CN107723296A - Application of the GRMZM2G417164 genes in stomata development - Google Patents
Application of the GRMZM2G417164 genes in stomata development Download PDFInfo
- Publication number
- CN107723296A CN107723296A CN201711147439.7A CN201711147439A CN107723296A CN 107723296 A CN107723296 A CN 107723296A CN 201711147439 A CN201711147439 A CN 201711147439A CN 107723296 A CN107723296 A CN 107723296A
- Authority
- CN
- China
- Prior art keywords
- cell
- gene
- corn
- stomata
- guard
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to corn gene field of engineering technology, and in particular to cornGRMZM2G417164Patent application of the gene in regulation stomata development application.CornGRMZM2G417164Regulate and control some genes relevant with stomata development as transcription factor, have adjusted the correlated process of corn stomata development.A series of experiments proves,GRMZM2G417164The final longitudinal division formation guard cell of signal transmission and guard-cell mother cell of the protein control guard-cell mother cell to accessory cell mother cell of coded by said gene, after the gene mutation body, plant can not form normal guard cell and accessory cell.Therefore, it is rightGRMZM2G417164The further investigation and analysis of gene function, for exploring the developmental mechanism of corn stomata, improveing the resistance of corn, there is important theory significance and actual application value.
Description
Technical field
The present invention relates to corn gene field of engineering technology, and in particular to cornGRMZM2G417164Gene is in regulation gas
The patent application of hole development application.
Background technology
Stomata is the aperture on plant leaf blade, is controlled by two guard cells and opens or close, be plant moisture scatter and disappear and
CO2The door of plant is passed in and out, it is most important to growth and development of plants.Stomata mainly exists in terrestrial plant, and plant by
The aquatic crucial evolution to terrestrial, there is stomata just plant has been adapted to terrestial enviornment.
In monocotyledon, stomata is made up of two accessory cells in a pair of guard cells and outside.The shape of accessory cell
Induced into by guard-cell mother cell, developed by accessory cell mother cell Asymmetric division, mainly auxiliary is protected
Guard cell adjusts the opening and closing of stomata.The development of stomata is influenceed by a variety of inherent and extrinsic factors.Internal factor is mainly thin
Secretion peptide, acceptor, kinases and several transcription factors of intracellular；Extrinsic factor is mainly light, CO2, the envirment factor such as humidity.
Stomata is also the receptor and effector that plant experiences the various adverse circumstance signals such as arid, cold.Study stomata development machine
System, more reasonably improve corn resistance using stomata for us and play an important role.But in corn related stomata mutant compared with
Few, hysteresis is compared in research.Thus strengthen for the research with stomata development related gene, can be new variety of plant cultivation and plant
Degeneration-resistant research provides new approach and thinking.
The content of the invention
It is related to the development of corn stomata it is an object of the invention to provide oneGRMZM2G417164Gene（Corn is given birth to
Thing information database：https://www.maizegdb.org/）, can be that new variety of plant is trained by the research to gene function
Educate and establish certain theoretical and application foundation.
Details are as follows for the technical scheme that the application is taken.
CornGRMZM2G41716For gene in the application of stomata development, the gene is related to the development of corn stomata, should
Signal transmission and guarantor of the guard-cell mother cell to accessory cell mother cell in the development of the protein regulation of gene code stomata
The final longitudinal division of guard cell mother cell forms the coherent signal transmission of guard cell；
Specifically, the gene participates in：（1）Guard-cell mother cell induces accessory cell mother cell polarity, not
Symmetrical fissions form accessory cell process；With（2）Guard-cell mother cell longitudinal division forms two ripe guard cell's processes；
By the gene mutation（Pass through the technological means such as gene insertion or gene silencing）After inactivation, i.e. cornGRMZM2G417164After gene is beyond expression, mutant（CornGRMZM2G417164Gene mutation body, that is, lack cornGRMZM2G417164Gene）Plant can not form normal guard cell and accessory cell, i.e., can not form normal stomata
（For corn, the mutant plants for lacking stomata are dead in tri-leaf period）.
One kind cultivates new variety of plant method, passes through technique for gene engineering means（Such as inserted by gene, gene sinks
It is silent）, inciting somebody to actionGRMZM2G41716After gene carries out partial inactivation, to be formed because plant part stomata can not develop, therefore can obtain
Obtain the new variety of plant of plant resistance to environment stress lifting.
In the prior art, for the related gene related to the development of corn stomata such asPAN1、PAN2、ZmFAMADeng gene
There is Primary Study.But in general, correlative study is still relatively limited.
In the application, the discovery based on specific corn stomata related mutants（The mutant can not form normal defendance
Cell and accessory cell；Leaf water content is high, aquation；Aetiolation, death after tri-leaf period.）, further pass through map based cloning skill
Art, obtain directly related with the mutant phenotypeGRMZM2G417164Gene.After further investigation, inventor has found：CornGRMZM2G417164Regulate and control some genes relevant with stomata development as transcription factor, have adjusted the development of corn stomata
Correlated process.A series of experiments proves,GRMZM2G417164The protein of coded by said gene controls guard-cell mother cell to pair
The signal transmission of guard cell mother cell and the final longitudinal division of guard-cell mother cell form guard cell, the gene mutation
Afterwards, plant can not form normal guard cell and accessory cell.Therefore, it is rightGRMZM2G417164Gene function is deeply ground
Study carefully and analyze, for exploring the developmental mechanism of corn stomata, improveing the resistance of corn, there is important theory significance and reality
Application value.
Brief description of the drawings
Fig. 1 be experimental plot maize planting WT,bzu2-1Seedling phenotypes；
(A) after seed is sprouted 5 days, compared with wild type,bzu2-1Mutant seedlings yellow, and blade is normal in wild type
（Scale bar = 2.0 cm）；After 14 d,bzu2-1The withered death of mutant plants（Scale bar = 1.0 cm）；
(B) wild type andbzu2-1DIC (the differential interference of blade epidermis in mutant
Contrast) picture（Scale bar = 50 µm）；
(C) bzu2-1Mutant is slower than wild type dehydration, 3 repetitions, and error line is standard variance, and T is examined, * *P<0.01；
(D) chlorophyll imager detection wild type andbzu2-1Middle photosynthetic efficiency,bzu2-1Mutant photosynthetic efficiency
Less than wild type；
(E) in photosynthesizer II, maximum quantum conversion efficiency (Fv/Fm), 6 repetitions, error line is standard variance, and T is examined
Test, * *P<0.01；
(F) far infrared imagery instrument detectsbzu2-1With blade face temperature in wild type,bzu2-1Mutant blade face temperature is high；
(G) bzu2-1Blade face temperature (DEG C) is higher than wild type blade face temperature；10 repetitions, error line are standard variance, and T is examined
Test, * *P<0.01；
Fig. 2 isBZU2Map based cloning and CRISPR-Cas9 checkings；
(A) by BZU1 fine map based cloning, in Bin 8.03 SSR marker withBZU2It is chain, willBZU2It is positioned at 79M15
Between 79M45 in about 700 kb region, the region shares the gene (portion gene is only listed in figure) of 15 structural integrities；
(B) GRMZM2G417164 isBZU2, the bp of code area total length 660；bzu2-1In,BZU2The 390th in coding region sequence
4 bases of AGCT, T and AG composition terminator codons below are inserted at bp, terminator codon in advance occurs, causes BZU2
Translation terminates in advance, and protein function is lost；
(C) bzu2-2、bzu2-3Withbzu2-4Mutational site,bzu2-25 bases are lacked behind middle PAM sites,bzu2-3In
25 bases are lacked behind PAM sites,bzu2-41 base of middle insertion；CRISPR-Cas9 PAM sites are located atBZU2In sequence
At 289 bases；
(D) wild type,bzu2-1,bzu2-2、bzu2-3Withbzu2-4In phenotype（Scale bar = 50 µm）；
Fig. 3 isBZU2As bHLH classes transcription factor and nuclear location；BZU2 utilizes Agrobacterium in Tobacco Epidermis core is positioned
The instantaneous conversion system of mediation is by 35S::GFP and 35S:: BZU2:GFP injections are entered in Tobacco Epidermis, after 24 h
In laser confocal microscope（ZEISS LSM700）Lower observation, 35S::H2B:MCherry marks as nuclear location（Scale
bars=50 μm）；
Fig. 4 proves in situ hybridizationBZU2The expression pattern in stomata growth course；In in situ hybridization, T7 promoters are utilized in vitro
Transcribe out BZU2 mRNA anti sense and sense probes, the section hybridization that the tissue of probe and stomata developmental stage is made
（Scale bar = 50 μm）；
Fig. 5 is corn stomata growth course figure, for show WT andbzu2-1Development difference；
（A）Epidermis archaeocyte is formed guard-cell mother cell (green under coloured image) and induced by an Asymmetric division
Neighbouring cell forms accessory cell mother cell (light red under coloured image), accessory cell mother cell Asymmetric division, is formed
Accessory cell（Yellow under coloured image）；Guard-cell mother cell symmetrical fissions form guard cell, eventually form ripe stomata
Complex；Andbzu2-1In these Process lacks；
（B）Wild type andbzu2-1Middle stomata developmental process and F-actin (green under coloured image) positioning result（Figure top
The forming process of stomata is expressed as, is followed successively by from left to right：Epidermis archaeocyte → guard-cell mother cell → guard cell → into
Ripe Stomatal regulation）：In wild type, F-actin enrichments are positioned in accessory cell mother cell to be combined with guard-cell mother cell
Site；bzu2-1In, the enrichment in the site that F-actin is combined in accessory cell mother cell with guard-cell mother cell disappears
Lose（Scale bar=25 µm）.
Embodiment
The present invention is further explained with reference to embodiment, before specific embodiment is introduced, with regard to following realities
Apply be related in example part biological material Background situation briefly introduce be described as follows.
Biomaterial：
CornGRMZM2G417164Gene mutation body（bzu2-1Mutant）And its corresponding wild type, material is obtained for that can disclose,
From Maize Genetics Cooperation Stock Center, it is named asbzu2-1；It is to be understood that the application
Before forbzu2-1Mutant gene is simultaneously unconfirmed, i.e.bzu2-1It is not that specially which gene, which is undergone mutation, in mutant
Know.
Embodiment
Due to the application related art scheme and related mutants Phenotypic Observation and related gene identification, confirmation height phase
Close, thus with regard to cornGRMZM2G417164The phenotype anomaly and its mutator of gene mutation bodyGRMZM2G417164Base
The confirmation process of cause is briefly discussed below.
（One）Cornbzu2-1The phenotype of mutant is abnormal
By wild type（CornGRMZM2G417164Gene normal expression strain）Withbzu2-1Mutant is planted in experimental plot simultaneously,
Normal photoperiod and planting conditions.After one week, seed, which is sprouted, to be unearthed, and wild type seedlings growth is normal, butbzu2-1Seedling goes out
Existing aquation, and further occur yellow, death in tri-leaf period（Such as Figure 1A）.
To dead plant（bzu2-1Mutant plants）Blade carries out microexamination, as a result finds its stomata dysplasia,
There is no normal guard cell and accessory cell（Such as Figure 1B）.
Further different growing stages cell development state observation is found：bzu2-1In mutant plants, guard cell is female
Cell can not normal longitudinal division, ultimately form the improper morphology of stomata of other shapes（Such as Figure 1B）；And due to mutant plants
Stomata is lacked, and then causes moisture loss very slow and CO2There is obstacle in exchange so that plant respiration and photosynthesis by
Very big influence, ultimately resulting in mutant can not complete the history of life, dead in tri-leaf period（Such as Fig. 1 C）.
Photosynthetic efficiency detection and temperture of leaves detection to mutant plants show：The mutant plants of stomata are lacked, its
Photosynthetic efficiency substantially reduces（Such as Fig. 1 D, Fig. 1 E）；And under far infrared imagery instrument,bzu2-1The leaf surface of mutant plants
Temperature is apparently higher than wild type（Such as Fig. 1 F, Fig. 1 G）.
These comprehensive results can be seen thatbzu2-1Mutator is related to stomata development height in mutant plants.
（Two）To cornGRMZM2G417164The positioning and confirmation of gene
Utilize corn map-based cloning（As a result it is as shown in Figure 2）, it is rightbzu2-1Mutator is positioned in mutant plants.
Positioning result shows：Mutator is in the range of No. 8 M of chromosome 79 ~ 80（Referring particularly in aforementioned figures declaratives
Hold）, by expanding, being sequenced to gene order in section, the results showed that：GRMZM2G417164 isBZU2,GRMZM2G417164
Gene is mutated,GRMZM2G417164Gene internal has the insertion of 4 bases of AGCT at 390 bp, causes termination
Codon TAG appearance in advance, encoding histone terminate in advance, form nonfunctional albumen, i.e.,：In mutant,GRMZM2G417164Gene can not accurate translation be normally functional protein（Fig. 2）.
Additional description is needed, is confirmedGRMZM2G417164During gene order, with normal expression
GRMZM2G417164 genes（I.e.BZU2）Maize genome be template, enter performing PCR amplification obtainGRMZM2G417164Gene
Sequence, when PCR is expanded, primer sequence is designed as shown in SEQ ID NO.1 ~ 2, specific as follows：
BZU2-F:ATGTCCCACATCGCGGTGGAGC,
BZU2-R: TTATATGGCGGCGGCCATGGCT。
It is sequenced and is completed with M13-F/R after pcr amplification product is connected with T-Vector, relevant primer synthesis and examining order
Completion is provided by Jin Wei intelligence bio tech ltd.
To confirm to be only reallyGRMZM2G417164The mutation of gene causes Relevant phenotype difference, and inventor is further
Construct CRISPR-Cas9- GRMZM2G417164Carrier is transferred in WT, is obtainedGRMZM2G417164The plant of mutation, its table
Type withbzu2-1Unanimously.Thus it is confirmed that：It is singleGRMZM2G417164The mutation of gene causes mutant Relevant phenotype
Difference.
With regard to above-mentioned associated verification process it is to be understood thatCRISPR-Cas9- GRMZM2G417164The structure of carrier and
Maize genetic conversion is completed by Beijing Ji Nuowo bio tech ltd.Wherein during vector construction, to BZU2 gene sequences
After row analysis, it is necessary first to find suitable PAM sites, as a result find in BZU2 sequences at 289bp
CCTGTCATGATCA meets design requirement, is then based on PAM sites（Restriction Enzyme isBspH1）Build relevant carriers.Converting
After obtaining transfer-gen plant, transformed plant DNA is extracted, amplification includes the sequence fragment in PAM sites, and final identification obtains 3 not
With the material of site mutation, it is respectively designated asbzu-1,bzu2-3,bzu2-4, and phenotype in terms of then withbzu2-1Unanimously（Such as
Fig. 3）.This result shows：bzu2-1The Relevant phenotype difference of mutant is by cornGRMZM2G417164Gene mutation and
Only as caused by being mutated the term single gene.
（Three）It is rightGRMZM2G417164The analysis and positioning of gene
On the basis of the studies above, further, inventor is by map-based cloning, to cornGRMZM2G417164Gene
Cloned and analyzed.As a result show：CornGRMZM2G417164Total length be 660 bp, its CDS total length is 220 amino
Acid, its albumen encoded belong to bHLH class transcription factor families.
To be positioned to expression position of the gene in normal plant, instantaneous conversion technology, inventor's structure are utilized
pGreenⅡ_0280-GRMZM2G417164-GFPAnd control vectorGRMZM2G417164- GFP, and converted Tobacco Leaf
Piece.Related experiment is briefly discussed below.
（1）pGreenⅡ_0280-GRMZM2G417164-GFPAnd control vectorpGreenⅡ_0280-GFPStructure
The carriers of pGreen II _ 0280, are given by He'nan University teacher Guo Siyi：
Primer sequence is designed as shown in SEQ ID NO.3 ~ 6, it is specific as follows：
GFPInF：GtatcATGGTGAGCAAGGGCGAGGAG,
GFPInR：gtgggacatTTACTTGTACAGCTCGTCCATGCCG；
ZmBZU2CDSF：GatcctctagaATGTCCCACATCGCGGTG,
ZmBZU2CDSR：gatttcagcgaattatctagaTTATATGGCGGCGGCCAT.
Using above-mentioned primer, GFP and ZmBZU2 fragments are amplified respectively；
By carrierpGreenⅡ_0280KpnI, XbaI double digestion are carried out, and utilizes ClonExpress MultiS One
Step Cloning Kit（C113-02, http://www.vazyme.com/）It is attached with above-mentioned institute's amplified fragments, finally
Structure, screening, obtain instantaneous conversion carrierpGreenⅡ_0280-GRMZM2G417164-GFP。
（2）Transformation of tobacco and transient expression observation
By Agrobacterium bacterium solution P19, above-mentioned steps（1）'spGreenⅡ_0280-GRMZM2G417164-GFPBacterium solution is inoculated with respectively
In the YEP fluid nutrient mediums containing corresponding antibiotic, 14 ~ 16 h or so are cultivated under the conditions of 28 DEG C, 220 rpm, to bacterium solution
OD600=1.0 ~ 1.2 or so is standby；
Bacterium solution is centrifuged into 15 min under the conditions of room temperature, 4000 rpm, gives up supernatant and is collecting bacteria；
Then re-suspension liquid is used（100 mL：l mL MgCl2(1 M)+ lmL MES（1 M）+ 0.2mL AS（0.1 M）+100
ML distilled waters）Collected thalline is resuspended, and adjusts OD600=0.8 ~ 1.0 or so is standby；
Bacterium solution by volume 1 after P19 and II _ 0280-GRMZM2G417164-GFP of pGreen are resuspended:After 1 is well mixed, room
Temperature places one and more than hour is used as parenteral solution.
With 2.5 mL syringes by above-mentioned parenteral solution（Bacterium solution）Injected by the aperture at the seedling cotyledon back side in tobacco leaf,
Add transparent cover or covering with ground sheeting, directly observed after 24 h.
Laser co-focusing observation is found：GRMZM2G417164The assignment of genes gene mapping is in nucleus（Detailed results are said referring to accompanying drawing
Bright content）, this is consistent with its function as transcription factor（Fig. 4）.
（Four）GRMZM2G417164The expression pattern of gene
Using hybridization in situ technique, inventor have detectedGRMZM2G417164Expression pattern of the gene in stomata growth course.
Its technical principle is：Formaldehyde can incite somebody to action in situ hybridizationGRMZM2G417164（BZU2）The RNA of transcription is fixed in cell tissue,
RNA is exposed by cutting into slices, digesting, and then passes through digoxin（Digoxin）Colour developing, it can be seen that the position of target gene transcription
Point.
The result of in situ hybridization is shown：
In guard-cell mother cell,BZU2MRNA anti sense probes can with guard-cell mother cellBZU2 mRNA
Sequence is complementary to be combined, and is detectedBZU2Expression；AndBZU2MRNA sense probes can not be female thin with guard cell as control
In born of the same parentsBZU2MRNA sequence combine.
In ripe guard cell,BZU2MRNA anti sense and sense probes all can't detectBZU2 MRNA's
Expression；The result showsBZU2It can be expressed in wild type guard-cell mother cell.
Butbzu2-1Guard-cell mother cell in,BZU2 MRNA anti sense and sense probes all detect not
ArriveBZU2 MRNA expression；Same situation,bzu2-1Guard cell in,BZU2MRNA anti sense and sense
Probe all can't detectBZU2 MRNA expression.
To sum up result can be seen that（As shown in Figure 5）：GRMZM2G417164Gene is expressed in guard-cell mother cell period
Height, andbzu2-1Almost do not expressed in mutant, this result shows：GRMZM2G417164（BZU2）Gene is being safeguarded
Cell blasts period expresses, and is advantageous to start the downstream related gene expression of its regulation and control, has in regulation and control stomata development important
Effect.
（Five）The detailed observation of corn stomata growth course
On the basis of the studies above result, detailed microexamination research of the inventor further to corn stomata development in different stages is sent out
It is existing：
In wild type, guard-cell mother cell can induce neighbouring accessory cell mother cell polarity, Asymmetric division, produce
Two accessory cells；After accessory cell is formed, guard-cell mother cell carries out once symmetrical longitudinal division, forms two maturations
Guard cell, finally develop into maturation Stomatal regulation；
Andbzu2-1In mutant, guard-cell mother cell can not induce neighbouring accessory cell mother cell polarity, not right
Claim division, thus normal accessory cell can not be formed；And with the growth of guard-cell mother cell,bzu2-1Middle defendance is thin
Born of the same parents' mother cell can not normal longitudinal division, but carried out horizontal stroke, the Asymmetric division such as oblique so that without normal guard cell
Occur.
Actin F-actin dyeing is further carried out, specific colouring method refers to as follows.
Preparation of reagents：
PIPES：150 mM, 200 mL, pH 6.8；
EGTA：50 mM, 100 mL, KOH adjust pH 7.0；
100 mM PEM：PIPES（150 mM, 133.3 mL）+ EGTA（50 mM, 20 mL）+MgCl2（1 M, 1 mL）,
KOH adjusts pH 6.9；50 mM PEM are used in experiment, are diluted with water.
To wild type andbzu2-1Tri-leaf period seedling, blade base stomata development section is chosen, is divested with hybridization tweezers outer
Layer plumule and cotyledon, it is careful to take out the 2nd and the 3rd blade base young leaflet tablet tissue；
Organization material is carefully cut into the cm sizes of 0.5 cm × 0.2, in 4% PFA（PEM dissolves）Fix 30 min；
PEM washes 3 times, every time 5 min；
With 5% penetrating 20 min of DMSO+1% Ttiton X-100（Be advantageous to dyestuff and enter tissue）；
PEM washes 3 times, every time 5 min；
Tissue block is immersed in the PEM dissolved with the Phalloidin of 10% Alexa Fluor 488, is incubated about 1.5 h；
Directly fluorescence is observed under laser co-focusing.
As a result find：In maize wild-type, guard-cell mother cell induction accessory cell polarity and Asymmetric division
When F-actin have obvious enrichment；Andbzu2-1In, this F-actin enrichment does not occur（As shown in Figure 5 B）.
To sum up result can be seen that：
CornGRMZM2G417164Transcription, the bHLH classes transcription factor protein of translation are as molecular switch, in stomata growth course
In serve important adjustment effect, regulated and controled signal transmission of the guard-cell mother cell to accessory cell mother cell, regulate and control
The gene of some stomatas development, controls the development of corn stomata to be formed, specifically：
The gene participates in：（1）Guard-cell mother cell induces accessory cell mother cell polarity, and Asymmetric division shape
Into accessory cell process；With（2）Guard-cell mother cell longitudinal division forms two ripe guard cell's processes；
By the gene mutation（Pass through the technological means such as gene insertion or gene silencing）After inactivation, i.e. cornGRMZM2G417164After gene is beyond expression, mutant plants can not form normal guard cell and accessory cell, i.e., can not
Form normal stomata（For corn, the mutant plants for lacking stomata are dead in tri-leaf period）；
Based on this achievement, for research corn stomata development, explore stomata and transmit adverse circumstance signal as receptor and effector
It is significant；
On the other hand, technique for gene engineering means are passed through（Such as inserted by gene, gene silencing）ToGRMZM2G41716
After gene carries out partial inactivation, to be formed because plant part stomata can not develop, there is degeneration-resistant, high yield for being cultivated using stomata
Corn variety have important guiding effect.
SEQUENCE LISTING
<110>He'nan University
<120>Application of the GRMZM2G417164 genes in stomata development
<130> none
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213>Engineer
<400> 1
atgtcccaca tcgcggtgga gc 22
<210> 2
<211> 22
<212> DNA
<213>Engineer
<400> 2
ttatatggcg gcggccatgg ct 22
<210> 3
<211> 26
<212> DNA
<213>Engineer
<400> 3
gtatcatggt gagcaagggc gaggag 26
<210> 4
<211> 34
<212> DNA
<213>Engineer
<400> 4
gtgggacatt tacttgtaca gctcgtccat gccg 34
<210> 5
<211> 29
<212> DNA
<213>Engineer
<400> 5
gatcctctag aatgtcccac atcgcggtg 29
<210> 6
<211> 39
<212> DNA
<213>Engineer
<400> 6
gatttcagcg aattatctag attatatggc ggcggccat 39
Claims (3)
1. cornGRMZM2G41716Application of the gene in stomata development, it is characterised in that the gene is sent out with corn stomata
Correlation is educated, specifically, the gene participates in：（1）Guard-cell mother cell induces accessory cell mother cell polarity, and
Asymmetric division forms accessory cell process；With（2）Guard-cell mother cell longitudinal division forms two ripe guard cell's mistakes
Journey.
2. corn as claimed in claim 1GRMZM2G41716Application of the gene in stomata development, it is characterised in that by thisGRMZM2G41716After gene mutation inactivation, plant can not form normal guard cell and accessory cell.
3. one kind cultivates new variety of plant method, it is characterised in that by technique for gene engineering means, is inciting somebody to actionGRMZM2G41716
After gene is inactivated, plant can not develop to form stomata.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711147439.7A CN107723296B (en) | 2017-11-17 | 2017-11-17 | Application of GRMZM2G417164 gene in stomatal development |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711147439.7A CN107723296B (en) | 2017-11-17 | 2017-11-17 | Application of GRMZM2G417164 gene in stomatal development |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107723296A true CN107723296A (en) | 2018-02-23 |
| CN107723296B CN107723296B (en) | 2021-07-13 |
Family
ID=61217298
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711147439.7A Active CN107723296B (en) | 2017-11-17 | 2017-11-17 | Application of GRMZM2G417164 gene in stomatal development |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107723296B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112680471A (en) * | 2019-10-17 | 2021-04-20 | 华南农业大学 | Application of ZmSPL gene in regulation and control of development of maize stigma mastoid cells |
| CN112695040A (en) * | 2019-10-22 | 2021-04-23 | 华南农业大学 | Use of ZmSBP14, ZmSBP10 or ZmSBP26 gene in regulation of corn stomata development |
| CN113755511A (en) * | 2021-10-12 | 2021-12-07 | 河南大学三亚研究院 | Application of corn Zm00001d029151 gene in regulation and control of guard cell morphogenesis |
| CN114058629A (en) * | 2021-11-11 | 2022-02-18 | 河南大学三亚研究院 | Application of Zm00001d042263 gene in regulation and control of corn stomata development |
-
2017
- 2017-11-17 CN CN201711147439.7A patent/CN107723296B/en active Active
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112680471A (en) * | 2019-10-17 | 2021-04-20 | 华南农业大学 | Application of ZmSPL gene in regulation and control of development of maize stigma mastoid cells |
| CN112680471B (en) * | 2019-10-17 | 2023-08-01 | 华南农业大学 | Application of ZmSPL gene in regulation and control of development of corn stigma mastoid cells |
| CN112695040A (en) * | 2019-10-22 | 2021-04-23 | 华南农业大学 | Use of ZmSBP14, ZmSBP10 or ZmSBP26 gene in regulation of corn stomata development |
| CN112695040B (en) * | 2019-10-22 | 2023-01-06 | 华南农业大学 | Application of ZmSBP14, zmSBP10 or ZmSBP26 gene in regulating and controlling development of corn stomata |
| CN113755511A (en) * | 2021-10-12 | 2021-12-07 | 河南大学三亚研究院 | Application of corn Zm00001d029151 gene in regulation and control of guard cell morphogenesis |
| CN113755511B (en) * | 2021-10-12 | 2023-03-24 | 河南大学三亚研究院 | Application of corn Zm00001d029151 gene in regulation and control of guard cell morphogenesis |
| CN114058629A (en) * | 2021-11-11 | 2022-02-18 | 河南大学三亚研究院 | Application of Zm00001d042263 gene in regulation and control of corn stomata development |
| CN114058629B (en) * | 2021-11-11 | 2022-12-30 | 河南大学三亚研究院 | Application of Zm00001d042263 gene in regulation and control of stomatal development of corn |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107723296B (en) | 2021-07-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bowman et al. | The renaissance and enlightenment of Marchantia as a model system | |
| CN107723296A (en) | Application of the GRMZM2G417164 genes in stomata development | |
| CN107723297A (en) | Iris R3 MYBx1 genes and its application in pattern regulation | |
| CN108624596B (en) | Gene for regulating growth of leguminous root noduleGmSPX5And uses thereof | |
| Li et al. | Shoot-to-root translocated GmNN1/FT2a triggers nodulation and regulates soybean nitrogen nutrition | |
| CN112724213B (en) | Sweet potato anthocyanin synthesis and stress resistance related protein IbMYB4, and coding gene and application thereof | |
| JP2005185102A (en) | Callus and plant body of new genotypic cms raphanus sativus lineage and hybrid seed produced therefrom | |
| CN110241122A (en) | Application of the Caragana intermedia CiCPK10 gene in regulation stress resistance of plant | |
| CN106318923B (en) | The protein and its gene of a kind of High Temperature Stress down regulation Development of Chloroplasts and application | |
| CN115725643A (en) | Application of NtMYB35 transcription factor in tobacco black shank resistance | |
| AU2021103672A4 (en) | Protein related to rice wax synthesis and its coding gene WSL5 and application thereof | |
| CN109456396A (en) | A kind of protein, molecular labeling and the application of Senescence of Rice and fringe type controlling gene HK73 and its coding | |
| CN112266919B (en) | Rice source insect-resistant related gene OsIDP1 and encoding product and application thereof | |
| CN105968178B (en) | The application of rice Os RAD1 albumen and its encoding gene in regulation pollen fertility | |
| CN104945493B (en) | A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application | |
| CN114107373A (en) | Method for preparing arabidopsis autophagy gene mutant and application | |
| CN110029106A (en) | The RNAi segment of MSL1 and its application in raising plant cadmium stress sensitivity | |
| CN117209581B (en) | Application of GAI protein of herba lophatheri in plant dwarfing | |
| CN116375835B (en) | Application of Yan flower MYB4b protein in regulation and control of plant leaf morphology | |
| CN113717981B (en) | DTX6 mutant gene and application thereof in herbicide diquat resistance | |
| CN116497054B (en) | Application of GmSGT1 gene in controlling soybean nodulation | |
| CN106755064A (en) | Cabbage type rape gene Bnms4bApplication in yellow leaf tobacco is prepared | |
| CN112126710B (en) | Rice source insect-resistant related gene OsLRR6 and encoding product and application thereof | |
| CN115490762B (en) | Chimonanthus praecox CpCBL8 gene, protein encoded by same and application thereof | |
| CN101817875B (en) | Rice adventitious root protruding control gene OsDARE1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |