by 130 routine gastric juice Ct
gAPDHvalue is analyzed, find the horizontal stable of GAPDH in Healthy People (NMMG), patients w ith peptic ulcer disease (GU), atrophic gastritis (AG) patient and each phase cancer of the stomach (GC) patient gastric juice, and the factors such as gastric juice GAPDH level is not subject to age, sex, drinks, smoking and helicobacter pylori infection affect, and having proposed thus GAPDH is also a good outer ginseng gene (seeing accompanying drawing 7 and subordinate list 1) at gastric juice.
The relation of table 1 gastric juice GAPDH level and clinical pathological factors
Utilize the Ct value of target lncRNA and GAPDH in same individual gastric juice sample, just can be according to formula Δ Ct=Ct
lncRNA-Ct
gAPDHcalculate the Δ Ct value of this target lncRNA, just can judge the relative level of this target lncRNA according to the size of Δ Ct value; The little person of Δ Ct value, the level of its corresponding target lncRNA is high; And the large person of Δ Ct value, the level of its corresponding target lncRNA is low.
In above-mentioned example, RMRP and AA174084 also can replace with other target lncRNA specific amplification upstream and downstream primer, do not enumerate at this; The present invention has set up extraction and the detection method of lncRNA in gastric juice, has found that GAPDH is a good outer ginseng gene at gastric juice, lays a good foundation for studying lncRNA function and level.
Embodiment 5
Adopt the method for above-mentioned foundation to detect the level of lncRNA in different patients with gastric disease gastric juice.As shown in Figure 8, AA174084 level in 45 example normal or slight gastritis, 30 routine stomach ulcer, 16 routine atrophic gastritiss and 39 routine Gastric Juice from Patients Suffering from Stomach Carcinomas, patients with gastric cancer group gastric juice AA174084 level is apparently higher than other each group, P<0.001.As shown in Figure 9, the ROC tracing analysis of 39 routine patients with gastric cancer and 91 routine non-Gastric Juice from Patients Suffering from Stomach Carcinoma AA174084 levels, AUC value is 0.723, threshold value is 4.24, P<0.001.
Claims (9)
1. the extraction of lncRNA and a detection method in gastric juice, comprise the steps:
(1) adopt RNA extraction agent to extract the total RNA of human gastric juice, with reverse transcription reagent, RNA extracting solution is carried out to reverse transcription reaction and obtain cDNA;
(2) the cDNA solution of step (1) is carried out to pcr amplification reaction, then detect and increase with quantitative real time PCR Instrument;
It is characterized in that: in step (1), adopt extractant Trizol LS gastric juice to be carried out to the extraction of RNA, and carry out pcr amplification reaction by lncRNA specific amplification upstream and downstream primer or GAPDH amplification upstream and downstream primer pair cDNA solution in step (2).
2. extraction and the detection method of lncRNA in a kind of gastric juice as claimed in claim 1, is characterized in that: the concrete steps of described step (1) are:
A, gastric juice extract: with stomach tube extraction human gastric juice 3～6ml on an empty stomach, put into centrifuge tube, centrifugal 3 minutes of 3000rpm under room temperature, transfers to another without in RNA enzyme centrifuge tube, as on ice by supernatant;
B, gastric juice pre-treatment: gastric juice 250～350 μ l that get step a are placed in 2ml without RNA enzyme centrifuge tube, add the Trizol LS reagent of 3 times of volumes, vortex oscillation 10 seconds, room temperature leaves standstill 5 minutes, at 4 DEG C, centrifugal 10 minutes of 12000rpm, transfers to supernatant liquid one new in RNA enzyme centrifuge tube;
C, chloroform extraction: in the supernatant liquor of step b, add 0.2～0.3ml trichloromethane, vortex oscillation 10 seconds, leaves standstill 5 minutes under room temperature, at 4 DEG C, centrifugal 15 minutes of 12000rpm, draws upper water and moves into mutually new in RNA enzyme centrifuge tube;
D, isopropanol precipitating: add the isopyknic Virahol of water at the middle and upper levels with step c, after mixing, under 4 DEG C of conditions, leave standstill 20 minutes, then centrifugal 10 minutes of 12000rpm at 4 DEG C, abandoning supernatant must precipitate;
E, washing with alcohol: in the precipitation of steps d, adding massfraction is 75% ethanol 1ml, put upside down for several times, and centrifugal 5 minutes of 12000rpm, abandons supernatant at 4 DEG C;
F, dry RNA: previous step is abandoned after supernatant, again centrifugal 2 minutes of 12000rpm at 4 DEG C; Abandon supernatant, under room temperature, be dried 1～2 minute, add 10 μ l without RNA enzyme water dissolution, obtain RNA extracting solution ,-80 DEG C save backup;
G, RNA reverse transcription: with reverse transcription reagent, the RNA extracting solution of step f is carried out to reverse transcription reaction and obtain cDNA solution, put-20 DEG C and save backup;
H, PCR detect: the cDNA solution to step g carries out pcr amplification reaction, and amplification upstream and downstream primer is lncRNA specific amplification upstream and downstream primer or GAPDH amplification upstream and downstream primer, then detect with quantitative real time PCR Instrument.
3. extraction and the detection method of lncRNA in a kind of gastric juice as claimed in claim 1, is characterized in that: in described step (2), lncRNA specific amplification upstream and downstream primer is respectively RMRP amplification upstream and downstream primer.
4. extraction and the detection method of lncRNA in a kind of gastric juice as claimed in claim 1, is characterized in that: in described step (2), lncRNA specific amplification upstream and downstream primer is respectively AA174084 amplification upstream and downstream primer.
5. extraction and the detection method of lncRNA in a kind of gastric juice as claimed in claim 1, is characterized in that: in described step (2), GAPDH specific amplification upstream primer is: 5 ' ACCCACTCCTCCACCTTTGAC3 '; With GAPDH specific amplification downstream primer be: 5 ' TGTTGCTGTAGCCAAATTCGTT3 '.
6. extraction and the detection method of lncRNA in a kind of gastric juice as claimed in claim 3, is characterized in that: described RMRP amplification upstream primer is: 5 ' ACTCCAAAGTCCGCCAAGA3 '; With RMRP amplification downstream primer be: 5 ' TGCGTAACTAGAGGGAGCTGAC3 '.
7. extraction and the detection method of lncRNA in a kind of gastric juice as claimed in claim 4, is characterized in that: described AA174084 amplification upstream primer is: 5 ' CTGGTTCTTCATCCCTGCTATG3 '; With AA174084 amplification downstream primer be: 5 ' CCTGCTCCTCTTTGTGTTCTCT3 '.
8. extraction and the detection method of lncRNA in a kind of gastric juice as claimed in claim 1, is characterized in that: the pcr amplification reaction condition of described step (2) is: 95 DEG C of denaturations 5 minutes; Then 94 DEG C of sex change 15 seconds, 55 DEG C of annealing 30 seconds, 70 DEG C are extended 30 seconds, totally 45 circulations.
9. extraction and the detection method of lncRNA in a kind of gastric juice as claimed in claim 1, is characterized in that: in described step (1), the additional proportion of gastric juice and extractant Trizol LS is 1:2.5～3.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410088376.2A CN103834738B (en) | 2014-03-11 | 2014-03-11 | The extraction of lncRNA and detection method in a kind of gastric juice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410088376.2A CN103834738B (en) | 2014-03-11 | 2014-03-11 | The extraction of lncRNA and detection method in a kind of gastric juice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834738A true CN103834738A (en) | 2014-06-04 |
| CN103834738B CN103834738B (en) | 2016-09-07 |
Family
ID=50798630
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410088376.2A Expired - Fee Related CN103834738B (en) | 2014-03-11 | 2014-03-11 | The extraction of lncRNA and detection method in a kind of gastric juice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834738B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105653897A (en) * | 2015-12-25 | 2016-06-08 | 北京百迈客生物科技有限公司 | Biological platform-based IncRNA analysis system and method |
| CN105695451A (en) * | 2016-04-19 | 2016-06-22 | 南京大学 | Extraction method of microbial total DNA in human stomach |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127601A (en) * | 2010-12-27 | 2011-07-20 | 宁波大学 | Method for detecting miRNA (micro ribonucleic acid) in stomach juice |
-
2014
- 2014-03-11 CN CN201410088376.2A patent/CN103834738B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127601A (en) * | 2010-12-27 | 2011-07-20 | 宁波大学 | Method for detecting miRNA (micro ribonucleic acid) in stomach juice |
Non-Patent Citations (5)
| Title |
|---|
| HILLIER L. ET AL: "AA174084.1", 《GENBANK》 * |
| JOSEPH ROSENBLUH ET AL: "RMRP Is a Non-Coding RNA Essential for Early Murine Development", 《PLOS ONE》 * |
| KAVLEEN SIKAND ET AL: "Intrinsic expression of host genes and intronic miRNAs in prostate carcinoma cells", 《CANCER CELL INTERNATIONAL》 * |
| QIANQIAN PANG ET AL: "Increased expression of long intergenic non-coding RNA LINC00152 in gastric cancer and its clinical significance", 《TUMOR BIOL》 * |
| 崔龙: "胃液微小RNA的分析及其在胃癌筛查中的意义", 《中国优秀硕士学位论文全文数据库（电子期刊）》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105653897A (en) * | 2015-12-25 | 2016-06-08 | 北京百迈客生物科技有限公司 | Biological platform-based IncRNA analysis system and method |
| CN105653897B (en) * | 2015-12-25 | 2019-02-01 | 北京百迈客生物科技有限公司 | LncRNA analysis system and method based on biological cloud platform |
| CN105695451A (en) * | 2016-04-19 | 2016-06-22 | 南京大学 | Extraction method of microbial total DNA in human stomach |
| CN105695451B (en) * | 2016-04-19 | 2019-02-15 | 南京大学 | The extracting method of microorganism total DNA in a kind of human stomach |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834738B (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2406402B1 (en) | Method to assess human allograft status from microrna expression levels | |
| CN107385014B (en) | RT-qPCR method for directly and quantitatively detecting circulating miRNA | |
| CN103966311A (en) | Method for detecting lncRNA (long noncoding RNA) in plasma | |
| CN103805696A (en) | Micro RNA (Ribonucleic Acid) molecular marker for diagnosing rheumatoid arthritis and detection kit thereof | |
| CN104120185A (en) | Method and kit for diagnosing liver cancer by use of the ratio of change in serum miRNA quantity | |
| WO2012160551A2 (en) | Methods and compositions for determining heart failure or a risk of heart failure | |
| CN107820519B (en) | Health sign | |
| CN103834738A (en) | Method for extracting and detecting IncRNA in gastric juice | |
| CN102127601A (en) | Method for detecting miRNA (micro ribonucleic acid) in stomach juice | |
| KR102096498B1 (en) | MicroRNA-4732-5p for diagnosing or predicting recurrence of colorectal cancer and use thereof | |
| KR102492149B1 (en) | MicroRNA-1246 for diagnosing of ovarian cancer and use thereof | |
| CN106521035B (en) | Gene chip detection kit and method for detecting 16 respiratory pathogens | |
| CN109930206A (en) | Detection kit is sequenced in micro blood platelet RNA based on BGISEQ-500 | |
| CN102443638B (en) | Internal reference for detecting miRNA (micro Ribonucleic Acid) in serum/blood plasma and application of internal reference | |
| CN103882095A (en) | Application of small molecule RNA as tuberculosis marker | |
| CN103555848A (en) | 3'-5'-qPCR (quantitative polymerase chain reaction) quantitative detection technology for small RNA (ribonucleic acid) | |
| KR101381894B1 (en) | Serum miRNA as a marker for the diagnosis of lymph node metastasis of gastric cancer | |
| CN107586844A (en) | Application of glioma prognostic marker Circ9:135881633|135883078 | |
| CN104655859A (en) | Breast cancer diagnosis marker | |
| CN104651492B (en) | Applications of the miRNA410 in prostatic cancer diagnostic reagent kit is prepared | |
| CN108165634B (en) | Detection and application of novel gastric cancer molecular marker tRF-5026a | |
| CN101126705A (en) | Human small RNS 129 fluorescent quantitative reagent box | |
| CN103757121B (en) | Based on hsa-miR-489 detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN109517894B (en) | Non-coding RNA biomarker related to liver cancer and application thereof | |
| RU2729423C2 (en) | Method of extracting free and exosomal micro-rna from saliva |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160907 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |