CN107828732A - A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source RIG I acceptor genes - Google Patents

A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source RIG I acceptor genes Download PDF

Info

Publication number
CN107828732A
CN107828732A CN201711089724.8A CN201711089724A CN107828732A CN 107828732 A CN107828732 A CN 107828732A CN 201711089724 A CN201711089724 A CN 201711089724A CN 107828732 A CN107828732 A CN 107828732A
Authority
CN
China
Prior art keywords
hek293
prig
cell
cells
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201711089724.8A
Other languages
Chinese (zh)
Inventor
朱建中
李双洁
何姗
周荣云
陈南华
朱美芹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN201711089724.8A priority Critical patent/CN107828732A/en
Publication of CN107828732A publication Critical patent/CN107828732A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Reproductive Health (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Medicinal Chemistry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention belongs to biological technical field, and in particular to the NF κ B Dual-Luciferases reporter cell lines and its construction method of stable expression pig source RIG I acceptor genes.The cell line refers to the HEK293 NF κ B cells for being transferred to pig source RIG I (pRIG I) acceptor gene, and the HEK293 NF κ B cells are the introduction of the HEK293 cells of NF κ B luciferases and internal reference renilla luciferase.The present invention, which provides, can be used in studying pRIG I activation activation downstream NF κ B promoters reporter gene detection stable cell lines.The present invention also provides biomaterial to stablize intracellular difference expression gene under RNA Seq technology high flux screening pRIG I silences and the state of activation, and the species specificity for further research RIG I is laid a good foundation and platform.

Description

A kind of NF- κ B Dual-Luciferases report of stable expression pig source RIG-I acceptor genes is thin Born of the same parents and its construction method
Technical field
The invention belongs to biological technical field.More particularly to the NF- of stable expression pig source RIG-I (pRIG-I) acceptor gene κ B Dual-Luciferases reporter cell lines and its construction method.More specifically, the present invention, which provides, can be used in studying pRIG-I work Change activation downstream NF- κ B promoters reporter gene detection stable cell lines.The present invention is also RNA-Seq technology high flux screenings Stablize intracellular difference expression gene under pRIG-I silences and the state of activation and provide biomaterial, and be further research RIG- I species specificity is laid a good foundation and platform.
Background technology
RIG samples acceptor (RLR)RIG-I
RLR is the main viral RNA acceptor in cell cytosol.RIG-I earliest by screening cDNA library when sent out It is existing[1,2], other members also include MDA5 and LGP2.RIG-I and MDA5 has similar structural region：Two CARD of N-terminal (caspase recruitment domains) cascaded structure domain (2CARDs), there is signal activity, middle DExH-box solutions Revolve enzyme region (helicase domain) and the inhibition zone of C-terminal or control region (repressor domain or regulatory domain RD)[3].RIG-I best identifieds RNA is 5 ' short and small end triphosphoric acid double-stranded RNAs (5 ' ppp-dsRNA), can also be known The double-stranded RNA analog poly I of other short chain:C[3,4].RIG-I activation mechanism research is very deep, clearer：Positive reason Under condition, the Hel-2i areas of RIG-I CARD active regions and unwindase, which combine, is in a kind of autologous holddown[4].In 5 ' ppp- When dsRNA stimulates RIG-I, the combination of 5 ' ppp-dsRNA triphosphoric acid (ppp) first with RIG-I C-terminal RD areas, RIG-I conformations Change causes the Hel-2i in 5 ' ppp-dsRNA and RIG-I unwindases areas further combined with so as to relieve Hel-2i to CARD strings Join the suppression of area (2CARDs).Afterwards by K63 ubiquitin chain effect (K63-Ubiquitination/Polyubiquitin) or Person aggregates into fibril effect (filament) by RD-helicase on the RNA chains of combination, and 2CARDs forms relatively stable Spiral sample tetramer structure (also referred to as " lock-washer " spline structure).The 2CARDs tetramers of formation excite downstream tap egg White MAVS forms prion sample particle signal complex, final transcriptional factorses IRF3 and NF- κ B, difference induced expression IFN And inflammatory cytokine[5]。
RIG sample acceptors are distributed in almost all of mammalian cell, and crucial work is played in virus identification and immune response With[3,4].Consistent with identification RNA ligand features, RIG-I specific recognition majority sub-threads minus-stranded rna virus is (because these viruses are multiple Substantial amounts of short and small 5 ' ppp-dsRNA is produced during system)；These viruses include the Ebola virus (EBOV) of filamentous virus section, The measles virus (Measle virus) of Paramyxoviridae, sendai virus (Sendai virus), NDV (NDV), exhale Road syncytial virus (RSV) is inhaled, the influenza virus (Influenza virus) of orthomyxoviridae family, the Chinese of bunyaviridae is smooth Viral (Hantavirus), the vesicular stomatitis virus (VSV) of Rhabdoviridae, hydrophobin (RV) etc..RIG-I also can be special The HCV (HCV) and Japanese B encephalitis virus (JEV) of different identification single-stranded positive flaviviridae.In addition, RIG-I also identifies DNA virus such as adenovirus (Adenovirus), vaccinia virus, herpesviral (Herpsvirus)；Because these DNA virus carries type III RNA polymerase and produces small dsRNA in a replication process.Also have been reported that RIG-I can identify bacterium RNA such as monokaryon Li bacillus (L.Monocytogenes), helicobacter pylori (H.pylori) and Shigella flexneri (S.flexneri)[6]。
Although the interaction research report about many pig RIG-I signal paths and virus, is all based on pig RIG-I and strikes low skill The result and conclusion that art or people RIG-I are overexpressed and drawn.There is presently no the report of pig RIG-I separation and identification.
Domestic animal innate immunity acceptor RIG-I research contents is deficient, pig RIG-I signal paths do not have studies have reported that, having must Establish the cell system of research pig RIG-I signal paths.
Bibliography：
1.Yoneyama,M.,et al.,The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses.Nat Immunol,2004.5 (7):p.730-7.
2.Sumpter,R.,Jr.,et al.,Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase,RIG-I.J Virol,2005.79(5):p.2689-99.
3.Schlee,M.,Master sensors of pathogenic RNA-RIG-I like receptors.Immunobiology,2013.218(11):p.1322-35.
4.Kell,A.M.and M.Gale,Jr.,RIG-I in RNA virus recognition.Virology, 2015.479-480:p.110-21
5.Wu,B.and S.Hur,How RIG-I like receptors activate MAVS.CurrOpinVirol,2015.12:p.91-98.
6.Vabret,N.and J.M.Blander,Sensing microbial RNA in the cytosol.Front Immunol,2013.4:p.468.
The content of the invention
It is an object of the invention to provide a kind of NF- κ B Dual-Luciferases report of stable expression pig source RIG-I acceptor genes Cell line and its construction method.
Present patent application establishes the HEK293-NF- in the RIG-I eukaryon expression plasmids of the pig independently obtained and our inventions On the basis of the stable reporter cell lines of κ B Dual-Luciferases, structure can stablize expression pig source RIG-I (pRIG-I) acceptor gene The stable reporter cell lines of NF- κ B Dual-Luciferases.The cell line both can be used for screening verification pRIG-I and part RNA knowledge Not and combine, can be used for stablizing intracellular differential expression under follow-up RNA-Seq technical research RIG-I silences and the state of activation Gene.
The technical solution adopted in the present invention is：
A kind of NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source RIG-I acceptor genes, refer to be transferred to pig The HEK293-NF- κ B cells of source RIG-I (pRIG-I) acceptor gene, the HEK293-NF- κ B cells are the introduction of NF- κ B worms The HEK293 cells of luciferase and internal reference renilla luciferase.
The structure of the NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source RIG-I acceptor genes of the present invention Construction method is as follows：
(1) structure of the pcDNA carrier for expression of eukaryon of the encoding gene containing pRIG-I
The amplification of pRIG-I encoding genes and clone.PCR primer is designed, RT-PCR is expanded from pig PK15 cell RNAs PRIG-I encoding genes, amplification PCR fragment is after double digestion and among the Gateway pENTR4 with C- ends HA expression labels Entry vector is attached, and recombinant clone obtains restructuring intermediate carrier after bacterium colony PCR and digestion identification.
LR site-specific recombining reactions.By the pENTR4 recombinant plasmids (site containing attL) and purpose containing pRIG-I of identification PcDNA expression vectors pDEST47 (site containing attR) carries out LR site-specific recombining reactions, is recombinated through bacterium colony PCR identifications Clone pcDNApRIG-I.
Recombinate pcDNApRIG-I expression.PcDNApRIG-I transfection 293T cells are recombinated, crack cell after 48 hours Thing carries out SDS-PAGE electrophoresis, and albumen transfer film carries out anti-HA antibody immunoblottings, the results showed that, (Fig. 1) phase is compareed with pcDNA Than pRIG-I expression~100kD in cell differential protein band (Fig. 1).
The identification of pRIG-I semiotic functions.Plasmid pcDNA pRIG-I transfect 293T cells, and after 48 hours, cell is manually Synthesize double-stranded RNA analog pI:C (low molecule amount, LMW pI:C) 1 μ g/ml transfections stimulate overnight.Extract cell total rna, RT- PCR detects cell downstream cytokine gene and related gene expression (IFN-β, ISG56, ISG60, IL-8, TNF-α).As a result Show that pRIG-I not only has constitutive activity, by pI:C stimulate after can also the gene expression such as mediate downstream cell factor enter One step raises (Fig. 2).
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells (HEK293) are cultivated to degrees of fusion 70%-80%, using expressing NF- κ B luciferin (FLuc) Slow virus (Blasticidin) infects HEK293 cells, and infection cell is sieved with 10 μ g/ml blasticidin Ss (Blasticidin) Choosing obtains the HEK293 cell lines of stable expression NF- κ B reporter genes.It is subcloned through limiting dilution assay twice, cell clone is used TNF-α stimulates cell 6-8 hours, and screening stimulates TNF-α induction to produce high-level NF- kB activations, and height expression FLuc's is slender Born of the same parents clone.Above-mentioned cell clone plasmid TK renilla luciferases (RLuc) and pBabeHygro cotransfections, cell is through 100 μ g/ Stable expression cell is obtained after ml hygromycin B (hygromycin B) screening.Cell is subcloned by limiting dilution assay again, single Individual cell clone is stimulated with various concentrations TNF-α, and choosing to stimulate TNF-α has the high expression of high-level FLuc responses Simultaneous Stabilization RLuc cell clone.
(3) structure of the stable reporter cell lines of pRIG-I-HEK293-NF- κ B：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, are tried using liposome transfection Plasmid pcDNApRIG-1 containing pRIG-I genes is transfected into HEK293-NF- κ B cells by agent Lipofectamine2000, warp The HEK293-NF- κ B cells of expression pRIG-I encoding genes are obtained after 800 μ g/ml G418 screenings, are reflected through three-wheel cytositimulation Fixed screening and expansion culture, the HEK293-NF- κ B Dual-Luciferases stabilization reporter cell for obtaining stable expression pRIG-I genes System.
The invention discloses the stable report of NF- κ B luciferases of stable expression pig source RIG-I (pRIG-I) acceptor gene The preparation method of cell line.On the basis of obtaining HEK293-NF- κ B and stably expressing Dual-Luciferase reporter cell lines, transfection The eukaryon expression plasmid of pRIG-I gene coding regions is expressed, is screened by G418 and obtains stable expression pig source RIG-I (pRIG-I) The NF- κ B Dual-Luciferases report stable cell lines of acceptor gene.As shown in Fig. 2, Fig. 3 and Fig. 4, the stable reporter cells of pRIG-I System compares with control cell, not only with constitutive activity, and can be to stimulant LMW pI:C, which is produced, further specifically should Answer.The function of being configured to further research pRIG-I of the stable reporter cell lines of pRIG-I has established biomaterial basis, favorably In the further abundant research about pRIG-I.Dual-Luciferase report stable cell lines contain internal reference luciferase reporter gene, It can correct and avoid to make result more credible due to error caused by the differences such as cytotoxicity in experiment.
Brief description of the drawings
Fig. 1：Expression of the pRIG-I albumen in transfectional cell.1：PcDNA, 2：pcDNA pRIG-I.
By pcDNA pRIG-I and control pcDNA transfection 293T cells, cell lysate carries out SDS-PAGE after 48 hours, Albumen transfer film carries out anti-HA antibody immunoblottings, detects pRIG-I expression.PRIG-I molecular weight is 104kDa (the 2nd swimming Road), β-actin molecular weight is 42kDa.
Fig. 2：PRIG-I semiotic function identification.
Control plasmid, pcDNA pLGP2 and pcDNA pRIG-I are transfected into 293T cells respectively, 48h after transfection, used respectively Low molecule amount pI:C (LMW), HMW pI:C (HMW) stimulates 293T cells with 1 μ g/mL amount transfection, is collected after stimulating 12h Cell, cell total rna is extracted, carry out RT-PCR, detect the expression of each cell factor.
Fig. 3：The stable reporter cell lines of pRIG-I-NF- κ B signals are to LMW pI:The special responsing reaction that C is stimulated.
The irritaiting concentration of different stimulated agent for stimulating pRIG-I-HEK293-NF- κ B stable expression cell lines is respectively： pam2csk4：100ng/mL、LPS：100ng/mL、FLA-BS：1μg/mL、R837：10μg/mL、R848：10μg/mL、CpG：10 μg/mL、iE-DAP：10μg/mL、MDP:1μg/mL、PMA：100ng/mL, it is direct when cell reaches 70%-80% degrees of fusion Add cytositimulation.pI:The μ g/mL of C (LMW) 1 transfections stimulate.
Fig. 4：Through the repeatedly stable reporter cell lines of passage pRIG-I-NF- κ B to LMW pI:C responsing reaction.
Cell is spread in 96 porocyte culture plates, when cell fusion degree reaches 80%, uses pI:The μ g/mL of C (LMW) 1 are transfected Stimulate, by the use of 100ng/mL PMA as positive control, with kit detection NF- κ B stimulating activity after stimulating overnight.
Embodiment
(1) structure of the pcDNA carrier for expression of eukaryon of the encoding gene containing pRIG-I
The amplification of pRIG-I gene coding regions and clone.
Design a pair of clone PCR primers, sense primer ttcgcGTCGACatgacagcagagcagcggcggaatc (SEQ ID NO.1)；Anti-sense primer is ttcgcCCCGGGctcaaggttgcccattccctgaagacccag (SEQ ID NO.2).From pig PK15 cell extraction total serum IgEs, reverse transcription (RT) generation cDNA, using cDNA as template, PCR expands pRIG-I genes Code area, it is 2.8kb DNA fragmentations that amplification, which obtains size,.PCR fragment is expanded after SalI and SmaI double digestions and with C- ends Entry vector connects through T4 ligases among the Gateway pENTR4 of 2XHA expression labels, connection product transformed competence colibacillus TOP10, conversion bacterium TOP10 coating kalamycin resistance (Kanamycin) bacteria Agr flat boards, recombinant clone is through bacterium colony PCR Identified with digestion, the further DNA sequencing of interstitial granules is verified in the positive.
The construction method of entry vector is as follows among the Gateway pENTR4 with C- ends 2XHA expression labels：
Geting started, (excellent treasured is biological, www.youbio.cn production code members by empty carrier pENTR4-N-FLAG：VT2038) plasmid expands After increasing, with NcoI digestions, agarose gel recovery digestion large fragment, the connection of T4 ligases, TOP10 competent cells, coating are converted Kanamycins (Kanamycin) agar plate.Plasmid is extracted from conversion bacterium colony, DNA sequencing, which determines to obtain, removes N- ends The plasmid pENTR4 of FLAG labels.
Composition sequence atcaccagctacccatacgatgttcctgactatgcgggctatccctatgacgtccc ggact Atgcatag (SEQ ID NO.3) and its complementary series, denaturation annealing form double-stranded blunt end DNA (dsDNA).Plasmid pENTR4 is used EcoR V digestions, alkaline phosphatase (AP) dephosphorylation process, are connected with above-mentioned flush end DNA with T4 ligases, and connection product turns Change TOP10 competent cells, be coated with kanamycins agar plate.Plasmid, EcoR V digestions and DNA are extracted from conversion bacterium colony Sequencing identification.Synthesized DNA sequence dna is 2XHA label coding sequences, and 5 ends add ATCACCAGC, and 3 ends add terminator codon TAG. The HA sequence labels upstream correctly connected remains EcoR V, and downstream is the terminator codon TAG of synthesis.
LR site-specific recombining reactions.
By interstitial granules pENTR4-pRIG-I-2XHA (site containing attL) and purpose in identified and sequence correctly restructuring PcDNA expression vectors pDEST47 (positions containing attR；Addgene, article No. #36139) in LR Clonsae (ThermoFisher, goods Number 12538120) effect is lower carries out site-specific LR recombining reactions, reaction product coating ampicillin (Ampicillin) fine jade Fat culture plate, bacterium colony PCR identification conversion bacterium colonies, plasmid is extracted from positive bacterium colony culture, obtains restructuring purpose expression plasmid pcDNApRIG-I。
Recombinate pcDNApRIG-I expression.
Divide 0.3X106Cells/well is in 24- well culture plates, and second day with lipofectamine lipofectamine2000 (ThermoFisher) 293T for transfecting 1 μ g restructuring pcDNA pRIG-I respectively and compareing in pcDNA to 24- well culture plates is thin Born of the same parents.Cell lysate is subjected to SDS-PAGE electrophoresis after 48 hours, albumen transfer film carries out anti-HA antibody immunoblottings, as a result table Bright pRIG-I expression~100kD in cell differential protein band (Fig. 1).
The identification of pRIG-I semiotic functions.
Plasmid pcDNA pRIG-I transfection 293T cells, RIG-I homologs of the pig source LGP2 as no signal function, Carrier pcDNA is cloned in, in, pcDNA LGP2 and pcDNA is respectively as control plasmid transfectional cell.After 48 hours, cell is used Low molecule amount pI:C(LMW pI:C, InvivoGen, article No.：) and HMW pI tlrl-picw:C(HMW pI:C, InvivoGen, article No.：Tlrl-pic) 1 μ g/ml transfections stimulate overnight.Cell total rna is extracted, RT-PCR detection cells downstream is thin Intracellular cytokine gene and related gene expression (IFN-β, ISG56, ISG60, IL-8, TNF-α), RPL32 compare as internal reference.As a result Show that pRIG-I not only has constitutive activity, by LMW pI:C and HMW pI:C can also mediate downstream cell factor after stimulating Deng the further rise (Fig. 2) of gene expression.
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells (HEK293) are cultivated to degrees of fusion 70%-80%, using expressing NF- κ B luciferin (FLuc) Slow virus (Blasticidin) infects HEK293 cells, and infection cell is sieved with 10 μ g/ml blasticidin Ss (Blasticidin) Choosing obtains the HEK293 cell lines of stable expression NF- κ B reporter genes.Limiting dilution assay is subcloned twice, cell clone TNF- α stimulates cell 6-8 hours, and screening stimulates TNF-α the high-level NF- kB activations of induction generation, unicellular gram of height expression FLuc It is grand.Above-mentioned cell clone plasmid TK renilla luciferases (RLuc) and pBabeHygro cotransfections, cell is through 100 μ g/ml's Stable expression cell is obtained after hygromycin B (hygromycin B) screening.Cell is subcloned by limiting dilution assay again, single thin Born of the same parents clone stimulates (10-100ng/ml) with various concentrations TNF-α, and choosing to stimulate TNF-α has high-level FLuc responses simultaneously Stable high expression RLuc cell clone；Obtain HEK293-NF- κ B Dual-Luciferase reporter cells.
(3) structure of pRIG-I-HEK293-NF- κ B stable expression cell lines：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, are tried using liposome transfection Plasmid pcDNApRIG-1 containing pRIG-I genes is transfected into HEK293-NF- κ B reports carefully by agent Lipofectamine2000 Born of the same parents, the HEK293-NF- κ B cells of expression pRIG-I encoding genes are obtained after 800 μ g/ml G418 is screened 1-2 weeks, through three-wheel Cytositimulation evaluation and screening and expansion culture, the HEK293-NF- κ B Dual-Luciferases stabilization for obtaining stable expression pRIG-I genes Reporter cell lines.
(4) responsing reaction of the pRIG-I-HEK293-NF- κ B stable expression cell lines to different stimulated agent：
Divide 0.3X105PRIG-I-HEK293-NF- κ B cells/hole is incubated overnight in 96- well culture plates, second day use Pam2csk4 (InvivoGen, article No.：Tlrl-pm2s-1), LPS (InvivoGen, article No.：tlrl-b5lps)、FLA-BS (InvivoGen, article No.：Tlrl-bsfla), R837 (InvivoGen, article No.：Tlrl-imqs), R848 (InvivoGen, goods Number：Tlrl-r848), CpG (InvivoGen, article No.：Tlrl-2007), iE-DAP (InvivoGen, article No.：tlrl-dap)、 MDP (InvivoGen, article No.：) and LMW pI tlrl-mdp:C (InvivoGen, article No.：Tlrl-picw pRIG-I-) is stimulated The stable expression cells of HEK293-NF- κ B, PMA (InvivoGen, article No.：Tlrl-pma) as positive stimulus control (Fig. 3).Thorn After swashing 12 hours, double fluorescent element enzyme report test detects activity (the TransDetect Double- of downstream reporter gene Luciferase Reporter Assay Kit, TransGen Biotech, article No., FR201-02).It is specific as follows：Abandon nutrition Liquid, add 50 μ l cell pyrolysis liquids to crack per hole 10 minutes or so, take 20 μ l first to add 15 μ l in 96 hole analysis plates Luciferase Reaction Reagent I, which gently mix to be put into Chemiluminescence Apparatus, reads firefly luciferase report base Because of the activity of (RLuc), add after 15 μ l Luciferase Reaction Reagent II are mixed and read renilla luciferase The activity of reporter gene (FLuc), Fluc the Fluc/Rluc numerical value of each stimulated samples and are not stimulated after Rluc is corrected (Control) comparison values compare, and calculate the stimulation multiple of each stimulated samples.As a result find, pRIG-I-HEK293-NF- κ B are steady Cell line is determined only to LMW pI:C has special response, and to other innate immunity receptor stimulators without obvious response (Fig. 3).
After the stable expression cells of pRIG-I-HEK293-NF- κ B repeatedly passage, divide 0.3X105Cells/well is trained in 96- holes Foster plate is incubated overnight, and second day with differential stimulus agent LMW pI:C (1 μ g/ml) (InvivoGen, article No.：Tlrl-picw) turn Dye stimulates stable cell, PMA (100ng/ml) (InvivoGen, article No.：Tlrl-pma) compareed as positive stimulus.Stimulate 12 Activity (the TransDetect Double- of double fluorescent element enzyme report test detection downstream reporter gene after hour Luciferase Reporter Assay Kit, article No., FR201-02)：Nutrient solution is abandoned, adds 50 μ l cell pyrolysis liquids to split per hole Solution 10 minutes or so, takes 20 μ l in 96 hole analysis plates, it is light first to add 15 μ l Luciferase Reaction Reagent I It is light to mix the activity for being put into and Fluc being read in Chemiluminescence Apparatus, add 15 μ l Luciferase Reaction Reagent II Rluc activity is read after mixing, Fluc the Fluc/Rluc numerical value of each stimulated samples and does not stimulate (No) right after Rluc is corrected According to numeric ratio pair, the stimulation multiple (Fig. 4) of each stimulated samples is calculated.
SEQUENCE LISTING
<110>Yangzhou University
<120>A kind of NF- κ B Dual-Luciferases reporter cells of stable expression pig source RIG-I acceptor genes and its structure side
Method
<130>
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 36
<212> DNA
<213>Artificial sequence
<400> 1
ttcgcgtcga catgacagca gagcagcggc ggaatc 36
<210> 2
<211> 41
<212> DNA
<213>Artificial sequence
<400> 2
ttcgccccgg gctcaaggtt gcccattccc tgaagaccca g 41
<210> 3
<211> 69
<212> DNA
<213>Artificial sequence
<400> 3
atcaccagct acccatacga tgttcctgac tatgcgggct atccctatga cgtcccggac 60
tatgcatag 69

Claims (2)

1. a kind of NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source RIG-I acceptor genes, it is characterised in that be Refer to the HEK293-NF- κ B cells for being transferred to pig source RIG-I acceptor genes, the HEK293-NF- κ B cells are the introduction of NF- κ B The HEK293 cells of luciferase and internal reference renilla luciferase.
2. the structure of the NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source RIG-I (pRIG-I) acceptor gene of one kind Method, it is characterised in that comprise the following steps：
(1) structure of the pcDNA carrier for expression of eukaryon of the encoding gene containing pRIG-I
PCR primer is designed, RT-PCR expands pRIG-I encoding genes from pig PK15 cell RNAs, and amplification PCR fragment is through double digestion Entry vector is attached afterwards and among the Gateway pENTR4 with C- ends HA expression labels；It will mention containing pRIG-I's PENTR4 recombinant plasmids and purpose pcDNA expression vectors pDEST47 carry out LR site-specific recombining reactions, are recombinated PcDNApRIG-I expression plasmids；
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells HEK293 to degrees of fusion 70%-80% is cultivated, utilizes the slow virus sense for expressing NF- κ B luciferin FLuc HEK293 cells are contaminated, infection cell screens the HEK293 for obtaining stable expression NF- κ B reporter genes with 10 μ g/ml blasticidin Ss Cell line；Limiting dilution assay is subcloned twice, and cell clone stimulates cell 6-8 hours with TNF-α, screens and TNF-α stimulation is lured High-level NF- kB activations, height expression FLuc single cell clone are given birth in artificial delivery；Above-mentioned cell clone plasmid TK renilla luciferases RLuc and pBabe Hygro cotransfections, cell obtain stable expression cell after 100 μ g/ml hygromycin B screening；Cell is again It is subcloned by limiting dilution assay, individual cells clone is stimulated with various concentrations TNF-α, and choosing to stimulate TNF-α has Gao Shui The high expression RLuc of flat FLuc responses Simultaneous Stabilization cell clone；
(3) structure of the stable reporter cell lines of pRIG-I-HEK293-NF- κ B：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, utilize lipofectamine Plasmid pcDNApRIG-1 containing pRIG-I genes is transfected into HEK293-NF- κ B cells by Lipofectamine2000, warp The HEK293-NF- κ B cells of expression pRIG-I encoding genes are obtained after 800 μ g/ml G418 screenings, are reflected through three-wheel cytositimulation Fixed screening and expansion culture, the HEK293-NF- κ B Dual-Luciferases stabilization reporter cell for obtaining stable expression pRIG-I genes System.
CN201711089724.8A 2017-11-08 2017-11-08 A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source RIG I acceptor genes Pending CN107828732A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711089724.8A CN107828732A (en) 2017-11-08 2017-11-08 A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source RIG I acceptor genes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711089724.8A CN107828732A (en) 2017-11-08 2017-11-08 A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source RIG I acceptor genes

Publications (1)

Publication Number Publication Date
CN107828732A true CN107828732A (en) 2018-03-23

Family

ID=61653921

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711089724.8A Pending CN107828732A (en) 2017-11-08 2017-11-08 A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source RIG I acceptor genes

Country Status (1)

Country Link
CN (1) CN107828732A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106544322A (en) * 2016-12-06 2017-03-29 东华大学 A kind of reporting system and its construction method for studying Kiss1 gene expression regulations

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106544322A (en) * 2016-12-06 2017-03-29 东华大学 A kind of reporting system and its construction method for studying Kiss1 gene expression regulations

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CZUPRYNA J 等: "Firefly luciferase and RLuc8 exhibit differential sensitivity to oxidative stress in apoptotic cells", 《PLOS ONE》 *
JIANZHONG ZHU 等: "Characterization of bovine Toll-like receptor 8: ligand specificity, signaling essential sites and dimerization", 《MOL IMMUNOL》 *
JIANZHONG ZHU 等: "Porcine TLR8 and TLR7 are both activated by a selective TLR7 ligand, imiquimod", 《MOL IMMUNOL》 *
夏焱 等: "建立doxycycline诱导表达Xaf1的肿瘤细胞株", 《中山大学学报》 *
王荡 等: "猪维甲酸诱导基因I的克隆及其在诱导I型干扰素中的作用", 《畜牧兽医学报》 *

Similar Documents

Publication Publication Date Title
CN107012121A (en) Carry the structure of the stable cell lines of orthogonal tRNA/ aminoacyl tRNA synthetases
CN106459976A (en) Mirnas enhancing cell productivity
US20120282674A1 (en) Method for the preparation of an influenza virus
CN108004270A (en) Utilize the method for luciferase reporter gene detection duck IFN-β promoter activity
US20240076690A1 (en) Viral vectors and uses thereof
CN107841530A (en) Chemical-activated luciferase gene expression chicken interferon α biological activity detection methods
CN102023212B (en) Rapid detection method of influenza virus neuraminidase antibody
CN110205321B (en) DNA fragment and application thereof in construction of recombinant influenza virus expressing red fluorescent protein gene
Guo et al. DEF cell-derived exosomal miR-148a-5p promotes DTMUV replication by negative regulating TLR3 expression
CN105785025A (en) Kit for detecting tick-borne encephalitis virus infected serum
CN107828732A (en) A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source RIG I acceptor genes
CN104513301B (en) Obtained from the cecropin and its encoding gene of Aedes aegypti and application
CN107058325A (en) A kind of crocea interferon regulatory factor IRF7 promoters, nucleic acid construct, cell and its production and use
CN107429248A (en) Non-coding RNA is used for the method and composition of cell culture and selection
CN102191223A (en) Preparation method and applications of H5N1 subtype bird flu pseudovirion
CN107603954A (en) A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes
CN107760653A (en) A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR5 acceptor genes
CN105586344B (en) Inhibit siRNA and its application of influenza virus related gene
WO2023015229A2 (en) Sars-cov-2 virus-like particles
CN107828734A (en) A kind of stable expression pig source TLR3 NF κ B Dual-Luciferases reporter cell lines and its construction method
CN107828735A (en) A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source NOD2 acceptor genes
JP6099075B2 (en) Method for promoting transport of target mRNA from nucleus to cytoplasm, protein expression method and production method, and kit used therefor
CN107603953A (en) A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR7 acceptor genes
Wei et al. A chicken IgY can efficiently inhibit the entry and replication of SARS-CoV-2 by targeting the ACE2 binding domain in vitro
CN107828733A (en) The NF κ B Dual-Luciferases reporter cell lines and its construction method of one plant of stable expression people source TLR8 acceptor gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20180323

WD01 Invention patent application deemed withdrawn after publication