CN107603953A - A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR7 acceptor genes - Google Patents
A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR7 acceptor genes Download PDFInfo
- Publication number
- CN107603953A CN107603953A CN201711089721.4A CN201711089721A CN107603953A CN 107603953 A CN107603953 A CN 107603953A CN 201711089721 A CN201711089721 A CN 201711089721A CN 107603953 A CN107603953 A CN 107603953A
- Authority
- CN
- China
- Prior art keywords
- hek293
- ptlr7
- cell
- cells
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to biological technical field, and in particular to the NF κ B Dual-Luciferases reporter cell lines and its construction method of stable expression pig source TLR7 acceptor genes.The cell line refers to the HEK293 NF κ B cells for being transferred to pig source TLR7 acceptor genes, and the HEK293 NF κ B cells are the introduction of the HEK293 cells of NF κ B luciferases and internal reference renilla luciferase.The present invention, which provides, can be used in studying pTLR7 activation activation downstream NF κ B promoters reporter gene detection stable cell lines.The present invention also provides biomaterial to stablize intracellular difference expression gene under RNA Seq technology high flux screenings pTLR7 silences and the state of activation, and the species specificity for further research TLR7 is laid a good foundation and platform.
Description
Technical field
The invention belongs to biological technical field.More particularly to the NF- κ B of stable expression pig source TLR7 (pTLR7) acceptor gene
Dual-Luciferase reporter cell lines and its construction method.More specifically, the present invention, which provides, can be used in studying pTLR7 and activating swashing
Downstream NF- κ B promoters reporter gene detection stable cell lines living.The present invention is also RNA-Seq technology high flux screenings pTLR7
Stablize intracellular difference expression gene under the silent and state of activation and provide biomaterial, and be further research TLR7 kind
Specificity is laid a good foundation and platform.
Background technology
The type of Toll-like receptor 7 (TLR7), belong to TLR7/8/9 families subclass, be positioned at intracellular.TLR7 and TLR8 knows
Not similar activator：Micromolecule nucleotide analog R848 (Resiquimod) and CL097 and the single stranded RNA rich in GU or U
(ssRNA).In contrast, small molecule activators R837 (Imiquimod) and Loxoribine only specifically activates TLR7.
TLR7 and TLR8 also identify short double-stranded RNA such as RNA interference (RNAi) in double-strand siRNA, the double-strand of tumor cell secretion
MiRNA such as miRNA-21 and miRNA-29a[1].TLR7ECD has 26 LRR motifs, bigger than TLR3；In addition with several larger
Insetion sequence and Unknown Function region (a undefined region, also referred to as Z- between LRR14 and LRR15
loop)；Therefore the space structure of sub-circular is presented in ECD albumin crystals[2].TLR7ECD exists with dimer, binding partner
Afterwards, dimer space conformation changes, and activation causes intracytoplasmic TIR domains to polymerize, and recruits the joint with homeodomain
Molecule MyD88 simultaneously forms signal complex Myddosome, causes downstream transcription factor NF- κ B and IRF7 activation.This two class turns
Record factor difference inducing cell and produce inflammatory cytokine and interferon (IFN).Although TLR7 and TLR8 are much like, have completely
Different cell distributions：The main distribution and expressions in plasmacytoid dendritic cells (pDC) and B cell of TLR7 are thin in medullary system monokaryon
Only a small amount of distribution in born of the same parents, macrophage and traditional dendritic cells (cDC)[3].TLR7 can identify a variety of viruses, including sendai virus
(Sendai virus), influenza virus (Influenza virus), Coxsackie virus (Coxsackie virus), vaccinia virus
(Vaccinia virus), measles virus (Measle virus), respiratory syncytial virus (RSV) (RSV) and retroviruse
(Retrovirus)[4].Also studies have reported that TLR7 identifies streptococcus B group (Group B Streptococcus, GBS) RNA[5]。
(the Mol Immunol.2008Jun in addition to applicant goes over the functional study about pig TLR7；45(11):3238-
43), the TLR7 of also two research report separation identification pigs, studies its RNA stimulating activity, and gene pleiomorphism exists respectively
Distribution in TLR7 genes[6,7]。
Domestic animal TLR signals research contents is deficient, it is necessary to establishes the cell system of research pig TLR7 signal paths.
1.Sarvestani,S.T.,B.R.Williams,and M.P.Gantier,Human Toll-like
receptor 8 can be cool too:implications for foreign RNA sensing.J Interferon
Cytokine Res,2012.32(8):p.350-61.
2.Tanji,H.,et al.,Structural reorganization of the Toll-like receptor
8 dimer induced by agonistic ligands.Science,2013.339(6126):p.1426-9.
3.Ito,T.,et al.,Interferon-alpha and interleukin-12 are induced
differentially by Toll-like receptor 7 ligands in human blood dendritic cell
subsets.J Exp Med,2002.195(11):p.1507-12.
4.Thompson,M.R.,et al.,Pattern recognition receptors and the innate
immune response to viral infection.Viruses,2011.3(6):p.920-40.
5.Mancuso,G.,et al.,Bacterial recognition by TLR7 in the lysosomes of
conventional dendritic cells.Nat Immunol,2009.10(6):p.587-94.
6.Sang Y,Yang J,Ross CR,Rowland RR,Blecha F.Molecular identification
and functional expression of porcine Toll-like receptor(TLR)3 and TLR7.Vet
Immunol Immunopathol.2008 Sep 15；125(1-2):162-7.
7.Morozumi T,Uenishi H.Polymorphism distribution and structural
conservation in RNA-sensing Toll-like receptors 3,7,and 8 in pigs.Biochimica
et Biophysica Acta 1790(2009)267–274.
The content of the invention
It is an object of the invention to provide a kind of NF- κ B Dual-Luciferases report of stable expression pig source TLR7 acceptor genes is thin
Born of the same parents system and its construction method.The present invention is established in the pTLR7 genes independently obtained (see document Mol Immunol.2008Jun；45
(11):3238-43) and on the basis of the stable reporter cell lines of HEK293-NF- κ B Dual-Luciferases, structure, which can be stablized, expresses
The NF- κ B Dual-Luciferases report stable cell lines of pig source TLR7 (pTLR7) acceptor gene.The cell line both can be used for screening
PTLR7 and smaller ligand Imiquimod (R837) identification and combination is verified, follow-up RNA-Seq technologies is can be used for and grinds
Study carefully and stablize intracellular difference expression gene under TLR7 silences and the state of activation.
The technical solution adopted in the present invention is：
A kind of NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source TLR7 acceptor genes, refer to be transferred to pig
Source TLR7 acceptor genes pTLR7 HEK293-NF- κ B cells, the HEK293-NF- κ B cells are the introduction of NF- κ B worm fluorescence
The HEK293 cells of plain enzyme and internal reference renilla luciferase.
The structure of the NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source TLR7 acceptor genes of the present invention
Method is as follows：
(1) structure of the pcDNA carrier for expression of eukaryon of the gene coding region containing pTLR7
The amplification of pTLR7 gene coding regions and clone.PCR primer is designed, RT-PCR is expanded from pig PK15 cell RNAs
PTLR7 encoding genes, amplification PCR fragment enter after double digestion and among the Gateway pENTR4 with C- ends HA expression labels
Door carrier connection, Positive recombinant clones are obtained after bacterium colony PCR and digestion identification.
LR site-specific recombining reactions.By the pENTR4 recombinant plasmids (site containing attL) and purpose containing pTLR7 of identification
PcDNA expression vectors pDEST47 (site containing attR) carries out site-specific recombining reaction, is recombinated through bacterium colony PCR identifications
PcDNA pTLR7 are cloned.
Recombinate pcDNA pTLR7 expression.Recombinate pcDNA pTLR7 transfection 293T cells, cell lysate after 48 hours
SDS-PAGE is carried out, albumen transfer film carries out anti-HA antibody immunoblottings, the results showed that pTLR7 expression~140kD in cell
Differential protein band (Fig. 1).
The identification of pTLR7 semiotic functions.Plasmid pcDNA pTLR7 transfect 293T cells, and after 24 hours, extraction cell is total
RNA, RT-PCR detect cell downstream cytokine gene and related gene expression (IFN-β, IL-8, TNF-α).As a result show
PTLR7 compares with control, can mediate the transcriptional expression of IL-8 and TNF-α.(Fig. 2).
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells (HEK293) are cultivated to degrees of fusion 70%-80%, using expressing NF- κ B luciferin (FLuc)
Slow virus (Blasticidin) infects HEK293 cells, and infection cell is sieved with 10 μ g/ml blasticidin Ss (Blasticidin)
Choosing obtains the HEK293 cell lines of stable expression NF- κ B reporter genes.It is subcloned through limiting dilution assay twice, cell clone is used
TNF-α stimulates cell 6-8 hours, and screening stimulates TNF-α induction to produce high-level NF- kB activations, and height expression FLuc's is slender
Born of the same parents clone.Above-mentioned cell clone plasmid TK renilla luciferases (RLuc) and pBabe Hygro cotransfections, cell is through 100 μ g/
Stable expression cell is obtained after ml hygromycin B (hygromycin B) screening.Cell is subcloned by limiting dilution assay again, single
Individual cell clone is stimulated with various concentrations TNF-α, and choosing to stimulate TNF-α has the high expression of high-level FLuc responses Simultaneous Stabilization
RLuc cell clone..
(3) structure of the stable reporter cell lines of pTLR7-HEK293-NF- κ B：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, are tried using liposome transfection
Plasmid pcDNApTLR7 containing pTLR7 genes is transfected into HEK293-NF- κ B cells by agent Lipofectin2000, through 800 μ
The HEK293-NF- κ B cells of expression pTLR7 encoding genes are obtained after g/ml G418 screenings, identifies and sieves through three-wheel cytositimulation
Choosing and expansion culture, the HEK293-NF- κ B Dual-Luciferases stabilization reporter cell lines for obtaining stable expression pTLR7 genes.
The invention discloses the stable report of NF- κ B luciferases of stable expression pig source TLR7 (pTLR7) acceptor gene is thin
The preparation method of born of the same parents system.On the basis of obtaining HEK293-NF- κ B and stably expressing Dual-Luciferase reporter cell lines, pTLR7 is transfected
The eukaryon expression plasmid of gene, the NF- κ B that stable expression pig source TLR7 (pTLR7) acceptor gene of acquisition is screened by G418 are double glimmering
Light element enzyme reports stable cell lines.The cell can respond (Fig. 3-4) to differential stimulus agent R837.PTLR7 is stable to be reported
The function of being configured to further research pTLR7 of cell line has established biomaterial basis, is advantageous to further to enrich relevant
PTLR7 research.Dual-Luciferase report stable cell lines contain internal reference luciferase reporter gene, can correct and avoid to test
In due to error caused by the differences such as cytotoxicity, make result more credible.
Brief description of the drawings
Fig. 1：Expression of the pTLR7 in transfectional cell.
Fig. 2：The identification of pTLR7 semiotic functions.
Fig. 3：Dual-Luciferase reporter assay checking pTLR7-293-NF- κ B stable cell lines are answered a variety of stimulants
Answer.
Fig. 4：Dual-Luciferase reporter assay examines repeatedly the stable cells of passage pTLR7-293-NF- κ B to the special of R837
Response.
Embodiment
(1) structure and pTLR7 Function Identifications of the pcDNA carrier for expression of eukaryon of the encoding gene containing pTLR7
The amplification of pTLR7 gene coding regions and clone.
A pair of clone PCR primers are designed, sense primer is
ttcgcGTCGACatggtgtttccaatgtggacgttgaagag(SEQ ID NO.1)；Anti-sense primer is
ttcgcCCCGGGggctgtctctttgaacacctgactataggtaac(SEQ ID NO.2).It is total from pig PK15 cell extractions
RNA, reverse transcription (RT) generation cDNA, using cDNA as template, PCR amplification pTLR7 gene coding regions, amplification obtains size and is
3.1kb DNA fragmentation.Expand the Gateway that PCR fragment expresses label after SalI and SmaI double digestions and with C- ends 2XHA
Entry vector connects through T4 ligases among pENTR4, connection product transformed competence colibacillus TOP10, conversion bacterium TOP10 coating cards
That chloramphenicol resistance (Kanamycin) bacteria Agr flat board, recombinant clone identify that interstitial granules enters in the positive through bacterium colony PCR and digestion
One step DNA sequencing is verified.
The construction method of entry vector is as follows among the Gateway pENTR4 with C- ends 2XHA expression labels：
Geting started, (excellent treasured is biological, www.youbio.cn production code members by empty carrier pENTR4-N-FLAG：VT2038) plasmid expands
After increasing, with NcoI digestions, agarose gel recovery digestion large fragment, the connection of T4 ligases, TOP10 competent cells, coating are converted
Kanamycins (Kanamycin) agar plate.Plasmid is extracted from conversion bacterium colony, DNA sequencing, which determines to obtain, removes N- ends
The plasmid pENTR4 of FLAG labels.
Composition sequence atcaccagctacccatacgatgttcctgactatgcgggctatccctatgacgtccc ggact
Atgcatag (SEQ ID NO.3) and its complementary series, denaturation annealing form double-stranded blunt end DNA (dsDNA).Plasmid pENTR4 is used
EcoR V digestions, alkaline phosphatase (AP) dephosphorylation process, are connected with above-mentioned flush end DNA with T4 ligases, and connection product turns
Change TOP10 competent cells, be coated with kanamycins agar plate.Plasmid, EcoR V digestions and DNA are extracted from conversion bacterium colony
Sequencing identification.Synthesized DNA sequence dna is 2XHA label coding sequences, and 5 ends add ATCaccagc, and 3 ends add terminator codon TAG.
The HA sequence labels upstream correctly connected remains EcoR V, and downstream is the terminator codon TAG of synthesis.
LR site-specific recombining reactions.
By interstitial granules pENTR4-pTLR7-2XHA (site containing attL) and purpose in identified and sequence correctly restructuring
PcDNA expression vectors pDEST47 (positions containing attR；Addgene, article No. #36139) in LR Clonsae (ThermoFisher, goods
Number 12538120) effect is lower carries out site-specific LR recombining reactions, and reaction product transformed competence colibacillus DH5 α bacteriums are simultaneously coated with ammonia benzyl
Penicillin (Ampicillin) agar plate.Conversion bacterium colony is identified through bacterium colony PCR, matter is extracted from positive bacterium colony culture
Grain, obtain restructuring purpose expression plasmid pcDNA pTLR7.
Recombinate pcDNA pTLR7 expression.
Divide 0.3X106Cells/well is in 24- well culture plates, and second day with lipofectamine lipofectamine2000
(ThermoFisher) 293T cells in 1 μ g restructuring pcDNA pTLR7 to 24- well culture plates are transfected.Cell cracks after 48 hours
Thing carries out SDS-PAGE, and albumen transfer film carries out anti-HA antibody immunoblottings, the results showed that and pTLR7 expresses in cell~
140kD differential protein band (Fig. 1).
The identification of pTLR7 semiotic functions.
Plasmid pcDNA pTLR7 transfect 293T cells, after 24 hours, extraction pTLR7 and control transfectional cell total serum IgE, and RT-
PCR detects cell downstream cytokine gene and related gene expression (IFN-β, IL-8, TNF-α).As a result show that pTLR7 can be situated between
Lead the transcription (Fig. 2) of IL-8 and TNF-α.Do not detect that stimulations of the pTLR7 to R837 is lived in this experiment for some reason
Property (Fig. 2), but (Mol Immunol.2008Jun in the paper delivered in our prior；45(11):3238-43), Wo Menyong
The experiment of NF- κ B promoters has been explicitly shown pTLR7 and R837 stimulation responses has been reacted.
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells (HEK293) are cultivated to degrees of fusion 70%-80%, using expressing NF- κ B luciferin (FLuc)
Slow virus (Blasticidin) infects HEK293 cells, and infection cell is sieved with 10 μ g/ml blasticidin Ss (Blasticidin)
Choosing obtains the HEK293 cell lines of stable expression NF- κ B reporter genes.Limiting dilution assay is subcloned twice, cell clone TNF-
α stimulates cell 6-8 hours, and screening stimulates TNF-α the high-level NF- kB activations of induction generation, unicellular gram of height expression FLuc
It is grand.Above-mentioned cell clone plasmid TK renilla luciferases (RLuc) and pBabe Hygro cotransfections, cell is through 100 μ g/ml's
Stable expression cell is obtained after hygromycin B (hygromycin B) screening.Cell is subcloned by limiting dilution assay again, single thin
Born of the same parents clone to be stimulated with various concentrations TNF-α, and choosing to stimulate TNF-α has the high expression RLuc of high-level FLuc responses Simultaneous Stabilization
Cell clone.
(3) structure of pTLR7-HEK293-NF- κ B stable expression cell lines：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, are tried using liposome transfection
Plasmid pcDNApTLR7 containing pTLR7 genes is transfected into HEK293-NF- κ B reporter cells by agent Lipofectin2000, warp
800 μ g/ml G418 obtains the HEK293-NF- κ B cells of expression pTLR7 encoding genes after screening 1-2 weeks, pierced through three wheel cellses
Swash evaluation and screening and expand culture, the stable report of HEK293-NF- κ B Dual-Luciferases of the stable expression pTLR7 genes of acquisition carefully
Born of the same parents system.
(4) irritant test of the stable expression cells of pTLR7-HEK293-NF- κ B：
Divide 0.3X105PTLR7-HEK293-NF- κ B cells/hole is incubated overnight in 96- well culture plates, and second day with 13 kinds
Stimulant includes PMA (InvivoGen, article No.：Tlrl-pma), Pam2CSK4 (InvivoGen, article No.：Tlrl-pm2s-1),
LPS-B5 (Standard) (InvivoGen, article No.：Tlrl-b5lps), Flagellin from B.subtilis, FLA-BS
(InvivoGen, article No.：Tlrl-bsfla), Imiquimod (R837) (InvivoGen, article No.：Tlrl-imqs), R848
(Resiquimod) (InvivoGen, article No.：Tlrl-r848), (artificial synthetic oligonucleotide, sequence are SEQ ID to CpG1826
NO.4：TCCATGACGTTCCTGACGTT), (artificial synthetic oligonucleotide, sequence are SEQ ID NO.5 to CpG2006：
TCGTCGTTTTGTCGTTTTGTCGTT), (artificial synthetic oligonucleotide, sequence are SEQ ID NO.6 to CpG2007：
TCCATGACGTTCCTGACGTT), iE-DAP (InvivoGen, article No.：Tlrl-dap), MDP (InvivoGen, article No.：
Tlrl-mdp), Poly (I:C) (HMW) (InvivoGen, article No.：Tlrl-pic), double-strand dsDNA (InvivoGen, article No.：
Tlrl-isdn the stable expression cells (Fig. 3) of pTLR7-HEK293-NF- κ B, after stimulating 12 hours, double fluorescent element enzyme report) are stimulated
Accuse activity (the TransDetect Double-Luciferase Reporter Assay of testing inspection downstream reporter gene
Kit, TRANSBIOTECH, article No., FR201-02).It is specific as follows：Nutrient solution is abandoned, adds 50 μ l cell pyrolysis liquids to crack 10 per hole
Minute or so, 20 μ l are taken in 96 hole analysis plates, are first added 15 μ l Luciferase Reaction Reagent I and are gently mixed
It is even to be put into the activity that firefly luciferase reporter gene (Fluc) is read in Chemiluminescence Apparatus, add 15 μ l
Luciferase Reaction Reagent II read the activity of Renilla luciferase reporter gene (Rluc), Fluc after mixing
After Rluc is corrected, the Fluc/Rluc numerical value of each stimulated samples and do not stimulate (NS) comparison values compare, calculate each stimulated samples
Stimulation multiple (Fig. 3).
After the stable expression cells of pTLR7-HEK293-NF- κ B repeatedly passage, divide 0.3X105Cells/well is trained in 96- holes
Foster plate is incubated overnight, and stimulates stable cell with differential stimulus agent R837 (10 μ g/ml) within second day.It is dual glimmering after stimulating 12 hours
Light element enzyme report test detects activity (the TransDetect Double-Luciferase Reporter of downstream reporter gene
Assay Kit).Nutrient solution is abandoned, adds 50 μ l cell pyrolysis liquids to crack per hole 10 minutes or so, takes 20 μ l in 96 hole analysis plates,
First add 15 μ l Luciferase Reaction Reagent I and gently mix the work for being put into and Fluc being read in Chemiluminescence Apparatus
Property, add after 15 μ l Luciferase Reaction Reagent II are mixed and read Rluc activity, Fluc is through Rluc schools
After just, the Fluc/Rluc numerical value of stimulated samples and do not stimulate (NS) comparison values to compare, calculate the stimulation multiples of stimulated samples
(Fig. 4).
SEQUENCE LISTING
<110>Yangzhou University
<120>A kind of the NF- κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR7 acceptor genes
<130>
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 40
<212> DNA
<213>Artificial sequence
<400> 1
ttcgcgtcga catggtgttt ccaatgtgga cgttgaagag 40
<210> 2
<211> 44
<212> DNA
<213>Artificial sequence
<400> 2
ttcgccccgg gggctgtctc tttgaacacc tgactatagg taac 44
<210> 3
<211> 69
<212> DNA
<213>Artificial sequence
<400> 3
atcaccagct acccatacga tgttcctgac tatgcgggct atccctatga cgtcccggac 60
tatgcatag 69
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
tccatgacgt tcctgacgtt 20
<210> 5
<211> 24
<212> DNA
<213>Artificial sequence
<400> 5
tcgtcgtttt gtcgttttgt cgtt 24
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
tccatgacgt tcctgacgtt 20
Claims (2)
1. a kind of NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source TLR7 acceptor genes, it is characterised in that refer to
Pig source TLR7 acceptor genes pTLR7 HEK293-NF- κ B cells are transferred to, the HEK293-NF- κ B cells are the introduction of NF-
The HEK293 cells of κ B luciferases and internal reference renilla luciferase.
2. a kind of construction method of the NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source TLR7 acceptor genes, it is special
Sign is to comprise the following steps：
(1) structure of the pcDNA carrier for expression of eukaryon of the gene coding region containing pTLR7
PCR primer is designed, RT-PCR expands pTLR7 encoding genes from pig PK15 cell RNAs, and amplification PCR fragment is through double digestion
Connected afterwards with entry vector among the Gateway pENTR4 with C- ends HA expression labels；It will obtain containing pTLR7's
PENTR4 recombinant plasmids and purpose pcDNA expression vectors pDEST47 carry out site-specific recombining reaction, obtain restructuring pcDNA
PTLR7 expression clonings；
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells HEK293 to degrees of fusion 70%-80% is cultivated, utilizes the slow virus sense for expressing NF- κ B luciferin FLuc
HEK293 cells are contaminated, infection cell screens the HEK293 for obtaining stable expression NF- κ B reporter genes with 10 μ g/ml blasticidin Ss
Cell line；Limiting dilution assay is subcloned twice, and cell clone stimulates cell 6-8 hours with TNF-α, screens and TNF-α stimulation is lured
High-level NF- kB activations, height expression FLuc single cell clone are given birth in artificial delivery；Above-mentioned cell clone plasmid TK renilla luciferases
RLuc and pBabe Hygro cotransfections, cell obtain stable expression cell after 100 μ g/ml hygromycin B screening；Cell is again
It is subcloned by limiting dilution assay, individual cells clone is stimulated with various concentrations TNF-α, and choosing to stimulate TNF-α has Gao Shui
The high expression RLuc of flat FLuc responses Simultaneous Stabilization cell clone；
(3) structure of the stable reporter cell lines of pTLR7-HEK293-NF- κ B：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, utilize lipofectamine
Plasmid pcDNApTLR7 containing pTLR7 genes is transfected into HEK293-NF- κ B cells by Lipofectin2000, through 800 μ g/
The HEK293-NF- κ B cells of expression pTLR7 encoding genes are obtained after ml G418 screenings, through three-wheel cytositimulation evaluation and screening
And expand culture, obtain the stable reporter cell lines of HEK293-NF- κ B Dual-Luciferases of stable expression pTLR7 genes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711089721.4A CN107603953A (en) | 2017-11-08 | 2017-11-08 | A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR7 acceptor genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711089721.4A CN107603953A (en) | 2017-11-08 | 2017-11-08 | A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR7 acceptor genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107603953A true CN107603953A (en) | 2018-01-19 |
Family
ID=61086032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711089721.4A Pending CN107603953A (en) | 2017-11-08 | 2017-11-08 | A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR7 acceptor genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107603953A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101260408A (en) * | 2008-03-27 | 2008-09-10 | 武汉大学 | Construction method and application of two-color fluorescence report carrier |
-
2017
- 2017-11-08 CN CN201711089721.4A patent/CN107603953A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101260408A (en) * | 2008-03-27 | 2008-09-10 | 武汉大学 | Construction method and application of two-color fluorescence report carrier |
Non-Patent Citations (5)
| Title |
|---|
| CZUPRYNA J 等: "Firefly luciferase and RLuc8 exhibit differential sensitivity to oxidative stress in apoptotic cells", 《PLOS ONE》 * |
| JIANZHONG ZHU 等: "Characterization of bovine Toll-like receptor 8: ligand specificity, signaling essential sites and dimerization", 《MOL IMMUNOL》 * |
| JIANZHONG ZHU 等: "Porcine TLR8 and TLR7 are both activated by a selective TLR7 ligand, imiquimod", 《MOL IMMUNOL》 * |
| 夏焱 等: "建立doxycycline诱导表达Xaf1的肿瘤细胞株", 《中山大学学报》 * |
| 孙小林: "稳定表达猪Toll样受体5细胞系的构建与初步应用", 《万方数据》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gámbaro et al. | Stable tRNA halves can be sorted into extracellular vesicles and delivered to recipient cells in a concentration-dependent manner | |
| Famulok et al. | Functional aptamers and aptazymes in biotechnology, diagnostics, and therapy | |
| CN114846146B (en) | Engineered guide RNAs for increasing efficiency of CRISPR/Cas12f1 systems and uses thereof | |
| EP2762569B1 (en) | Ngf aptamer and application thereof | |
| Wang et al. | Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity | |
| Nguyen et al. | A novel high‐throughput cell‐based method for integrated quantification of type I interferons and in vitro screening of immunostimulatory RNA drug delivery | |
| CN107012121A (en) | Carry the structure of the stable cell lines of orthogonal tRNA/ aminoacyl tRNA synthetases | |
| CN111088323A (en) | Cell SELEX method for screening transmembrane target protein aptamer, transmembrane target protein aptamer and application of transmembrane target protein aptamer | |
| CN107603953A (en) | A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR7 acceptor genes | |
| US20230272416A1 (en) | Method and system for delivering nucleic acid | |
| Tsukamoto et al. | i-tRAP (individual tRNA acylation PCR): a convenient method for selective quantification of tRNA charging | |
| CN107760653A (en) | A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source TLR5 acceptor genes | |
| CN107619438B (en) | Novel cyclic dinucleotide receptor and method and kit for screening agonist or inhibitor thereof | |
| CN107603954A (en) | A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes | |
| Akimov et al. | DNA barcode-guided lentiviral CRISPRa tool to trace and isolate individual clonal lineages in heterogeneous cancer cell populations | |
| CN108004298A (en) | Chemical-activated luciferase gene expression dog interferon alpha biological activity detection method | |
| Cassan et al. | Expression vectors for quatitating in vivo translational ambiguity: Their potential use to analyse frameshifting at the HIV gag-pol junction | |
| CN103980366B (en) | A kind of interleukin fusion protein and its preparation method and application | |
| CN107828733A (en) | The NF κ B Dual-Luciferases reporter cell lines and its construction method of one plant of stable expression people source TLR8 acceptor gene | |
| CN108660216B (en) | Kit and its detection method based on peripheral blood free nucleotide miRNAs super sensitivity detection device | |
| CN107828734A (en) | A kind of stable expression pig source TLR3 NF κ B Dual-Luciferases reporter cell lines and its construction method | |
| CN107828732A (en) | A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source RIG I acceptor genes | |
| CN107828735A (en) | A kind of the NF κ B Dual-Luciferases reporter cells and construction method of stable expression pig source NOD2 acceptor genes | |
| WO2020028609A1 (en) | Phosphorylation-based mirna sensor | |
| KR20140064399A (en) | Single stranded dna aptamers specifically binding to salmonella typhimurium and production method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180119 |
|
| WD01 | Invention patent application deemed withdrawn after publication |