AU2021103672A4 - Protein related to rice wax synthesis and its coding gene WSL5 and application thereof - Google Patents

Abstract

The invention discloses a protein related to rice wax synthesis and its coding gene WSL5, and application in rice breeding thereof. The nucleotide sequence of the protein related to rice wax synthesis is shown as SEQ ID NO: 2. The nucleotide sequence of gene WSL5 encoding the disclosed protein is shown as SEQ ID NO: 1. The present invention also provides an application of the above gene WSL5 in improving waxy content of rice and resisting biotic and abiotic stress of rice. By isolating, cloning, the present identified the gene WSL5 related to rice wax synthesis, and performed gene function verification through complementary experiments. The results of map based cloning showed that the gene encodes an oxidoreductase. The invention has broad application prospects for cultivating new varieties with rich wax content and resistance to stress, and solving the problems that the current rice varieties are prone to early senescence in the later growing stage and the production is easily affected by the environment. 1/2 FIGURES Figure 1 Figure 2

Description

1/2

FIGURES

Figure 1

Figure 2

Protein related to rice wax synthesis and its coding gene WSL5 and application

thereof

TECHNICAL FIELD

The invention belongs to the field of plant genetic engineering. Particularly,

The present invention relates to a method for cloning gene WSL5 (Wax Crystal-Sparse

Leaf 5) of rice using map-based cloning technology, and using transgenic complementary

experiments to identify the function of the gene; At the same time, it also involves the

application of this gene to regulate rice leaf senescence, thereby improving rice varieties

to increase yield.

BACKGROUND

As the first protective layer of plants against external environment, wax is also an

important waterproof layer on the surface of plants, which plays an important role in

preventing non-stomatal water evaporation of terrestrial plants. It can also protect plants

from various biological and adversity stresses, such as ultraviolet rays, strong radiation,

bacteria, fungi, pests and high temperature or freezing damage. Rice is one of the most

important food crops in China, and improving its stress resistance is an important means

to ensure the safe production of rice and national food security. Therefore, the study of

different waxy synthetic mutants is of great significance to reveal the mechanism of waxy

synthesis and regulation of rice leaves, and to provide a new way to reconstruct waxy

layer of rice by biotechnological means to enhance the stress resistance of crops and

improve the yield of rice under adverse conditions.

The main components of wax are various lipids soluble in organic matter, mainly C20

C34 very long-chain fatty acids and their corresponding derivatives of alcohols, esters,

aldehydes, alkanes and ketone.

The main components of wax on rice leaf and leaf sheath are primary alcohols, aldehydes

and fatty acids, while the content of alkanes is less than 15% of the total wax. Alkanes

and alkenes are the main components of waxy on the surface of rice anther, accounting

for about 90% of the total. The synthesis of plant epidermal wax is completed in

epidermal cells. The synthesis process mainly includes the de novo synthesis of C16 and

C18 fatty acids in plastids, and then the products are transferred to the endoplasmic

reticulum and extended to C20-C36 very long-chain fatty acids, and different wax

components are further synthesized through alcohol synthesis and alkane synthesis.

There are 13 waxy related genes have been cloned in rice after the discovery of some

non-waxy mutants. Wax-Dificent Antherl(WDA1) gene is the first cloned wax-related

gene in rice, which is specifically expressed in anther epidermal cells. The WDA1 mutant

has reduced waxy crystals on the surface of the anthers, blocked development of

microspores, and abnormal development of pollen extine, resulting in the male sterility of

rice;

In addition to the reduced waxiness on the leaf surface, Crystal-Spares Leaf1 (wsll)

mutant also has problems of growth retardation, decreased fertility, leaf fusion and

reduced drought resistance, indicating that the WSL1 gene may also be involved in the

synthesis of lipids related to rice growth and development.

Gene ONION1 and ONION2 are involved in the synthesis of very long-chain fatty acids,

which are specifically expressed in the outermost layers of stem apical meristems and developing lateral organs. The outer epidermal cells of the two mutants developed abnormally, grew slowly and eventually died; gll-2 mutant has thinner epidermis, less waxy crystals on its surface and lower drought tolerance. DWA1 is mainly involved in wax synthesis under drought stress. The content of very long-chain fatty acids increased in plants with over-expressed DWA1; After drought treatment, the surface wax content of dwal decreased, and the expression of many wax-related genes was inhibited, which made DWA1 more sensitive to drought. The wax synthesis regulatory genes 1(WR1) and

2(WR2) are two wax regulatory genes. The expression of WRI gene was induced by

drought, ABA and salt stress, and the wax content on the surface of over-expressed WRI

plants increased, while that of plants interfered by RNAi decreased. Further studies

showes that WRI gene could bind to the promoters of wax-related genes OsLACS1 and

OsFAE-L, then regulate gene expression and thus influence the wax synthesis and

metabolism on the surface of rice. Over-expressed WR2 can also regulate the wax and

keratin content on the leaf surface, and enhance the drought resistance of rice. WSL4

encodes p-ketoacyl-CoA synthase (KCS) and participates in the first step of long-chain

fatty acid synthesis, while WSL3 encodes j-ketoacyl-CoA reductase (KCR), and

catalyzes the second step of fatty acid chain elongation. WSL3 and WSL4 were

expressed in all tissues of rice and were all located in endoplasmic reticulum membrane.

The waxy layer on the leaf surface of wsl3 and wsl4 mutants became thinner and the fatty

acid composition changed(Gan et al., 2016; Wang et al., 2017).

Although the disclosure of existing rice waxy synthesis mutants and genes have played an

important role in revealing the molecular mechanism of waxy synthesis and regulation,

there is still a need for further study of their molecular mechanism. According to the invention, a wax synthesis gene encoding a 3-oxoacetyl-reducase WSL5 is isolated and cloned by a map-based cloning technology. Cytological and biochemical analysis shows that the gene affects the wax distribution and content on the surface of rice leaves. The function of the gene is identified by transgenic complementary experiments.

SUMMARY

The purpose of the present invention is to provide a protein related to rice wax synthesis,

its coding gene WSL5 and the application in rice breeding thereof.

The invention provides a protein related to rice wax synthesis, and the nucleotide

sequence of the protein is shown in SEQ ID NO: 2. The protein also includes nucleotide

sequences or derivatives generated by adding, substituting, inserting or deleting one or

more amino acids or homologous sequences of other species in the nucleotide sequence

shown in SEQ ID NO: 2.

The present invention also provides a gene WSL5 encoding the protein, and the

nucleotide sequence of the gene WSL5 is shown in SEQ ID NO: 1. The gene WSL5 also

includes mutants, alleles or derivatives generated by adding, substituting, inserting or

deleting one or more nucleotides in the nucleotide sequence as shown in SEQ ID NO: 1.

The above gene WSL5 is used in improving waxy content of rice and resisting biotic and

abiotic stress of rice. As an improvement of the application of the gene WSL5 of the

present invention, rice cells are transformed with the gene having the nucleotide sequence

shown in SEQ ID NO: 1, and then the transformed rice cells are cultivated into plants.

The rice brittle stalk mutant of the invention is obtained by screening from EMS mutant

library of japonica rice Zhonghua 11. In addition to the thin distribution of wax on the leaf surface and the low content of wax components, the mutant also showed the phenomenon of premature senescence of leaves.

By crossing the mutant with normal rice and observing the separation of F 2 progeny, it is

determined that the phenotype is caused by one gene. According to the invention, a base

WSL5 for controlling stem strength of rice is cloned and separated by adopting a map

based cloning method. It is derived from gene LOC_Os04g30760 by single base

mutation, that is, nucleotide G at the 7 6 0 th position of SEQ ID NO.1 is mutated to A,

which leads to the change of the encoded amino acid. Bioinformatics analysis shows that

WSL5 encodes a 3-oxoacetyl-reductase of the wax synthesis pathway.

Transgenic research with complementary functions is carried out through transgenic

technology, and the results show that the transgenic rice with the phenotype of mutant

wsl5 restored to wild type is obtained by the invention, which proves that the gene WSL5

is correctly cloned by the invention.

To sum up, that gene WSL5 that controls rice wax synthesis is isolated, cloned and

identified, and the gene function is verified through complementary experiments. The

results of map-based cloning showed that the gene encoded an oxidoreductase. The

method provided by the invention is used for cultivating a new variety with rich wax

content and resistance to stress, and has wide application prospect for solving the

problems that the current rice variety is prone to premature senescence in the later growth

period and the production is easily affected by the environment.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is the phenotype of wild type and ws15 mutant and the characteristics of leaf

water droplets.

Figure2 is the distribution of wax on the leaf surface of wild type and ws15 mutant.

Figure 3 is a fine map of WSL5 gene.

Figure 4 is the phenotype of transgenic rice and wax distribution on leaf surface in

functional complementation experiment.

DESCRIPTION OF THE INVENTION

The invention will be further described with specific embodiments below. These

descriptions are not intended to further limit the contents of the present invention. Unless

otherwise specified in the following embodiments, the technical means used are

conventional means well known to those skilled in the art..

Materials and reagents used in the following embodiments can be obtained from

commercial sources unless otherwise specified.

Embodiment 1: Obtaining and Phenotypic Analysis of Mutant Materials

By EMS chemical mutagenesis of japonica rice Zhonghua 11, a mutant ws15 with

reduced wax synthesis was screened. The traits of this mutant have been stably inherited

after multiple generations of selfing. The mutant showed that the leaf surface was wetted

with water, and the water condensed into water droplets in the wild type leaves, while

showed a dispersion phenotype in the mutant, which was a typical wax reduction

phenotype. Scanning electron microscopy revealed that the waxy distribution on the leaf

surface of ws15 was significantly thinner than that of the wild type. Compared with wild

type, the mutant also had premature senescence of leaves under field conditions. All the

rice materials were planted under routine management in the experimental field of

Jiangxi Agricultural University, Nanchang, Jiangxi Province.

The EMS chemical mutagenesis method is as follows: immerse the seeds of Zhonghua 11

in ethyl methanesulfonate with the concentration of 0.05 ~ 0.5 mol/L for 30 min, and then

plant the germinated seeds in the field, selfing over multiple generations.

Embodiment 2 population construction and genetic analysis

The mutant ws15 was hybridized with the commonly used varieties Nip, TN1 and 9311,

and all Fi plants showed normal phenotype of wild-type, indicating that ws15 was

controlled by recessive nuclear genes. Statistics on the segregation ratio of F2 segregation

population (Table 1) showed that the segregation ratio of normal phenotype plants and

mutant phenotype plants was close to 3:1 after chi-squared test, which indicated that wax

reduction and premature senescence of ws15 were controlled by a pair of single recessive

nuclear genes.

Table 1 Genetic analysis of rice brittle stalk mutant ws15

Combination FiMuat Nrl F 2 _______ 2 of materials Normal Mutant Normal Mutant x PValue phenotype phenotype phenotype phenotype wsl5/Nip 10 0 363 112 0.534702773 0.47445614 wsl5/TN1 9 0 286 87 0.588627854 0.454851356 wsl519311 8 0 245 69 1.691198191 0.215676424 Embodiment 3 Fine Mapping Of WSL5 Gene

The F2 population of mutant crossing with TNi was selected as the location population.

SSR primers uniformly distributed on 12 chromosomes of rice stored in our laboratory

were used to screen the polymorphism of mutant and TN1. Then, linkage analysis was

carried out with 21 wax-reduced plants (premature senescence plants) in F2 of wsl5/TNi,

and the position of the target gene on the chromosome was preliminarily confirmed.

Genomic DNA was extracted by CTAB method. The specific steps are as follows:

0.1 g of rice leaves was weighted and ground into powder with liquid nitrogen, and

then 600tL of DNA extraction buffer solution(made from CTAB solution-2% (m/v)

CTAB, 100mmol/L Tris-Cl, 20mmol/L EDTA, 1.4mol/L NaCl; pH 8.0) was added, water

bath at 65°C for 40 min. Then 600 L chloroform: isoamyl alcohol (volume ratio: 24:1)

was added and mixed well. Centrifuged at 10,000rpm for 5min, and transferred the

supernatant to a new centrifuge tube.

©Added 2/3 ~ 1 times of pre-cooled isopropanol (to 4°C) to the supernatant obtained

after centrifugation in the above step O, and mixed gently until DNA precipitates.

Centrifuged at 13,000rpm for 8 min, and poured out the supernatant.

©The DNA precipitate obtained in step @ was washed with 200 L of 70 (volume

concentration) hexanol.

The washed DNA was dried and dissolve in 100 L TE buffer solution or pure water.

The concentration of DNA samples obtained in step @ was detected by ultraviolet

spectrophotometry, and the integrity of DNA was detected by 0.7% agarose gel

electrophoresis. Complete and suitable DNA was used for PCR amplification, and

incomplete DNA is re-extracted until complete DNA was obtained.

PCR reaction system is 10 L: DNA template 1 L, 1OxPCR buffer solution 1 L, forward

and reverse primer(10 mol/L), each 0.5[tL, dNTPs 1 L, rTaq enzyme 0.24L, and ddH 20

was added to make up 10 d. PCR amplification procedure is as follows: pre-denature at

94°C for 4 min; [denature at 94°C for 30s, annealing at 55°C ~ 60°C for 30s (temperature

varies with primers), extending at 72°C for 30s], and repeat for 40 times; finally extended

at 72°C for 10min. PCR products were electrophoresed by 4% agarose gel, and after

electrophoresis, photos were taken on gel imager and gel was read. 186 pairs of SSR primers screened above were used for gene linkage analysis, and it was initially found that WSL5 was located on chromosome 3. New Indel marker was then designed upstream and downstream of the linkage marker, and 96 individual plants were used to locate the target gene interval which was locked between molecular markers M3 and M4.

A new molecular marker was designed again in the obtained interval, and a total of 1224

F2 plants were used to locate the gene in the interval of about 52kb between C4 and C7

. See table 2 for primer sequences.

Table 2 Molecular markers used for fine positioning

Prime Forward Primer(5'--3') Reverse Primer(5'--3') r M1 TATGCGAAGGATGTGCGAC ACGAATACATGTGCCTGCC M5 CGGAGCTGGTCTAGCCATC GTCTCCGTCTTCCTCACTCG M6 AATGGGACCAGAAAGCACAC AAAAAGAGCATGGGGGCTAC M3 AACCGGCCATGCCAGAGAGG CCAAATCCTATCCGCCACACACC M2 CTGGATCTGTGAGGTGTCTCTA AAAGAGGAGTTCGCACAAGTGG GG M4 GTAGCCTTGCACTCGACCGTAC ACCAACTCTGGCAATGCATCC C Cl CATTGCCAACCCGTAAAGCTAC GGTGAGCTGAAGATGTTCTTTCAT C GG C2 CCCTGCACCTGGATTCTCTCTC ATTGACGCACAGACAAGAACAAG C ACG C3 TTATTAGAGCGCCATGTGGC CATGCTGTGGTTTGTCAAGG C4 AGCAACTGCACAGGAATAAT ATGTGCCACCATAAGTTGAT C7 CGTTCAAGGAGCTTGTGTTGAT GGACCGATTTAAGTGAACGTTGAT CC GG C8 TTCCACAACCCTTGTATGTGTG GTGCATGAGAAGAGGATAGATGTG C G C9 CGACACAAGCACTAGGCATC TATGTCGAGGACGATGGACA Cl0 TGTCCACATCGCCATGTACT TGAAGGACGCTACGGAACTC

According to the data from rice genome database (http://rice.plantbiology.msu.edu/), it

was found that there were 7 open reading frames (ORF). The whole genes (including

promoters and introns) of ZH11 and wsl5 were sequenced and compared, a single base

mutation of G--A occurred in the 9th exon of LOCOs04g30760, and the 2 5 4th amino

acid was changed from Ala to Thr.

The WSL5 gene has the nucleotide sequence shown in SEQ ID NO: 1, and the encoded

protein thereof has the nucleotide sequence shown in SEQ ID NO: 2.

Embodiment 4 Plant Transformation

The genomic DNA fragment from 5'-UTR to 3'-UTR of WSL5 gene in wild-type rice

ZH11 was amplified, with a total length of 831lbp, which was connected to the binary

vector pCAMBIA1300 by recombination. The plasmid was transformed into

Agrobacterium tumefaciens EHA105 by liquid nitrogen freeze-thaw method and

transformed into mutant rice. The callus induced by the mature embryo of mutant is

cultured in the induction medium for 2 weeks, and then the vigorously growing callus is

selected as the receptor for transformation. The EHA105 strain containing the binary

plasmid vector (pCAMBIA1300-WSL5) was used to infect rice callus. After co

cultivation in the dark and 25°C for 3 days, it was cultured on a selection medium

containing 50 mg/L Hygromycin in light for about 14 days (light strength is 13,200 LX,

temperature is 32°C). The pre-differentiated callus were transferred to differentiation

medium and cultured under light conditions (light intensity 13,200LX, temperature 32°C)

for about one month to obtain resistant transgenic plants. The phenotype identification of

complementary seedling plants was compared with the wild-type and mutants of the same

period, it was found that the premature senescence phenotype of the transgenic plants had recovered, and the waxy distribution on the leaf surface had also increased, which was not significantly different from the wild-type.

The foregoing descriptions are only preferred embodiments of the present invention and

are not intended to limit the present invention. Any changes or substitutions that can be

easily conceived by those skilled in the art within the technical scope disclosed in the

present invention should be covered within the protection scope of the present invention.

Therefore, the protection scope of the present invention should be subject to the

protection scope defined in the claims.

Claims (5)

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. A protein related to rice wax synthesis, characterized in that its nucleotide sequence is

shown in SEQ ID NO: 2.

2. A protein related to rice wax synthesis according to claim 1, characterized in that the

nucleotide sequence further comprises an nucleotide sequence or derivative generated by

adding, substituting, inserting or deleting one or more amino acids or homologous

sequences of other species in the nucleotide sequence shown in SEQ ID NO: 2.

3. A gene encoding the protein related to rice wax synthesis according to claim 1 or 2,

characterized in that the nucleotide sequence of the gene is shown in SEQ ID NO: 1.

4. A gene according to claim 3, wherein the nucleotide sequence further comprises mutants,

alleles or derivatives generated by adding, substituting, inserting or deleting one or more

nucleotides in the nucleotide sequence shown in SEQ ID NO: 1.

5. An application of the gene according to claim 3 in improving waxy content of rice and

resistance to biotic and abiotic stress of rice.