CN107603954A - A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes - Google Patents
A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes Download PDFInfo
- Publication number
- CN107603954A CN107603954A CN201711089723.3A CN201711089723A CN107603954A CN 107603954 A CN107603954 A CN 107603954A CN 201711089723 A CN201711089723 A CN 201711089723A CN 107603954 A CN107603954 A CN 107603954A
- Authority
- CN
- China
- Prior art keywords
- pcgas
- hek293
- cell
- cells
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to biological technical field, and in particular to the NF κ B Dual-Luciferases reporter cell lines and its construction method of stable expression pig source cGAS acceptor genes.The cell line refers to the HEK293 NF κ B cells for being transferred to pig source cGAS acceptor genes, and the HEK293 NF κ B cells are the introduction of the HEK293 cells of NF κ B luciferases and internal reference renilla luciferase.The present invention provides the stable cell lines that can be used in studying pcGAS activation activation downstream NF κ B promoters reporter gene detections.Function of the present invention also for further research pcGAS has established biomaterial basis, is advantageous to further enrich the research about pcGAS.
Description
Technical field
The invention belongs to biological technical field.More particularly to the NF- κ B of stable expression pig source cGAS (pcGAS) acceptor gene
Dual-Luciferase reporter cell lines and its construction method.More specifically, the present invention, which provides, can be used in studying pcGAS and activating swashing
Downstream NF- κ B promoters reporter gene detection stable cell lines living.Function of the present invention also for further research pcGAS is established
Biomaterial basis, is advantageous to further enrich the research about pcGAS.
Background technology
DNA acceptor annular guanosine adenosine monophosphate synzyme (cyclic GMP-AMP synthase, cGAS)
DNA acceptors are the innate immunity acceptors (PRRs) of later discovery in endochylema, including DAI, DDX41, IFI16, AIM2,
DHX9, DHX36, DDX60, DNA-PK, MRE11 etc..In addition to AIM2 induction inflammation corpusculum activation, after other DNA receptor activations
Antiviral agent and inflammatory factor can be produced with induction of gene transcription.So many DNA acceptors, lead to after DNA is identified in endochylema
Crossing adaptor protein STING excites similar signal path and downstream cytokine to produce, and illustrates these function of receptors largely
It is upper that there is plyability or play antivirus action respectively in different type cell[1]。
CGAS is the endochylema DNA acceptors found recently, and research is very deep, and function is also clear that [2,3,4].CGAS is one
60kda or so albumen, comprising a N-terminal domain being made up of 150 amino acid, one has protease resistant, conservative
Nucleic acid transferase (NTase) C-terminal domain.According to cGAS crystal structure, itself and double-stranded DNA (dsDNA) interaction are
Non-sequence dependence.Double-stranded DNA (dsDNA) can combine cGAS, stimulate cGAS to activate.CGAS has enzymatic activity in itself, with reference to
ATP and GTP can be catalyzed after DNA and forms annular guanosine adenosine monophosphate (cGAMP).CGAMP is that second messenger can be directly in conjunction with simultaneously
Activate adaptor protein STING.Adaptor protein STING is reticulon, and it is related to mitochondria to be also distributed in mitochondria on a small quantity
On film (MAM), after identifying second messenger cGAMP, STING forms dimer and indexing is to around nucleus.The STING of indexing is recruited
Raise protein kinase TBK1, the latter's phosphorylation STING and transcription factor IRF3, inducing type I interferon (IFN) genetic transcription.STING
Also protein kinase IKK, the latter transcriptional factorses NF- κ B are recruited simultaneously, induce inflammatory Cytokines Expression.
CGAS-cGAMP-STING signals play a major role in host identifies and resisted DNA virus, and these viruses include
HSV-1, KSHV, MHV68, RRV and the EBV of herpesviral, papillomavirus HPV, adenovirus, hepatitis B etc..Interesting
It is that cGAS also plays a role in the single positive chain RNA virus in part are resisted, these RNA virus include the yellow fever disease of flaviviridae
Human corona virus (HCoV) severe acute respiratory syndrome virus of malicious (YFV), dengue virus (DENV), hepatitis C virus (HCV) and coronaviridae
(SARS-CoV)[1]。
Studies have reported that isolating functional cGAS from pig, pig cGAS is positioned at cell cytosol and endoplasmic reticulum, mediation
DNA is stimulated, the I type IFN signals dependent on STING and IRF3[5]。
Domestic animal innate immunity acceptor cGAS research contents is deficient, and pig cGAS signal paths only have Primary Study report,
It is necessary to establish the cell system for studying pig cGAS signal paths.
1.Ma Z,Damania B.The cGAS-STING Defense Pathway and Its Counteraction
by Viruses.Cell Host Microbe.2016Feb 10；19(2):150-8.
2.Ablasser,M.Goldeck,T.Cavlar,T.Deimling,G.Witte,I.K.P.Hopfner,
J.Ludwig,V.Hornung.cGAS produces a 2-5′-linked cyclic dinucleotide second
messenger that activates STING.Nature,498(2013),pp.380-384.
3.Sun L,Wu J,Du F,Chen X,Chen ZJ.Cyclic GMP-AMP synthase is a
cytosolic DNA sensor that activates the type I interferon
pathway.Science.2013Feb 15；339(6121):786-91.
4.Gao D,Wu J,Wu YT,Du F,Aroh C,Yan N,Sun L,Chen ZJ.Cyclic GMP-AMP
synthase is an innate immune sensor of HIV and other
retroviruses.Science.2013Aug 23；341(6148):903-6.
5.Wang J,Chu B,Du L,Han Y,Zhang X,Fan S,Wang Y,Yang G.Molecular
cloning and functional characterization of porcine cyclic GMP-AMP
synthase.Mol Immunol.2015Jun；65(2):436-45.
The content of the invention
It is an object of the invention to provide a kind of NF- κ B Dual-Luciferases report of stable expression pig source cGAS acceptor genes is thin
Born of the same parents system and its construction method.Present invention foundation is double glimmering in the cGAS eukaryon expression plasmids and HEK293-NF- κ B of the pig independently obtained
On the basis of the stable reporter cell lines of light element enzyme, the NF- κ B that structure can stablize expression pig source cGAS (pcGAS) acceptor gene are double
Luciferase reporting stable cell lines.The cell line has established biomaterial basis for further research pcGAS function, favorably
In the further abundant research about pcGAS.
The technical solution adopted in the present invention is：
A kind of NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source cGAS acceptor genes, refer to be transferred to pig
The HEK293-NF- κ B cells of source cGAS acceptor genes (pcGAS), it is glimmering that the HEK293-NF- κ B cells are the introduction of NF- κ B worms
The HEK293 cells of light element enzyme and internal reference renilla luciferase.
The structure of the NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source cGAS acceptor genes of the present invention
Method is as follows：
(1) structure of the pcDNA carrier for expression of eukaryon of the coding region gene containing pcGAS
The amplification of pcGAS coding region genes and clone.PCR primer is designed, from the primary pulmonary alveolar macrophage of pig (PAM) RNA
Middle RT-PCR expands pcGAS encoding genes, and amplification PCR fragment expresses the Gateway of label after double digestion and with C- ends HA
Entry vector is connected among pENTR4, and Positive recombinant clones are obtained after bacterium colony PCR and digestion identification.
LR site-specific recombining reactions.By the pENTR4 recombinant plasmids (site containing attL) and purpose containing pcGAS of identification
PcDNA expression vectors pDEST47 (site containing attR) carries out site-specific recombining reaction, is identified through bacterium colony PCR and obtains positive weight
Group pcDNApcGAS clones.
Recombinate pcDNApcGAS expression.PcDNApcGAS transfection 293T cells are recombinated, cell lysate enters after 48 hours
Row SDS-PAGE, albumen transfer film carry out anti-HA antibody immunoblottings, the results showed that pcGAS expression~55kD in cell spy
M-band band (Fig. 1).
The identification of pcGAS semiotic functions.Plasmid pcGAS transfects pig PAM cells, after 24 hours, extracts cell total rna, RT-
PCR detects cell downstream cytokine gene and related gene expression.As a result show to compare with carrier pcDNA transfectional cells,
PcGAS can significantly increase the transcription (Fig. 2A) of ISG60 and IL-8 genes.STING is not expressed in people's 293T cells, we will
PcGAS and STING cotransfection 293T cells, the results showed that the faint induction IFN β transcription of pcGAS itself cans, be total to STING
Transfection can further enhance the expression (Fig. 2 B) of IFN β and TNF α gene.On this basis, we examine pcGAS and STING
Influence of the cotransfection to downstream transcription factor IRF3 and NF- kB activation：Promoter result of the test shows that pcGAS can be mediated significantly
The promoter activation of downstream IRF3 and NF- κ B drivings, the especially activation of IRF3 promoters；Above-mentioned cell pierces by dsDNA
Can further activating promoters reporter gene expression (Fig. 2 C) after swashing.
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells (HEK293) are cultivated to degrees of fusion 70%-80%, using expressing NF- κ B luciferin (FLuc)
Slow virus (Blasticidin) infects HEK293 cells, and infection cell is sieved with 10 μ g/ml blasticidin Ss (Blasticidin)
Choosing obtains the HEK293 cell lines of stable expression NF- κ B reporter genes.Limiting dilution assay is subcloned twice, cell clone TNF-
α stimulates cell 6-8 hours, and screening stimulates TNF-α the high-level NF- kB activations of induction generation, unicellular gram of height expression FLuc
It is grand.Above-mentioned cell clone plasmid TK renilla luciferases (RLuc) and pBabe Hygro cotransfections, cell is through 100 μ g/ml's
Stable expression cell is obtained after hygromycin B (hygromycin B) screening.Cell is subcloned by limiting dilution assay again, single thin
Born of the same parents clone to be stimulated with various concentrations TNF-α, and choosing to stimulate TNF-α has the high expression RLuc of high-level FLuc responses Simultaneous Stabilization
Cell clone.
(3) structure of pcGAS-HEK293-NF- κ B stable expression cell lines：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, are tried using liposome transfection
Plasmid pcDNApcGAS containing pcGAS genes is transfected into HEK293-NF- κ B cells by agent Lipofectin2000, through 800 μ
The HEK293-NF- κ B cells of expression pcGAS encoding genes are obtained after g/ml G418 screenings, identifies and sieves through three-wheel cytositimulation
Choosing and expansion culture, the HEK293-NF- κ B Dual-Luciferase reporter cell lines for obtaining stable expression pcGAS genes.
The invention discloses the stable report of NF- κ B luciferases of stable expression pig source cGAS (pcGAS) acceptor gene is thin
The preparation method of born of the same parents system.On the basis of obtaining HEK293-NF- κ B and stably expressing Dual-Luciferase reporter cell lines, pcGAS is transfected
The eukaryon expression plasmid of gene, the NF- κ B that stable expression pig source cGAS (pcGAS) acceptor gene of acquisition is screened by G418 are double glimmering
Light element enzyme reports stable cell lines.As shown in Figure 3-4：Stimulation of the pcGAS-NF- κ B reporter cells to dsDNA shows specifically to have
The response of effect.The function of being configured to further research pcGAS of the stable reporter cell lines of pcGAS-NF- κ B has established biomaterial
Basis, be advantageous to further enrich the research about pcGAS.Dual-Luciferase report stable cell lines contain internal reference fluorescein report
Gene is accused, can correct and avoid to make result more credible due to error caused by the differences such as cytotoxicity in experiment.
Brief description of the drawings
Fig. 1：Expression of the pcGAS in transfectional cell.
Fig. 2：The identification of pcGAS semiotic functions.A, RT-PCR detect activity of the pcGAS in pig PAM cells are transfected；B,
PcGAS and STING cotransfection 293T cells cause the transcription of downstream cytokine；C, pcGAS and STING cotransfection 293T cells
Cause the expression of downstream transcription factor IRF3 and NF- kB activation and corresponding promoter reporter gene.
Fig. 3：Dual-Luciferase reporter assay examines response of the pcGAS-293-NF- κ B stable cell lines to a variety of stimulants
Reaction.
Fig. 4：The checking of Dual-Luciferase reporter assay repeatedly passes on pcGAS-293-NF- κ B stable cell lines to dsDNA's
Special response.
Embodiment
(1) structure of the pcDNA carrier for expression of eukaryon of the encoding gene containing pcGAS
The amplification of pcGAS gene coding regions and clone.
A pair of clone PCR primers are designed, sense primer is ccagCCATGGcggcccggc (SEQ ID NO.1)；Draw in downstream
Thing is ttcgcGATATCccaaaaaactggaaatccattgtttctttcatattcaatttgctt tgacagaaattctttac
ttgg(SEQ ID NO.2).From the primary PAM cell extractions total serum IgE of pig, reverse transcription (RT) generates cDNA, using cDNA as template,
PCR amplification pcGAS gene coding regions, amplification obtain the DNA fragmentation that size is about 1.5kb.Expand PCR fragment through NcoI and
After EcoRV double digestions and the Gateway pENTR4 centres entry vector with C- ends 2XHA expression labels is through T4 ligases
(NEB) connect, connection product transformed competence colibacillus TOP10, conversion bacterium TOP10 coating kalamycin resistances (Kanamycin) are thin
Bacterio-agar flat board, recombinant clone identify through bacterium colony PCR and digestion, it is positive in the further DNA of interstitial granules pENTR4-pcGAS-2XHA
Sequencing is verified.
The construction method of entry vector is as follows among the Gateway pENTR4 with C- ends 2XHA expression labels：
Geting started, (excellent treasured is biological, www.youbio.cn production code members by empty carrier pENTR4-N-FLAG：VT2038) plasmid expands
After increasing, with NcoI digestions, agarose gel recovery digestion large fragment, the connection of T4 ligases, TOP10 competent cells, coating are converted
Kanamycins (Kanamycin) agar plate.Plasmid is extracted from conversion bacterium colony, DNA sequencing, which determines to obtain, removes N- ends
The plasmid pENTR4 of FLAG labels.
Composition sequence atcaccagctacccatacgatgttcctgactatgcgggctatccctatgacgtccc ggact
Atgcatag (SEQ ID NO.3) and its complementary series, denaturation annealing form double-stranded blunt end DNA (dsDNA).Plasmid pENTR4 is used
EcoR V digestions, alkaline phosphatase (AP) dephosphorylation process, are connected with above-mentioned flush end DNA with T4 ligases, and connection product turns
Change TOP10 competent cells, be coated with kanamycins agar plate.Plasmid, EcoR V digestions and DNA are extracted from conversion bacterium colony
Sequencing identification.Synthesized DNA sequence dna is 2XHA label coding sequences, and 5 ends add ATCACCAGC, and 3 ends add terminator codon TAG.
The HA sequence labels upstream correctly connected remains EcoR V, and downstream is the terminator codon TAG of synthesis.
LR site-specific recombining reactions.
By interstitial granules pENTR4-pcGAS-2XHA (site containing attL) and purpose in identified and sequence correctly restructuring
PcDNA expression vectors pDEST47 (position containing attR, Addgene, article No. #36139) is in LR Clonsae (ThermoFisher, goods
Number 12538120) effect is lower carries out site-specific LR recombining reactions, and connection product transformed competence colibacillus bacterium DH5 α are simultaneously coated with ammonia benzyl
Penicillin (Ampicillin) agar plate, bacterium colony PCR identification conversion bacterium colonies, plasmid is extracted from positive bacterium colony culture,
Obtain restructuring purpose expression plasmid pcDNApcGAS.
Recombinate pcDNApcGAS expression.
Divide 0.3X106Cells/well is in 24- well culture plates, and second day with lipofectamine lipofectamine2000
(ThermoFisher) 293T cells in 1 μ g restructuring pcDNA pcGAS to 24- well culture plates are transfected.Cell cracks after 48 hours
Thing carries out SDS-PAGE, and albumen transfer film carries out anti-HA antibody immunoblottings, the results showed that pcGAS expression~55kD in cell
Differential protein band (Fig. 1).
The identification of pcGAS semiotic functions.
Test 1, pcGAS transfection porcine alveolar macrophages (PAM) activation downstream cytokine transcription (Fig. 2A).Point
0.3X106Cells/well is incubated overnight in 24- well culture plates, and second day with lipofectamine lipofectamine2000
(ThermoFisher) PAM cells in 1 μ g restructuring pcDNA pcGAS to 24- well culture plates are transfected.After transfection 24 hours, extraction
Cell total rna, RT-PCR detection cell downstream cytokine genes and related gene expression, including ISG60, IL8, β-actin.
The agarose gel electrophoresis that PCR primer carries out 1.5% checks above-mentioned cytokine gene transcription.
Test 2, pcGAS and STING cotransfection 293T cell-stimulatings downstream cytokine transcription (Fig. 2 B).Divide 0.3X106
Cells/well is incubated overnight in 24- well culture plates, if control group pcDNA (1.0 μ g) and experimental group pcDNA (0.5 μ g)+pcGAS
(0.5 μ g), pcDNA (0.5 μ g)+STING (0.5 μ g), pcGAS (0.5 μ g)+STING (0.5 μ g), turned with liposome within second day
The above-mentioned 1 μ g plasmids of transfection reagent lipofectamine2000 (ThermoFisher) cotransfection 293T into 24- well culture plates respectively
Cell.After transfection 24 hours, cell total rna, RT-PCR detection cell downstream cytokine genes and related gene expression are extracted,
Including IFN-β, ISG60, TNF-α and RPL32.The agarose gel electrophoresis that PCR primer carries out 1.5% checks above-mentioned cell factor
Genetic transcription.
Test 3, pcGAS and STING cotransfection 293T cell-stimulatings downstream transcription factor activation (Fig. 2 C).Divide 0.3X105
Cells/well is incubated overnight in 96- well culture plates.Transfection experiment is divided into ISG/IRF promoter reporter gene groups and ELAM/NF- κ B
Promoter reporter gene group, control group are respectively ISG-ctr, ELAM-ctr；Experimental group is cGAS, and (dosage is every by cGAS+STING
Hole cGAS 20ng, STING 10ng, ISG/ELAM 10ng, RL-luc 0.2ng), every group is supplemented to 50ng with pcDNA.It is above-mentioned
Transfectional cell is not stimulated or transfected with dsDNA (1 μ g/ml) and stimulated.Use lipofectamine within second day
Lipofectamine2000 (ThermoFisher) transfects 50ng plasmids into 96- well culture plates per hole 293T cells.Transfection 24
After hour cell is stimulated with the μ g/ml of double-stranded DNA (dsDNA) 1 by transfecting.After stimulating 12 hours, collect cell and do double fluorescent
The experiment of plain enzyme reporter gene assays (TransDetect Double-Luciferase Reporter Assay Kit,
TRANSBIOTECH, article No., FR201-02)：Cell nutrient solution is discarded, 50 μ l1 × cell pyrolysis liquid jog cracking is added per hole
Cell about 10 minutes, treats that cell fully cracks, and takes 20 μ l to add in the white analysis plates of 96- holes, adds 15 μ l Luciferase
Reaction Reagent I, which gently mix to be put into Chemiluminescence Apparatus, reads firefly luciferase reporter gene (Fluc)
Activity, add after 15 μ l Luciferase Reaction Reagent II are mixed and read Renilla luciferase reporter gene
(Rluc) activity.Fluc numerical value after Rluc data calibrations, all transfection samples respectively with corresponding ISG/IRF reporter genes
Compared with the control of ELAM/NF- κ B reporter genes to (Fig. 2 C).
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells (HEK293) are cultivated to degrees of fusion 70%-80%, using expressing NF- κ B luciferin (FLuc)
Slow virus (Blasticidin) infects HEK293 cells, and infection cell is sieved with 10 μ g/ml blasticidin Ss (Blasticidin)
Choosing obtains the HEK293 cell lines of stable expression NF- κ B reporter genes.Limiting dilution assay is subcloned twice, cell clone TNF-
α stimulates cell 6-8 hours, and screening stimulates TNF-α the high-level NF- kB activations of induction generation, unicellular gram of height expression FLuc
It is grand.Above-mentioned cell clone plasmid TK renilla luciferases (RLuc) and pBabe Hygro cotransfections, cell is through 100 μ g/ml's
Stable expression cell is obtained after hygromycin B (hygromycin B) screening.Cell is subcloned by limiting dilution assay again, single thin
Born of the same parents clone stimulates (10-100ng/ml) with various concentrations TNF-α, and choosing to stimulate TNF-α has high-level FLuc responses simultaneously
Stable high expression RLuc cell clone；Obtain HEK293-NF- κ B Dual-Luciferase reporter cells.
(3) structure of pcGAS-HEK293-NF- κ B stable expression cell lines：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, are tried using liposome transfection
Plasmid pcDNApcGAS containing pcGAS genes is transfected into HEK293-NF- κ B reporter cells by agent Lipofectin2000, warp
800 μ g/ml G418 (InvivoGen) obtains the HEK293-NF- κ B cells of expression pcGAS encoding genes after screening 1-2 weeks,
Through three-wheel cytositimulation evaluation and screening and expand culture, the stable double fluoresceins of HEK293-NF- κ B for expressing pcGAS genes of acquisition
The stable reporter cell lines of enzyme.
(4) irritant test of the stable expression cells of pcGAS-HEK293-NF- κ B：
Divide 0.3X105PcGAS-HEK293-NF- κ B cells/hole is incubated overnight in 96- well culture plates, and second day with 15 kinds
Stimulant includes PMA (InvivoGen, article No.：Tlrl-pma), Pam2CSK4 (InvivoGen, article No.：Tlrl-pm2s-1),
LPS-B5 (Standard) (InvivoGen, article No.：Tlrl-b5lps), Flagellin from B.subtilis, FLA-BS
(InvivoGen, article No.：Tlrl-bsfla), Imiquimod (R837) (InvivoGen, article No.：Tlrl-imqs), R848
(Resiquimod) (InvivoGen, article No.：Tlrl-r848), (artificial synthetic oligonucleotide, sequence are SEQ ID to CpG1826
NO.4：TCCATGACGTTCCTGACGTT), CpG2006 (artificial synthetic oligonucleotide, sequence SEQ ID NO.5：
TCGTCGTTTTGTCGTTTTGTCGTT), (artificial synthetic oligonucleotide, sequence are SEQ ID NO.6 to CpG2007：
TCCATGACGTTCCTGACGTT), iE-DAP (InvivoGen, article No.：Tlrl-dap), MDP (InvivoGen, article No.：
Tlrl-mdp), Poly (I:C) (HMW) (InvivoGen, article No.：Tlrl-pic), double-strand dsDNA (InvivoGen, article No.：
Tlrl-isdn), the stable expression cells (Fig. 3) of pcGAS-HEK293-NF- κ B, after stimulating 12 hours, double fluorescent element enzyme are stimulated
Report test detects activity (the TransDetect Double-Luciferase Reporter Assay of downstream reporter gene
Kit, article No., FR201-02)：Nutrient solution is abandoned, adds 50 μ l cell pyrolysis liquids to crack per hole 10 minutes or so, takes 20 μ l in 96 holes point
Analyse in plate, first add 15 μ l Luciferase Reaction Reagent I and gently mix to be put into Chemiluminescence Apparatus and read firefly
The activity of fireworm luciferase reporter gene (Fluc), add 15 μ l Luciferase Reaction Reagent II and mix
The activity of Renilla luciferase reporter gene (Rluc) is read afterwards, and Fluc is after Rluc is corrected, the Fluc/Rluc of each stimulated samples
Numerical value and do not stimulate (NS) comparison values to compare, calculate the stimulation multiples (Fig. 3) of each stimulated samples.
After the stable expression cells of pcGAS-HEK293-NF- κ B repeatedly passage, divide 0.3X105Cells/well is trained in 96- holes
Foster plate is incubated overnight, and second day with differential stimulus agent dsDNA (1 μ g/ml；InvivoGen, article No.：Tlrl-isdn) transfection thorn
Swash stable cell.Activity (the TransDetect of double fluorescent element enzyme report test detection downstream reporter gene after stimulating 12 hours
Double-Luciferase Reporter Assay Kit, article No., FR201-02)：Nutrient solution is abandoned, adds 50 μ l cells to split per hole
Solve liquid to crack 10 minutes or so, take 20 μ l in 96 hole analysis plates, first add 15 μ l Luciferase Reaction
Reagent I gently mix the activity for being put into and Fluc being read in Chemiluminescence Apparatus, add 15 μ l Luciferase
Reaction Reagent II read Rluc activity after mixing, Fluc is after Rluc is corrected, the Fluc/Rluc numbers of stimulated samples
Value and do not stimulate (NS) comparison values compare, calculate stimulated samples stimulate multiple (Fig. 4).
SEQUENCE LISTING
<110>Yangzhou University
<120>A kind of the NF- κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes
<130>
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence
<400> 1
ccagccatgg cggcccggc 19
<210> 2
<211> 77
<212> DNA
<213>Artificial sequence
<400> 2
ttcgcgatat cccaaaaaac tggaaatcca ttgtttcttt catattcaat ttgctttgac 60
agaaattctt tacttgg 77
<210> 3
<211> 69
<212> DNA
<213>Artificial sequence
<400> 3
atcaccagct acccatacga tgttcctgac tatgcgggct atccctatga cgtcccggac 60
tatgcatag 69
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
tccatgacgt tcctgacgtt 20
<210> 5
<211> 24
<212> DNA
<213>Artificial sequence
<400> 5
tcgtcgtttt gtcgttttgt cgtt 24
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
tccatgacgt tcctgacgtt 20
Claims (2)
1. a kind of NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source cGAS acceptor genes, it is characterised in that refer to
The HEK293-NF- κ B cells of pig source cGAS acceptor genes (pcGAS) are transferred to, the HEK293-NF- κ B cells are the introduction of
The HEK293 cells of NF- κ B luciferases and internal reference renilla luciferase.
2. a kind of construction method of the NF- κ B Dual-Luciferase reporter cell lines of stable expression pig source cGAS acceptor genes, it is special
Sign is to comprise the following steps：
(1) structure of the pcDNA carrier for expression of eukaryon of the coding region gene containing pcGAS
PCR primer is designed, RT-PCR expands pcGAS encoding genes from the primary pulmonary alveolar macrophage PAM of pig RNA, expands PCR
Fragment is connected after double digestion with entry vector among the Gateway pENTR4 with C- ends HA expression labels；What is obtained contains
PcGAS pENTR4 recombinant plasmids and purpose pcDNA expression vectors pDEST47 carries out site-specific recombining reaction, obtains positive
Recombinate pcDNApcGAS expression clonings；
(2) structure of the stable reporter cell of HEK293-NF- κ B Dual-Luciferases：
Human embryonic kidney cells HEK293 to degrees of fusion 70%-80% is cultivated, utilizes the slow virus sense for expressing NF- κ B luciferin FLuc
HEK293 cells are contaminated, infection cell screens the HEK293 for obtaining stable expression NF- κ B reporter genes with 10 μ g/ml blasticidin Ss
Cell line；Limiting dilution assay is subcloned twice, and cell clone stimulates cell 6-8 hours with TNF-α, screens and TNF-α stimulation is lured
High-level NF- kB activations, height expression FLuc single cell clone are given birth in artificial delivery；Above-mentioned cell clone plasmid TK renilla luciferases
RLuc and pBabe Hygro cotransfections, cell obtain stable expression cell after 100 μ g/ml hygromycin B screening；Cell is again
It is subcloned by limiting dilution assay, individual cells clone is stimulated with various concentrations TNF-α, and choosing to stimulate TNF-α has Gao Shui
The high expression RLuc of flat FLuc responses Simultaneous Stabilization cell clone；
(3) structure of pcGAS-HEK293-NF- κ B stable expression cell lines：
HEK293-NF- κ B Dual-Luciferases reporter cells are cultivated to degrees of fusion 70%-80%, utilize lipofectamine
Plasmid pcDNApcGAS containing pcGAS genes is transfected into HEK293-NF- κ B cells by Lipofectin2000, through 800 μ g/
The HEK293-NF- κ B cells of expression pcGAS encoding genes are obtained after ml G418 screenings, through three-wheel cytositimulation evaluation and screening
And expand culture, obtain the HEK293-NF- κ B Dual-Luciferase reporter cell lines of stable expression pcGAS genes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711089723.3A CN107603954A (en) | 2017-11-08 | 2017-11-08 | A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711089723.3A CN107603954A (en) | 2017-11-08 | 2017-11-08 | A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107603954A true CN107603954A (en) | 2018-01-19 |
Family
ID=61086519
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711089723.3A Pending CN107603954A (en) | 2017-11-08 | 2017-11-08 | A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107603954A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536492A (en) * | 2018-05-09 | 2019-03-29 | 江苏省人民医院 | People cGAS gene promoter area transcriptional regulatory element and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101372708A (en) * | 2008-10-17 | 2009-02-25 | 厦门大学 | Method for screening compound with testicular hormone receptor 3 as target spot |
| CN107190021A (en) * | 2017-06-20 | 2017-09-22 | 华中科技大学 | A kind of cell line of expression EDAR genes and the preparation and application of receptor stimulating agent |
-
2017
- 2017-11-08 CN CN201711089723.3A patent/CN107603954A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101372708A (en) * | 2008-10-17 | 2009-02-25 | 厦门大学 | Method for screening compound with testicular hormone receptor 3 as target spot |
| CN107190021A (en) * | 2017-06-20 | 2017-09-22 | 华中科技大学 | A kind of cell line of expression EDAR genes and the preparation and application of receptor stimulating agent |
Non-Patent Citations (7)
| Title |
|---|
| CZUPRYNA J 等: "Firefly luciferase and RLuc8 exhibit differential sensitivity to oxidative stress in apoptotic cells", 《PLOS ONE》 * |
| JIANZHONG ZHU 等: "Characterization of bovine Toll-like receptor 8: ligand specificity, signaling essential sites and dimerization", 《MOL IMMUNOL》 * |
| JIANZHONG ZHU 等: "Porcine TLR8 and TLR7 are both activated by a selective TLR7 ligand, imiquimod", 《MOL IMMUNOL》 * |
| RUN FANG 等: "NEMO-IKKβ Are Essential for IRF3 and NF-κB Activation in the cGAS-STING Pathway", 《J IMMUNOL》 * |
| 元英进 主编: "《现代制药工艺学 上册》", 31 July 2004, 化学工业出版社 * |
| 夏焱 等: "建立doxycycline诱导表达Xaf1的肿瘤细胞株", 《中山大学学报》 * |
| 杜丽丽 等: "猪cGAS基因的克隆与原核表达", 《中国农业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536492A (en) * | 2018-05-09 | 2019-03-29 | 江苏省人民医院 | People cGAS gene promoter area transcriptional regulatory element and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cao et al. | Nontoxic nanopore electroporation for effective intracellular delivery of biological macromolecules | |
| Morrison et al. | Innate immunity evasion by Dengue virus | |
| Patil et al. | TRIM41-mediated ubiquitination of nucleoprotein limits influenza A virus infection | |
| Lin et al. | Identification of RNA helicase A as a cellular factor that interacts with influenza A virus NS1 protein and its role in the virus life cycle | |
| Jiang et al. | Innate immune responses in human monocyte-derived dendritic cells are highly dependent on the size and the 5′ phosphorylation of RNA molecules | |
| Boutte et al. | Bacterial lifestyle shapes stringent response activation | |
| Schoggins et al. | A diverse range of gene products are effectors of the type I interferon antiviral response | |
| CN110402287A (en) | CRISPR/Cpf1 system and method | |
| Xia et al. | The ER membrane adaptor ERAdP senses the bacterial second messenger c-di-AMP and initiates anti-bacterial immunity | |
| Kendra et al. | Ablation of programmed− 1 ribosomal frameshifting in Venezuelan equine encephalitis virus results in attenuated neuropathogenicity | |
| CN102112624A (en) | Compositions and methods for spatial separation and screening of cells | |
| Tasker et al. | IFN-ε protects primary macrophages against HIV infection | |
| Deng et al. | Structure-guided mutagenesis alters deubiquitinating activity and attenuates pathogenesis of a murine coronavirus | |
| US20240043909A1 (en) | Methods and platform for screening and selecting metabolites and their receptors | |
| Yuan et al. | A local, interactive network of 3′ RNA elements supports translation and replication of Turnip crinkle virus | |
| Sivaramakrishnan et al. | Evidence for extracellular ATP as a stress signal in a single-celled organism | |
| Gallo et al. | Interactions of viral proteins from pathogenic and low or non-pathogenic orthohantaviruses with human type I interferon signaling | |
| CN107603954A (en) | A kind of the NF κ B Dual-Luciferases reporter cells and its construction method of stable expression pig source cGAS acceptor genes | |
| CN104099357B (en) | The method of detection protein stability and application thereof | |
| Tian et al. | Differential involvement of Gα16 in CC chemokine-induced stimulation of phospholipase Cβ, ERK, and chemotaxis | |
| Rye-McCurdy et al. | Mechanistic differences between nucleic acid chaperone activities of the Gag proteins of Rous sarcoma virus and human immunodeficiency virus type 1 are attributed to the MA domain | |
| CN105586344B (en) | Inhibit siRNA and its application of influenza virus related gene | |
| Zhang et al. | Antiviral effects of interferon-stimulated genes in bats | |
| CN105349544A (en) | Nucleic acid aptamer S3 of Staphylococcus aureus enterotoxin A and application thereof | |
| WO2019072048A1 (en) | Method and kit for screening novel cyclic dinucleotide receptor and agonist or inhibitor thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180119 |
|
| RJ01 | Rejection of invention patent application after publication |