CN107699615B - A method of identifying Malus spectabilis kind using DNA sequence dna structure nucleic acid molecule formula - Google Patents
A method of identifying Malus spectabilis kind using DNA sequence dna structure nucleic acid molecule formula Download PDFInfo
- Publication number
- CN107699615B CN107699615B CN201711030429.5A CN201711030429A CN107699615B CN 107699615 B CN107699615 B CN 107699615B CN 201711030429 A CN201711030429 A CN 201711030429A CN 107699615 B CN107699615 B CN 107699615B
- Authority
- CN
- China
- Prior art keywords
- malus
- malus spectabilis
- sequence
- nucleic acid
- acid molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Evolutionary Biology (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of methods of identification Malus spectabilis kind.The present invention provides the methods of identification Malus spectabilis kind, include the following steps：1) using the genomic DNA of Malus spectabilis kind to be measured as template, PCR amplification is carried out with the primer pair that two single strand dnas form shown in sequence 1 and sequence 2, obtains PCR product；2) PCR product is sequenced, the nucleic acid molecule formula of the Malus spectabilis kind to be measured is listed according to sequencing result；3) the nucleic acid molecule formula obtained by step 2) is compared with the nucleic acid molecule formula of several corresponding Malus spectabilis kinds, so that it is determined that the Malus spectabilis kind to be measured.The method of identification Malus spectabilis kind provided by the present invention is accurate, simple to operation, and production efficiency and the quality-monitoring for improving related industry are horizontal, effectively make up the deficiencies in the prior art；In addition, this method realizes the identification at Malus spectabilis kind non-florescence (such as seedling stage) simultaneously, there is higher sensitivity.
Description
Technical field
The invention belongs to forestry biomass technical fields, are related to a kind of method identified or assist plant identification, more particularly to
A method of identifying Malus spectabilis kind using DNA sequence dna structure nucleic acid molecule formula.
Background technology
Malus spectabilis（Malus spectabilis）It is the rose family（Rosaceae）Malus（Malus）Seeds.Malus spectabilis
There is important ornamental plantation to be worth for flower, leaf and fruit, be rare ornamencal flower and tree.
Malus spectabilis kind is classified generally according to the feature of fruit and flower, and fruiting period and time other than the florescence, there are kind mirror
Fixed difficult problem.Since the quantity of phenotypic markers and DNA molecular marker is few, existing marking sensitivity is limited, and there are synonyms
Identification with homonym phenomenon, Malus, especially Malus spectabilis kind is the difficult point of current research.Malus spectabilis variety source
Malus spectabilis breeding, deep development are utilized accurate identification and relevant scientific research has particularly important meaning and value.
Invention content
It is an object of the present invention to provide a kind of methods that Malus spectabilis kind to be measured is identified in identification or auxiliary.
It is provided by the present invention to be used to identifying or assisting the method for identifying Malus spectabilis kind to be measured, it is using in DNA sequence dna
Variant sites build nucleic acid molecule formula, and then identify or assist the method for identifying Malus spectabilis kind to be measured, specifically include following step
Suddenly：
（1）Using the genomic DNA of Malus spectabilis kind to be measured as template, with two shown in sequence in sequence table 1 and sequence 2
The primer pair of single strand dna composition carries out PCR amplification, obtains PCR product；
（2）The DNA sequence dna that length is 786bp is obtained after the PCR product is sequenced（Clip preceding 19 base and
Remaining variation region sequence after 806 bases）.Include the change dystopy for disclosing Malus spectabilis product inter-species heritable difference in the sequence
Point；
（3）The sequence to be compared is put together with the full sequence in DNA sequence data library, using ClustalX or
The softwares such as Mega are compared, and automatically generate a DNA aligned sequences matrix；
The DNA aligned sequences matrix is that two or more sequence opsition dependents are compared row according to specific scoring rule
The data set generated after row reflects the similitude between sequence to the maximum extent.The specific scoring rule that is directed to and
The correlation common sense such as algorithm and principle are on the books in the monograph in terms of " biological sequence analysis ".The DNA aligned sequences matrix
It can directly reflect that each sequence whether there is difference between same nucleotide site, and there are what kind of differences.Find nucleosides
The sour discrepant position being listed in the DNA aligned sequences matrix of letter, checks and approves the position and is located at the DNA aligned sequences square
The sequence of positions number that battle array 5 ' has been held, that is, determine a polymorphic site.
The DNA sequence dna library is as follows（a1）：
（a1）It is made of at least one of sequence in sequence table 3 to sequence 10；Wherein, sequence 3-10 is length 786bp
Sequence.
（4）The nucleic acid molecule formula of the Malus spectabilis kind to be measured is listed according to the DNA aligned sequences matrix；
The general formula of the nucleic acid molecule formula of the Malus spectabilis kind to be measured is：
B49B54B118B215B322B335B348B474B515B576B577B691；
In the general formula, the B49, the B54, the B118, the B215, the B322, the B335, the B348、
The B474, the B515, the B576, the B577With the B691, indicate successively in the DNA sequence dna comparison data matrix
The the 49th, 54,118,215,322,335,348,474,515,576,577 and 691 site, the position in polymorphic nucleotide site
Serial number is determined based on aligned sequences；
In the general formula, each B is any kind or two kinds in A, T, C and G；
When the Malus spectabilis kind to be measured is homozygous, in the general formula, each B is any in A, T, C and G
Kind, show simple spike in sequencing；When the Malus spectabilis kind to be measured is heterozygous, in the general formula, each B may be
A, two kinds in T, C and G can obtain significantly being superimposed set peak in sequencing.
（5）By step（4）The nucleic acid molecule formula of the gained Malus spectabilis kind to be measured is compared with nucleic acid molecule formula group I
It is right；
The nucleic acid molecule formula group I is by following a1）-a10）Totally 10 kinds of nucleotide molecular formula compositions：
a1）A49G54G118G215T322T335C348G474G515C576A577T691；
a2）G49G54G118G215Y322T335C348G474G515C576A577T691；
a3）G49G54G118G215T322T335C348G474G515C576A577Y691；
a4）G49R54G118G215T322T335C348G474R515C576A577T691；
a5）G49G54S118G215T322W335C348G474G515Y576W577T691；
a6）G49R54G118G215T322T335C348G474G515Y576W577T691；
a7）G49G54G118G215T322T335C348R474G515C576A577T691；
a8）G49G54G118G215T322T335M348R474G515C576A577T691；
a9）G49R54S118G215T322T335C348G474G515Y576A577T691；
a10）G49G54G118R215T322T335C348G474G515T576A577T691；
In a1）-a10）In, M indicates A and C；W indicates A and T；K indicates G and T；Y indicates T and C；R indicates A and G；S indicates G
And C；D indicates G, A and T（The corresponding site of the i.e. described Malus spectabilis kind to be measured is heterozygous）；
（6）According to step（5）Comparison result, cultivar identification is carried out to the Malus spectabilis kind to be measured as follows：
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a1）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is clock Northey Malus spectabilis（Malustschonoskii）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a2）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' golden wasp ' Mains Zumi（Malus×zumi ‘Golden Hornet'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a3）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' Rudoiph ' Malus spectabilis（Malus ‘Rudolph’）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a4）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' powder roof ' Malus spectabilis（Malus ‘Pink Spire’）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a5）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' flame ' Malus spectabilis（Malus ‘Flame'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a6）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' diamond ' Malus spectabilis（Malus‘Sparkler'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a7）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' Sprengel professor ' Mains Zumi（Malus×zumi ‘Professor Sprenger'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a8）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' how meagre profit examines Berman ' Malus spectabilis（Malus ‘Neville Copeman'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a9）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' red long ' Malus spectabilis（Malus‘Red Long'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a10）Shown in nucleic acid molecule formula, then the sea to be measured
Chinese bush cherry kind is or candidate is ' vertical silk ' Malus spectabilis（Malus halliana）；
Certainly, in the method method of a kind of identification or auxiliary identification Malus spectabilis kind to be measured, step（1）Middle use is drawn
Object to being not limited to the primer pair that sequence 1 and sequence 2 form in sequence table, be located at conserved region other primer pairs can also, only
It wants to expand to obtain step（2）In the sequence to be compared（Non-conservative area）?.
Further more, in the method method of Malus spectabilis kind to be measured is identified in a kind of identification or auxiliary, what is be compared is described
Sequence to be compared（Non-conservative area）, the removal of both ends conserved region sequence is not limited to above step（2）Described in, as long as can contain
Lid is used for test sample（Such as Malus spectabilis kind）Polymorphic site in the nucleic acid molecule formula of identification；Correspondingly, step（4）In
In general formula the lower right corner of B number as 5 ' end conserved region sequences accept or reject number and correspondingly change, it is still, more
Relative position between state site is constant.
Further, the method that the above identification provided by the present invention or auxiliary identify Malus spectabilis kind to be measured, operating procedure
It can be converted into as follows：
（1）Using the genomic DNA of Malus spectabilis kind to be measured as template, with two shown in sequence in sequence table 1 and sequence 2
The primer pair of single strand dna composition carries out PCR amplification, obtains PCR product；
（2）The PCR product is sequenced, sequencing result is compared with nucleotide sequence group I；
The nucleotide sequence group I is made of totally sequence 3-12 in sequence table, 10 sequences；
（3）According to step（2）Comparison result, the Malus spectabilis kind to be measured is identified as follows：
If containing sequence 3 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is Zhong Nuo
This Malus spectabilis；
If containing sequence 4 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is ' gold
Wasp ' Mains Zumi；
If containing sequence 5 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is ' Shandong
Doffer ' Malus spectabilis；
If containing sequence 6 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is ' powder
Roof ' Malus spectabilis；
If containing sequence 7 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is ' fire
Flame ' Malus spectabilis；
If containing sequence 8 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is ' brill
Stone ' Malus spectabilis；
If containing sequence 9 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is ' this
Pu Lun is taught ' Mains Zumi；
If containing sequence 10 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured be or it is candidate for ' how
Meagre profit examines Berman ' Malus spectabilis；
If containing sequence 11 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is ' red
Malus spectabilis long '；
If containing sequence 12 in the nucleotide sequence of the PCR product, the Malus spectabilis kind to be measured is or candidate is ' vertical
Silk ' Malus spectabilis.
In the above-mentioned methods, the Malus spectabilis kind to be measured is any kind in following 10 kinds：Clock Northey Malus spectabilis,
' golden wasp ' Mains Zumi, ' Rudoiph ' Malus spectabilis, ' powder roof ' Malus spectabilis, ' flame ' Malus spectabilis, ' diamond ' Malus spectabilis, ' Sprengel professor '
Mains Zumi, ' how meagre profit examines Berman ' Malus spectabilis, ' red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis.
It is a further object to provide a kind of kits being used to identify or assist to identify Malus spectabilis kind to be measured.
The kit provided by the present invention for being used to identify or assist to identify Malus spectabilis kind to be measured, specifically may include primer
To, record the comparison card of nucleic acid molecule formula group I；
Specifically two single strand dnas shown in sequence in sequence table 1 and sequence 2 form the primer pair；
The nucleic acid molecule formula group I is specifically by following a1）-a10）Totally 10 kinds of nucleotide molecular formula compositions：
a1）A49G54G118G215T322T335C348G474G515C576A577T691；
a2）G49G54G118G215Y322T335C348G474G515C576A577T691；
a3）G49G54G118G215T322T335C348G474G515C576A577Y691；
a4）G49R54G118G215T322T335C348G474R515C576A577T691；
a5）G49G54S118G215T322W335C348G474G515Y576W577T691；
a6）G49R54G118G215T322T335C348G474G515Y576W577T691；
a7）G49G54G118G215T322T335C348R474G515C576A577T691；
a8）G49G54G118G215T322T335M348R474G515C576A577T691；
a9）G49R54S118G215T322T335C348G474G515Y576A577T691；
a10）G49G54G118R215T322T335C348G474G515T576A577T691；
In a1）-a10）In, M indicates A and C；W indicates A and T；K indicates G and T；Y indicates T and C；R indicates A and G；S indicates G
And C；D indicates G, A and T（The corresponding site of the i.e. described Malus spectabilis kind to be measured is heterozygous）；
The Malus spectabilis kind to be measured can be any kind in following 10 kinds：Clock Northey Malus spectabilis, ' golden wasp ' pearl is beautiful
Malus spectabilis, ' Rudoiph ' Malus spectabilis, ' powder roof ' Malus spectabilis, ' flame ' Malus spectabilis, ' diamond ' Malus spectabilis, ' Sprengel professor ' Mains Zumi, ' how
Meagre profit examines Berman ' Malus spectabilis, ' it is red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis.
The kit is being identified or is assisting to identify that the application in Malus spectabilis kind to be measured also belongs to protection scope of the present invention.
The Malus spectabilis kind to be measured is any kind in following 10 kinds：Clock Northey Malus spectabilis, ' the U.S. sea of golden wasp ' pearl
It is Chinese bush cherry, ' Rudoiph ' Malus spectabilis, ' powder roof ' Malus spectabilis, ' flame ' Malus spectabilis, ' diamond ' Malus spectabilis, ' Sprengel professor ' Mains Zumi, ' how micro-
Profit examines Berman ' Malus spectabilis, ' it is red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis.
It is also another object of the present invention to provide a kind of methods that identification or auxiliary identification wait for measuring plants.
The method that identification provided by the present invention or auxiliary identify Malus spectabilis kind to be measured, specifically may include following steps：
（1）By comparing the DNA sequence dna for the multiple kinds for belonging to same plant, the DNA sequence dna of the Malus spectabilis kind is chosen
It is middle that there are the region of mononucleotide polymorphic site region of DNA domains as a purpose；
（2）Using the sequence of target DNA region both sides conservative region, design can expand to obtain containing the purpose
The primer of the DNA fragmentation in region of DNA domain；
（3）PCR amplification is carried out respectively with the genomic DNA of each plant in the multiple plant of the primer pair, from
The DNA fragmentation containing the target DNA region is obtained in each kind；
（4）To step（3）The DNA fragmentation containing the target DNA region obtained from each plant is sequenced, from
And obtain the nucleotide sequence in the target DNA region of each plant；
（5）The nucleotide sequence in the target DNA region of the various plants is put together and is compared, is obtained
DNA aligned sequences matrixes determine mononucleotide polymorphic site according to the DNA aligned sequences matrix, list the mirror of each plant
Surely nucleic acid molecule formula is used；
The nucleic acid molecule formula by according to the DNA aligned sequences matrix from 5 ' ends to 3 ' ends or from 3 ' ends to
5 ' ends sequentially list the nucleotide type of all mononucleotide polymorphic sites and its in the DNA aligned sequences matrixes
In sequence of positions number composition；The nucleic acid molecule formula general formula is Bx1Bx2Bx3……Bxn, in general formula, B is that mononucleotide is more
Nucleotide type on state site is any kind or two kinds in tetra- kinds of A, T, C, G；x1For the 1st mononucleotide polymorphic
Sequence of positions number of the site in the DNA aligned sequences matrix from 5 ' ends or 3 ' ends,x2For the 2nd mononucleotide
Sequence of positions number of the polymorphic site in the DNA aligned sequences matrix from 5 ' ends or 3 ' ends,x3For the 3rd monokaryon
Sequence of positions number of the thuja acid polymorphic site in the DNA aligned sequences matrix from 5 ' ends or 3 ' ends, analogizes,xnFor
Sequence of positions number of n-th of mononucleotide polymorphic site in the DNA aligned sequences matrix from 5 ' ends or 3 ' ends；
The Bx1Bx2Bx3……BxnFor by all mononucleotide polymorphic sites according in the DNA aligned sequences
It is sequentially listed from 5 ' ends or 3 ' ends in matrix；Certainly in practical operation, the identical site of effect is distinguished, can only be protected
One is stayed, for building nucleic acid molecule formula；
（6）A pedigree will be formed with the plant of the identical nucleic acid molecule formula, there are different nucleotide molecular formula
Plant as different pedigrees, all pedigrees constitute nucleic acid molecule formula pedigree charts；
In the nucleic acid molecule formula pedigree chart, each nucleic acid molecule formula corresponds to plant or plant from pedigree
Strain；
（7）Step will be belonged to（1）Described in same plant plant sample to be measured according to step（3）-（5）Repetitive operation,
Measuring plants alternative steps are waited for described（3）-（5）In each plant, obtain the nucleosides of the plant sample to be measured
Acid molecule formula；By all nucleosides in the nucleic acid molecule formula of the plant sample to be measured and the nucleic acid molecule formula pedigree chart
Acid molecule formula is compared, the pedigree for determining the title of the plant sample to be measured as follows and its being subordinate to：If described
The nucleic acid molecule formula of plant sample to be measured is identical as a nucleic acid molecule formula in the nucleic acid molecule formula pedigree chart, then
The plant sample to be measured is or candidate is any one kind in the corresponding pedigree of one nucleic acid molecule formula.
The method high sensitivity is suitable for identifying the different cultivars of a certain plant.
In the present invention, the plant is specially the different cultivars of Malus spectabilis kind.
In the method, the target DNA region specifically may be from the ubiquitin in the genome of the plant sample
Ligase gene regions.
In the present invention, step（2）In, the primer is specially two lists shown in sequence in sequence table 1 and sequence 2
The primer pair of ssdna molecule composition；The target DNA region specifically comes from using the primer pair to the plant sample
Genomic DNA carries out the PCR product obtained by PCR amplification.
Further, multiple kinds of the Malus spectabilis kind and its corresponding target DNA region are as follows：
Multiple kinds of the Malus spectabilis kind are at least two kinds in following 10 kind：Clock Northey Malus spectabilis, ' golden wasp '
Mains Zumi, ' Rudoiph ' Malus spectabilis, ' powder roof ' Malus spectabilis, ' flame ' Malus spectabilis, ' diamond ' Malus spectabilis, ' the U.S. sea of Sprengel professor ' pearl
Chinese bush cherry, ' how meagre profit examines Berman ' Malus spectabilis, ' red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis.
The nucleotides sequence in the region of DNA domain of the clock Northey Malus spectabilis of the Malus spectabilis kind is classified as sequence 3 in sequence table；
The Malus spectabilis kind ' nucleotides sequence in the region of DNA domain of golden wasp ' Mains Zumi is classified as sequence in sequence table
4；
The nucleotides sequence in the region of DNA domain of ' Rudoiph ' Malus spectabilis of the Malus spectabilis kind is classified as sequence 5 in sequence table；
The Malus spectabilis kind ' nucleotides sequence in the region of DNA domain of powder roof ' Malus spectabilis is classified as sequence 6 in sequence table；
The nucleotides sequence in the region of DNA domain of ' flame ' Malus spectabilis of the Malus spectabilis kind is classified as sequence 7 in sequence table；
The nucleotides sequence in the region of DNA domain of ' diamond ' Malus spectabilis of the Malus spectabilis kind is classified as sequence 8 in sequence table；
The nucleotides sequence in the region of DNA domain of the Malus spectabilis kind ' Sprengel professor ' Mains Zumi is classified as sequence in sequence table
Row 9；
The nucleotides sequence in the region of DNA domain of Malus spectabilis kind ' how meagre profit the examines Berman ' Malus spectabilis is classified as sequence in sequence table
10；
The nucleotides sequence in the region of DNA domain of ' red long ' Malus spectabilis of the Malus spectabilis kind is classified as sequence 11 in sequence table；
The Malus spectabilis kind ' nucleotides sequence in the region of DNA domain of vertical silk ' Malus spectabilis is classified as sequence 12 in sequence table.
Clock Northey Malus spectabilis, ' golden wasp ' Mains Zumi, ' Rudoiph ' Malus spectabilis, ' powder roof ' Malus spectabilis, ' is bored at ' flame ' Malus spectabilis
Stone ' Malus spectabilis, ' Sprengel professor ' Mains Zumi, ' how meagre profit examines Berman ' Malus spectabilis, ' red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis.
More specifically, the nucleic acid molecule formula in the region of DNA domain of the clock Northey Malus spectabilis is
A49G54G118G215T322T335C348G474G515C576A577T691；
It is described that ' the nucleic acid molecule formula in the region of DNA domain of golden wasp ' Mains Zumi is
G49G54G118G215Y322T335C348G474G515C576A577T691；
The nucleic acid molecule formula in the region of DNA domain of ' Rudoiph ' Malus spectabilis is
G49G54G118G215T322T335C348G474G515C576A577Y691；
It is described that ' the nucleic acid molecule formula in the region of DNA domain of powder roof ' Malus spectabilis is
G49R54G118G215T322T335C348G474R515C576A577T691；
The nucleic acid molecule formula in the region of DNA domain of ' flame ' Malus spectabilis is
G49G54S118G215T322W335C348G474G515Y576W577T691；
The nucleic acid molecule formula in the region of DNA domain of ' diamond ' Malus spectabilis is
G49R54G118G215T322T335C348G474G515Y576W577T691；
It is described that ' the nucleic acid molecule formula in the region of DNA domain of Sprengel professor ' Mains Zumi is
G49G54G118G215T322T335C348R474G515C576A577T691；
The nucleic acid molecule formula in the region of DNA domain of ' how meagre profit the examines Berman ' Malus spectabilis is
G49G54G118G215T322T335M348R474G515C576A577T691；
The nucleic acid molecule formula in the region of DNA domain of ' long red ' Malus spectabilis is
G49R54S118G215T322T335C348G474G515Y576A577T691；
It is described that ' the nucleic acid molecule formula in the region of DNA domain of vertical silk ' Malus spectabilis is
G49G54G118R215T322T335C348G474G515T576A577T691；
Wherein, M indicates A and C；W indicates A and T；K indicates G and T；Y indicates T and C；R indicates A and G；S indicates G and C；D tables
Show G, A and T（The corresponding site of the i.e. described Malus spectabilis kind to be measured is heterozygous）.
The present invention is by taking the qualification process of Malus spectabilis kind as an example, it is demonstrated experimentally that provided by the present invention reflected using the molecular formula
It is colonized object（Such as Malus spectabilis kind）Method it is more accurate, simple to operation, can improve related industry production efficiency and quality prison
Level is surveyed, the deficiency of previous methods is effectively made up；In addition, this method realizes non-florescence fruiting period simultaneously（Such as seedling stage）Accurate mirror
It is fixed.This method is for promoting the breeding of Malus spectabilis kind, the development of Malus spectabilis flowers and treesmarket and environmental protection to be of great significance.
Specific implementation mode
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Malus spectabilis kind：Clock Northey Malus spectabilis, ' golden wasp ' Mains Zumi, ' Rudoiph ' Malus spectabilis, ' powder roof ' Malus spectabilis, ' flame '
Malus spectabilis, ' diamond ' Malus spectabilis, ' Sprengel professor ' Mains Zumi, ' how meagre profit examines Berman ' Malus spectabilis, ' red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis
Spire pick up from Shandong Province Forest Tree Plasm Resources center germplasm resource bank.
Embodiment 1, using nucleic acid molecule formula identify Malus spectabilis kind method foundation and its application
In order to build the nucleic acid molecule formula that can be used in effectively identifying Malus spectabilis kind, the present inventor is to plunge into the commercial sea
One section of non-conservative area's DNA sequence dna is obtained in Chinese bush cherry kind series, and statistical analysis has been carried out to polymorphic site therein.As for examination
The Malus spectabilis kind of material totally 10 kinds, it is specific as follows：Clock Northey Malus spectabilis, ' golden wasp ' Mains Zumi, ' Rudoiph ' Malus spectabilis,
' powder roof ' Malus spectabilis, ' flame ' Malus spectabilis, ' diamond ' Malus spectabilis, ' Sprengel professor ' Mains Zumi, ' how meagre profit examines Berman ' Malus spectabilis,
' red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis.
One, design of primers
According to the conserved region at one section of non-conservative area's DNA sequence dna both ends, following primer is designed：
Forward primer：5'- GATTATGCCGAACATAGGAGT -3'（Sequence 1）；
Reverse primer：5'- CCAGTGCCCACTTCACC -3'（Sequence 2）.
Two, the sequencing of PCR amplification and PCR product
Using the young leaflet tablet of 10 parts of Malus spectabilis kinds as material to be tested as experiment material, carried using plant genome DNA
Take kit（Chinese Tiangeng biotechnology（Beijing）Co., Ltd's product, catalog number DP305）Extract each sample material
The genomic DNA of material.Using gained genomic DNA as template, PCR amplification is carried out using the primer pair of step 1 design.As a result it shows
Show, the PCR product that a length is about 1kb can be obtained in every part of Malus spectabilis kind.
Each PCR product after purification is sequenced, the DNA that the length containing several polymorphic sites is 786bp is obtained
Sequence.According to the sequencing result of 10 parts of Malus spectabilis kinds for examination, DNA sequence dna is defined as to the nucleotide sequence of the PCR product
20-805 from 5 ' ends（786bp）.By 20th nucleotide note of the nucleotide sequence of the PCR product from 5 ' ends
It is the 1st.（Longer or shorter sequence variation may also occur in the high-frequency generation area of this variation, future, may be because
The difference of sample to be tested and be slightly changed, at that time can according to actual conditions obtain aligned sequences matrix, determine subsequent polymorphic position
The sequence of positions number of point.）
10 parts of Malus spectabilis kinds are clock Northey Malus spectabilis, ' golden wasp ' Mains Zumi, ' Rudoiph ' Malus spectabilis, ' powder roof ' sea respectively
Chinese bush cherry, ' flame ' Malus spectabilis, ' diamond ' Malus spectabilis, ' Sprengel professor ' Mains Zumi, ' how meagre profit examines Berman ' Malus spectabilis, ' are red long ' Malus spectabilis,
' vertical silk ' Malus spectabilis.
The results show that the DNA sequence dna of clock Northey Malus spectabilis is sequence 3 in sequence table；
' DNA sequence dna of golden wasp ' Mains Zumi is sequence 4 in sequence table；
The DNA sequence dna of ' Rudoiph ' Malus spectabilis is sequence 5 in sequence table；
' DNA sequence dna of powder roof ' Malus spectabilis is sequence 6 in sequence table；
The DNA sequence dna of ' flame ' Malus spectabilis is sequence 7 in sequence table；
The DNA sequence dna of ' diamond ' Malus spectabilis is sequence 8 in sequence table；
' DNA sequence dna of Sprengel professor ' Mains Zumi is sequence 9 in sequence table；
The DNA sequence dna of ' how meagre profit examines Berman ' Malus spectabilis is sequence 10 in sequence table；
The DNA sequence dna of ' red long ' Malus spectabilis is sequence 11 in sequence table；
' DNA sequence dna of vertical silk ' Malus spectabilis is sequence 12 in sequence table.
Three, sequence alignment
The DNA sequence dna of 10 parts of Malus spectabilis kinds obtained by step 2 is compared, DNA aligned sequences matrixes are obtained
（aligned sequence matrix）.And then it obtains such as 12 mononucleotide polymorphic positions of Malus spectabilis cultivar identification in table 1
Point.
Mononucleotide polymorphic site in the DNA sequence dna of 1 10 parts of Malus spectabilis kinds of table
Note：M indicates A and C；W indicates A and T；K indicates G and T；Y indicates T and C；R indicates A and G；S indicates G and C；D is indicated
G, A and T（The corresponding site of the i.e. described Malus spectabilis kind to be measured is heterozygous）.In sequencing, corresponding heterozygous sites can detect obviously
Superposition set peak." Position Number of polymorphic site " is the Position Number in the DNA aligned sequences matrix.
It is only sorted by comparing, can just show the regularity of sample room sequence difference, this is biological information theory
With the component part of principle.
Four, the structure for the nucleic acid molecule formula of Malus spectabilis cultivar identification
According to the nucleotide of each polymorphic site of Malus spectabilis kind listed in table 1 letter and its in DNA aligned sequences squares
Position in battle array, lists the corresponding nucleic acid molecule formula of each Malus spectabilis kind, specific as follows：
Clock Northey Malus spectabilis, ' golden wasp ' Mains Zumi, ' Rudoiph ' Malus spectabilis, ' powder roof ' Malus spectabilis, ' is bored at ' flame ' Malus spectabilis
Stone ' Malus spectabilis, ' Sprengel professor ' Mains Zumi, ' how meagre profit examines Berman ' Malus spectabilis, ' red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis.
The nucleic acid molecule formula of clock Northey Malus spectabilis is A49G54G118G215T322T335C348G474G515C576A577T691；
' the nucleic acid molecule formula of golden wasp ' Mains Zumi is G49G54G118G215Y322T335C348G474G515C576A577T691；
The nucleic acid molecule formula of ' Rudoiph ' Malus spectabilis is G49G54G118G215T322T335C348G474G515C576A577Y691；
' the nucleic acid molecule formula of powder roof ' Malus spectabilis is G49R54G118G215T322T335C348G474R515C576A577T691；
The nucleic acid molecule formula of ' flame ' Malus spectabilis is G49G54S118G215T322W335C348G474G515Y576W577T691；
The nucleic acid molecule formula of ' diamond ' Malus spectabilis is G49R54G118G215T322T335C348G474G515Y576W577T691；
' the nucleic acid molecule formula of Sprengel professor ' Mains Zumi is G49G54G118G215T322T335C348R474G515C576A577T691；
The nucleic acid molecule formula of ' how meagre profit examines Berman ' Malus spectabilis is G49G54G118G215T322T335M348R474G515C576A577T691；
The nucleic acid molecule formula of ' red long ' Malus spectabilis is G49R54S118G215T322T335C348G474G515Y576A577T691；
' the nucleic acid molecule formula of vertical silk ' Malus spectabilis is G49G54G118R215T322T335C348G474G515T576A577T691。
M in above each nucleic acid molecule formula indicates A and C；K indicates G and T；Y indicates T and C；R indicate A and
G.M, K, Y or the R contained in nucleic acid molecule formula is the heterozygous sites in Malus spectabilis kind genome, can be obtained in sequencing bright
The set peak of aobvious superposition.
Five, Malus spectabilis kind is identified with nucleic acid molecule formula
（1）Using the genomic DNA of Malus spectabilis kind to be measured as template, with two shown in sequence in sequence table 1 and sequence 2
The primer pair of single strand dna composition carries out PCR amplification, obtains PCR product；
（2）After the PCR product is sequenced, first 19 of the nucleotide sequence of the PCR product from 5 ' ends are cut out
Nucleotide（19 nucleotide is the conserved region sequence that PCR product 5 ' is held；The end of PCR product 3 ' can certainly be cut out simultaneously
The 806th（Contain）Later nucleotide）, residue sequence is as sequence to be compared（Non-conservative area）；
（3）The sequence to be compared is put together with the full sequence in DNA sequence dna library and is compared, DNA ratios are obtained
To sequence matrix；
The DNA sequence dna library is as follows（a1）：
（a1）It is made of at least one of sequence in sequence table 3 to sequence 12；
（4）The nucleic acid molecule formula of the Malus spectabilis kind to be measured is listed according to the DNA aligned sequences matrix；
The general formula of the nucleic acid molecule formula of the Malus spectabilis kind to be measured is：
B49B54B118B215B322B335B348B474B515B576B577B691；
In the general formula, the B49, the B54, the B118, the B215, the B322, the B335, the B348、
The B474, the B515, the B576, the B577With the B691, indicate successively in the DNA sequence dna comparison data matrix
The the 49th, 54,118,215,322,335,348,474,515,576,577 and 691 site（Corresponding DNA sequence the 49th,
54,118,215,322,335,348,474,515,576,577 and 691 nucleotide sites）；
In the general formula, each B is any one of A, T, C and G or two kinds（When the tool of the Malus spectabilis kind to be measured
When body nucleotide site is homozygous site, in the general formula, each B is any one of A, T, C and G, in sequencing
Show simple spike；It is each in the general formula when the specific nucleotide site of the Malus spectabilis kind to be measured is heterozygous site
A B is two kinds in A, T, C and G, the set peak that can be significantly superimposed in sequencing.
（5）The Malus spectabilis kind to be measured is identified as follows：
Clock Northey Malus spectabilis, ' golden wasp ' Mains Zumi, ' Rudoiph ' Malus spectabilis, ' powder roof ' Malus spectabilis, ' is bored at ' flame ' Malus spectabilis
Stone ' Malus spectabilis, ' Sprengel professor ' Mains Zumi, ' how meagre profit examines Berman ' Malus spectabilis, ' red long ' Malus spectabilis, ' vertical silk ' Malus spectabilis.
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
A49G54G118G215T322T335C348G474G515C576A577T691, then the Malus spectabilis kind to be measured is or candidate is clock Northey Malus spectabilis；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49G54G118G215Y322T335C348G474G515C576A577T691, then the Malus spectabilis kind to be measured is or candidate is ' golden wasp ' pearl is beautiful
Malus spectabilis；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49G54G118G215T322T335C348G474G515C576A577Y691, then the Malus spectabilis kind to be measured is or candidate is ' Rudoiph ' Malus spectabilis；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49R54G118G215T322T335C348G474R515C576A577T691, then the Malus spectabilis kind to be measured is or candidate is ' powder roof ' Malus spectabilis；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49G54S118G215T322W335C348G474G515Y576W577T691, then the Malus spectabilis kind to be measured is or candidate is ' flame ' Malus spectabilis；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49R54G118G215T322T335C348G474G515Y576W577T691, then the Malus spectabilis kind to be measured is or candidate is ' diamond ' Malus spectabilis；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49G54G118G215T322T335C348R474G515C576A577T691, then the Malus spectabilis kind to be measured is or candidate is ' Sprengel professor '
Mains Zumi；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49G54G118G215T322T335M348R474G515C576A577T691, then the Malus spectabilis kind to be measured is or candidate is ' how meagre profit examines primary
It is graceful ' Malus spectabilis；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49R54S118G215T322T335C348G474G515Y576A577T691, then the Malus spectabilis kind to be measured is or candidate is ' red long ' Malus spectabilis；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is
G49G54G118R215T322T335C348G474G515T576A577T691, then the Malus spectabilis kind to be measured is or candidate is ' vertical silk ' Malus spectabilis.
Six, the new taxa key of Malus spectabilis kind
The new taxa key that 10 parts of Malus spectabilis kinds are developed according to the nucleic acid molecule formula of each sample obtained by step 5, is shown in
Table 2.
The new taxa key of 2 10 parts of Malus spectabilis kinds of table
1a. A49Type ... ... ... ... ... ... clock Northey Malus spectabilis
1b. G49Other samples in type ... ... ... ... ... ... this retrieval table
2a. Y322Type ... ... ... ... ... ... ' golden wasp ' Mains Zumi
2b. T322Other samples in type ... ... ... ... ... ... this retrieval table
3a. Y691Type ... ... ... ... ... ... ' Rudoiph ' Malus spectabilis
3b. T691Other samples in type ... ... ... ... ... ... this retrieval table
4a. R515Type ... ... ... ... ... ... ' powder roof ' Malus spectabilis
4b. G515Other samples in type ... ... ... ... ... ... this retrieval table
5a. W577Type
6a. G54S118W335Type ... ... ... ... ' flame ' Malus spectabilis
6b. R54G118T335Type ... ... ... ... ' diamond ' Malus spectabilis
5b. A577Other samples in type ... ... ... ... ... this retrieval table
7a. G474Type
8a. C348R660R760Type ... ... ... ... ' Sprengel professor ' Mains Zumi
8b. M348G660G760Type ... ... ... ... ' how meagre profit examines Berman ' Malus spectabilis
7b. R474Other samples in type ... ... ... ... ... this retrieval table
9a. S118Type ... ... ... ... ... ... ... ' red long ' Malus spectabilis
9b. G118Other samples in type ... ... ... ... ... this retrieval table
10a. R215Type ... ... ... ... ... ' vertical silk ' Malus spectabilis
10b. G215Other samples in type ... ... ... ... ... ... this retrieval table
Embodiment 2, other Malus spectabilis kinds for identifying Malus
In order to verify validity and specificity of the nucleic acid molecule formula for Malus spectabilis cultivar identification of the foundation of embodiment 1, this
The inventor of invention also acquires midget crabapple（Malus×micromalus）, ' Fan Aisaier pavilions ' Malus spectabilis（Malus ‘Van
Eseltine'）, ' persons of royal lineage ' Malus spectabilis（Malus ‘Royalty'）, ' gorgeous ' Malus spectabilis（Malus ‘Radiant'）, ' deep red ' Malus spectabilis
（Malus ‘Black Red'）, the blade of this 5 parts of Malus spectabilis kinds, and according to the method for embodiment 1, its genomic DNA is extracted,
PCR amplification and sequencing are carried out with the primer pair that two single strand dnas are constituted shown in sequence 1 and sequence 2, obtains 5 parts
The DNA sequence dna of Malus spectabilis kind.Wherein, the DNA sequence dna of midget crabapple is shown in sequence 13 in sequence table；' Fan Aisaier pavilions ' Malus spectabilis
DNA sequence dna be in sequence table shown in sequence 14；The DNA sequence dna of ' persons of royal lineage ' Malus spectabilis is shown in sequence 15 in sequence table；' gorgeous '
The DNA sequence dna of Malus spectabilis is shown in sequence 16 in sequence table；The DNA sequence dna of ' deep red ' Malus spectabilis is shown in sequence 17 in sequence table.
The DNA sequence dna of sequence 13-17 this 5 parts of Malus spectabilis kinds and the sequence of aforementioned 10 portions of Malus spectabilis kind are put together, profit
Use software（Such as Mega softwares）It is compared, obtains DNA aligned sequences matrixes, be further listed in the nucleic acid molecule of midget crabapple
Formula is：G49G54G118R215T322T335C348G474G515Y576A577T691；' the nucleic acid molecule formula of Fan Aisaier pavilions ' Malus spectabilis is：
G49R54G118R215T322T335C348G474G515Y576A577T691；The nucleic acid molecule formula of ' persons of royal lineage ' Malus spectabilis is
G49G54G118G215T322T335A348G474G515C576A577T691；The nucleic acid molecule formula of ' gorgeous ' Malus spectabilis is：
G49R54G118G215T322T335M348G474G515C576A577T691；The nucleic acid molecule formula of ' deep red ' Malus spectabilis is：
G49G54G118G215T322T335M348G474G515C576A577T691。
As it can be seen that midget crabapple, ' Fan Aisaier pavilions ' Malus spectabilis, ' persons of royal lineage ' Malus spectabilis, ' gorgeous ' Malus spectabilis, ' deep red ' Malus spectabilis, this 5 parts
The nucleic acid molecule formula of Malus spectabilis kind is different, and 10 kinds of nucleotide corresponding with 10 parts of Malus spectabilis kinds in embodiment 1 point
Minor is all different.To, it was confirmed that the validity and specificity of the method for the present invention.Imply this method in the following classification application
Aspect still has huge value and potentiality.
Claims (7)
1. a kind of method that identification or auxiliary identify Malus spectabilis kind to be measured, which is characterized in that include the following steps：
（1）Using the genomic DNA of Malus spectabilis kind to be measured as template, with shown in sequence in sequence table 1 and sequence 2 two it is single-stranded
The primer pair of DNA molecular composition carries out PCR amplification, obtains PCR product；
（2）After the PCR product is sequenced, preceding 19 nucleosides of the nucleotide sequence of the PCR product from 5 ' ends is cut out
Acid and the 806th later nucleotide, residue sequence is as sequence to be compared；
（3）The sequence to be compared is put together with the full sequence in DNA sequence dna library and is compared, DNA is obtained and compares sequence
Column matrix；
The DNA sequence dna library is as follows（a1）：
（a1）It is made of at least one of sequence in sequence table 3 to sequence 12；
（4）The nucleic acid molecule formula of the Malus spectabilis kind to be measured is listed according to the DNA aligned sequences matrix；
The general formula of the nucleic acid molecule formula of the Malus spectabilis kind to be measured is：
B49B54B118B215B322B335B348B474B515B576B577B691；
In the general formula, the B49, the B54, the B118, the B215, the B322, the B335, the B348, it is described
B474, the B515, the B576, the B577With the B691, in the DNA sequence dna comparison data matrix is indicated successively
49,54,118,215,322,335,348,474,515,576,577 and 691 sites, corresponding DNA sequence the 49th, 54,
118,215,322,335,348,474,515,576,577 and 691 nucleotide sites；
In the general formula, each B is any one of A, T, C and G or two kinds；
When the Malus spectabilis kind to be measured is homozygous, in the general formula, each B is any one of A, T, C and G,
Simple spike is shown when sequencing；When the Malus spectabilis kind to be measured is heterozygous, in the general formula, each B may be A, T, C
With two kinds in G, can obtain significantly being superimposed set peak in sequencing；
（5）By step（4）The nucleic acid molecule formula of the gained Malus spectabilis kind to be measured is compared with nucleic acid molecule formula group I；
The nucleic acid molecule formula group I is by following a1）-a10）Totally 10 kinds of nucleotide molecular formula compositions：
a1）A49G54G118G215T322T335C348G474G515C576A577T691；
a2）G49G54G118G215Y322T335C348G474G515C576A577T691；
a3）G49G54G118G215T322T335C348G474G515C576A577Y691；
a4）G49R54G118G215T322T335C348G474R515C576A577T691；
a5）G49G54S118G215T322W335C348G474G515Y576W577T691；
a6）G49R54G118G215T322T335C348G474G515Y576W577T691；
a7）G49G54G118G215T322T335C348R474G515C576A577T691；
a8）G49G54G118G215T322T335M348R474G515C576A577T691；
a9）G49R54S118G215T322T335C348G474G515Y576A577T691；
a10）G49G54G118R215T322T335C348G474G515T576A577T691；
In a1）-a10）In, the corresponding site of the Malus spectabilis kind to be measured is heterozygous, and M indicates A and C；K indicates G and T；Y is indicated
T and C；R indicates A and G；S indicates G and C；
（6）According to step（5）Comparison result, the Malus spectabilis kind to be measured is identified as follows：
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a1）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is clock Northey Malus spectabilis（Malus tschonoskii）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a2）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' golden wasp ' Mains Zumi（Malus×zumi‘Golden Hornet'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a3）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' Rudoiph ' Malus spectabilis（Malus‘Rudolph’）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a4）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' powder roof ' Malus spectabilis（Malus‘Pink Spire’）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a5）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' flame ' Malus spectabilis（Malus‘Flame'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a6）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' diamond ' Malus spectabilis（Malus‘Sparkler'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a7）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' Sprengel professor ' Mains Zumi（Malus×zumi‘Professor Sprenger'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a8）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' how meagre profit examines Berman ' Malus spectabilis（Malus‘Neville Copeman'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a9）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' red long ' Malus spectabilis（Malus‘Red Long'）；
If the nucleic acid molecule formula of the Malus spectabilis kind to be measured is a10）Shown in nucleic acid molecule formula, then Malus spectabilis product to be measured
Kind is or candidate is ' vertical silk ' Malus spectabilis（Malushalliana）.
2. according to the method described in claim 1, it is characterized in that, the Malus spectabilis kind to be measured is any in following 10 kind
Kind：Clock Northey Malus spectabilis（Malustschonoskii）, ' golden wasp ' Mains Zumi（Malus×zumi‘Golden
Hornet'）, ' Rudoiph ' Malus spectabilis（Malus‘Rudolph'）, ' powder roof ' Malus spectabilis（Malus‘Pink Spire'）, ' flame '
Malus spectabilis（Malus‘Flame'）, ' diamond ' Malus spectabilis（Malus‘Sparkler'）, ' Sprengel professor ' Mains Zumi（Malus×zumi‘Professor Sprenger'）, ' how meagre profit examines Berman ' Malus spectabilis（Malus‘Neville Copeman'）, ' long red ' sea
Chinese bush cherry（Malus‘Red Long'）, ' vertical silk ' Malus spectabilis（Malushalliana）.
3. a kind of kit being used to identify or assist to identify Malus spectabilis kind to be measured, which is characterized in that including primer pair, record
The comparison card of nucleic acid molecule formula group I；
The primer pair two single strand dnas shown in sequence in sequence table 1 and sequence 2 form；
The nucleic acid molecule formula group I is by following a1）-a10）Totally 10 kinds of nucleotide molecular formula compositions：
a1）A49G54G118G215T322T335C348G474G515C576A577T691；
a2）G49G54G118G215Y322T335C348G474G515C576A577T691；
a3）G49G54G118G215T322T335C348G474G515C576A577Y691；
a4）G49R54G118G215T322T335C348G474R515C576A577T691；
a5）G49G54S118G215T322W335C348G474G515Y576W577T691；
a6）G49R54G118G215T322T335C348G474G515Y576W577T691；
a7）G49G54G118G215T322T335C348R474G515C576A577T691；
a8）G49G54G118G215T322T335M348R474G515C576A577T691；
a9）G49R54S118G215T322T335C348G474G515Y576A577T691；
a10）G49G54G118R215T322T335C348G474G515T576A577T691；
In a1）-a10）In, M indicates A and C；Y indicates T and C；R indicates that A and G, W indicate that A and T, S indicate G and C；
The Malus spectabilis kind to be measured is any kind in following 10 kind：Clock Northey Malus spectabilis（Malustschonoskii）, ' gold
Wasp ' Mains Zumi（Malus×zumi‘Golden Hornet'）, ' Rudoiph ' Malus spectabilis（Malus‘Rudolph'）, ' powder room
Top ' Malus spectabilis（Malus‘Pink Spire'）, ' flame ' Malus spectabilis（Malus‘Flame'）, ' diamond ' Malus spectabilis（Malus
‘Sparkler'）, ' Sprengel professor ' Mains Zumi（Malus×zumi‘Professor Sprenger'）, ' how meagre profit examines primary
It is graceful ' Malus spectabilis（Malus‘Neville Copeman'）, ' long red ' Malus spectabilis（Malus‘Red Long'）, ' vertical silk ' Malus spectabilis
（Malushalliana）.
4. application of the kit described in claim 3 in identifying or assisting identifying Malus spectabilis kind to be measured, which is characterized in that
The Malus spectabilis kind to be measured is any kind in following 10 kind：Clock Northey Malus spectabilis（Malustschonoskii）, ' gold
Wasp ' Mains Zumi（Malus×zumi‘Golden Hornet'）, ' Rudoiph ' Malus spectabilis（Malus‘Rudolph'）, ' powder room
Top ' Malus spectabilis（Malus‘Pink Spire'）, ' flame ' Malus spectabilis（Malus‘Flame'）, ' diamond ' Malus spectabilis（Malus
‘Sparkler'）, ' Sprengel professor ' Mains Zumi（Malus×zumi‘Professor Sprenger'）, ' how meagre profit examines primary
It is graceful ' Malus spectabilis（Malus‘Neville Copeman'）, ' long red ' Malus spectabilis（Malus‘Red Long'）, ' vertical silk ' Malus spectabilis
（Malushalliana）.
5. a kind of method that identification or auxiliary identification wait for measuring plants, which is characterized in that include the following steps：
（1）By comparing the DNA sequence dna for the multiple kinds for belonging to same plant, chooses in the DNA sequence dna of the multiple kind and deposit
In the region of mononucleotide polymorphic site, region of DNA domain, the target DNA region come from the genome of the plant as a purpose
Interior ubiquitin ligase gene area；
（2）Using the sequence of target DNA region both sides conservative region, design can expand to obtain containing the target DNA
The primer of the DNA fragmentation in region, the primer are specially two single strand dnas shown in sequence in sequence table 1 and sequence 2
The primer pair of composition；
（3）PCR amplification is carried out respectively with the genomic DNA of each kind in the multiple kind of the primer pair, from each
The DNA fragmentation containing the target DNA region is obtained in kind；
（4）To step（3）The DNA fragmentation containing the target DNA region obtained from each kind is sequenced, to obtain
Obtain the nucleotide sequence in the target DNA region of each kind；
（5）The nucleotide sequence in the target DNA region of the multiple kind is put together and is compared, DNA ratios are obtained
To sequence matrix, mononucleotide polymorphic site is determined according to the DNA aligned sequences matrix, lists the nucleotide point of each kind
Minor；
The nucleic acid molecule formula by according to the DNA aligned sequences matrix from 5 ' ends to 3 ' ends or from 3 ' ends to 5 ' end
End sequentially lists the nucleotide type of all mononucleotide polymorphic sites and its in the DNA aligned sequences matrix
Sequence of positions number composition；The nucleic acid molecule formula general formula is Bx1Bx2Bx3……Bxn, in general formula, B is mononucleotide polymorphic position
Nucleotide type on point is any one of tetra- kinds of A, T, C, G or two kinds；X1 is the 1st mononucleotide polymorphic site in institute
It is the 2nd mononucleotide polymorphic site to state the sequence of positions number from 5 ' ends or 3 ' ends, x2 in DNA aligned sequences matrixes
Sequence of positions number in the DNA aligned sequences matrix from 5 ' ends or 3 ' ends, x3 are the 3rd mononucleotide polymorphic
Sequence of positions number of the site in the DNA aligned sequences matrix from 5 ' ends or 3 ' ends, analogizes, and xn is single n-th
Sequence of positions number of the nucleotide polymorphism site in the DNA aligned sequences matrix from 5 ' ends or 3 ' ends；
The Bx1Bx2Bx3……BxnFor by all mononucleotide polymorphic sites according in the DNA aligned sequences matrix
In sequentially listed from 5 ' ends or 3 ' ends；
（6）A pedigree will be formed with the plant of the identical nucleic acid molecule formula, the product with different nucleotide molecular formula
Kind is different pedigree, and all pedigrees constitute nucleic acid molecule formula pedigree charts；
In the nucleic acid molecule formula pedigree chart, each nucleic acid molecule formula corresponds to the plant variety from a pedigree；
（7）Step will be belonged to（1）Described in same plant plant sample to be measured according to step（3）-（5）Institute is used in repetitive operation
State plant sample alternative steps to be measured（3）-（5）In described each kind, obtain the nucleic acid molecule of the plant sample to be measured
Formula；By all nucleic acid molecules in the nucleic acid molecule formula of the plant sample to be measured and the nucleic acid molecule formula pedigree chart
Formula is compared, the pedigree for determining the title of the plant sample to be measured as follows and its being subordinate to：If the plant to be measured
The nucleic acid molecule formula of object sample is identical as a nucleic acid molecule formula in the nucleic acid molecule formula pedigree chart, then described to wait for
Measuring plants sample is or candidate is any one sample in the corresponding pedigree of one nucleic acid molecule formula；
The plant is Malus spectabilis kind；
The general formula of the nucleic acid molecule formula of the Malus spectabilis kind to be measured is：
B49B54B118B215B322B335B348B474B515B576B577B691。
6. the method that a kind of identification according to claim 5 or auxiliary identification wait for measuring plants, it is characterised in that：The Malus spectabilis
Multiple kinds and its corresponding target DNA region be as follows：
Multiple kinds of the Malus spectabilis kind are at least two kinds in following 10 kinds：Clock Northey Malus spectabilis
（Malustschonoskii）, ' golden wasp ' Mains Zumi（Malus×zumi‘Golden Hornet'）, ' Rudoiph ' Malus spectabilis
（Malus‘Rudolph'）, ' powder roof ' Malus spectabilis（Malus‘Pink Spire'）, ' flame ' Malus spectabilis（Malus‘Flame'）, ' bore
Stone ' Malus spectabilis（Malus‘Sparkler'）, ' Sprengel professor ' Mains Zumi（Malus×zumi‘Professor
Sprenger'）, ' how meagre profit examines Berman ' Malus spectabilis（Malus‘Neville Copeman'）, ' long red ' Malus spectabilis（Malus‘Red
Long'）, ' vertical silk ' Malus spectabilis（Malushalliana）；
The clock Northey Malus spectabilis（Malustschonoskii）The nucleotides sequence in the region of DNA domain be classified as sequence 3 in sequence table；
' golden wasp ' the Mains Zumi（Malus×zumi‘Golden Hornet'）The region of DNA domain nucleotide sequence
For sequence in sequence table 4；
' Rudoiph ' Malus spectabilis（Malus‘Rudolph'）The nucleotides sequence in the region of DNA domain be classified as sequence 5 in sequence table；
' powder roof ' the Malus spectabilis（Malus‘Pink Spire'）The nucleotides sequence in the region of DNA domain be classified as sequence in sequence table
Row 6；
' flame ' Malus spectabilis（Malus‘Flame'）The nucleotides sequence in the region of DNA domain be classified as sequence 7 in sequence table；
' diamond ' Malus spectabilis（Malus‘Sparkler'）The nucleotides sequence in the region of DNA domain be classified as sequence 8 in sequence table；
' Sprengel professor ' the Mains Zumi（Malus×zumi‘Professor Sprenger'）The region of DNA domain
Nucleotides sequence is classified as sequence 9 in sequence table；
' how meagre profit the examines Berman ' Malus spectabilis（Malus‘Neville Copeman'）The nucleotides sequence in the region of DNA domain be classified as
Sequence 10 in sequence table；
' red long ' Malus spectabilis（Malus‘Red Long'）The nucleotides sequence in the region of DNA domain be classified as sequence 11 in sequence table；
' vertical silk ' the Malus spectabilis（Malushalliana）The nucleotides sequence in the region of DNA domain be classified as sequence 12 in sequence table.
7. the method that a kind of identification according to claim 6 or auxiliary identification wait for measuring plants, which is characterized in that described to be measured
Plant includes at least following one kind:
Clock Northey Malus spectabilis（Malustschonoskii）, ' golden wasp ' Mains Zumi（Malus×zumi‘Golden
Hornet'）, ' Rudoiph ' Malus spectabilis（Malus‘Rudolph'）, ' powder roof ' Malus spectabilis（Malus‘Pink Spire'）, ' flame '
Malus spectabilis（Malus‘Flame'）, ' diamond ' Malus spectabilis（Malus‘Sparkler'）, ' Sprengel professor ' Mains Zumi（Malus× zumi‘Professor Sprenger'）, ' how meagre profit examines Berman ' Malus spectabilis（Malus‘Neville Copeman'）, ' long red ' sea
Chinese bush cherry（Malus‘Red Long'）, ' vertical silk ' Malus spectabilis（Malushalliana）,
The clock Northey Malus spectabilis（Malustschonoskii）The nucleic acid molecule formula in the region of DNA domain be
A49G54G118G215T322T335C348G474G515C576A577T691；
' golden wasp ' the Mains Zumi（Malus×zumi‘Golden Hornet'）The region of DNA domain nucleic acid molecule
Formula is G49G54G118G215Y322T335C348G474G515C576A577T691；
' Rudoiph ' Malus spectabilis（Malus‘Rudolph'）The nucleic acid molecule formula in the region of DNA domain be
G49G54G118G215T322T335C348G474G515C576A577Y691；
' powder roof ' the Malus spectabilis（Malus‘Pink Spire'）The nucleic acid molecule formula in the region of DNA domain be
G49R54G118G215T322T335C348G474R515C576A577T691；
' flame ' Malus spectabilis（Malus‘Flame'）The nucleic acid molecule formula in the region of DNA domain be
G49G54S118G215T322W335C348G474G515Y576W577T691；
' diamond ' Malus spectabilis（Malus‘Sparkler'）The nucleic acid molecule formula in the region of DNA domain be
G49R54G118G215T322T335C348G474G515Y576W577T691；
' Sprengel professor ' the Mains Zumi（Malus×zumi‘Professor Sprenger'）The region of DNA domain
Nucleic acid molecule formula is G49G54G118G215T322T335C348R474G515C576A577T691；
' how meagre profit the examines Berman ' Malus spectabilis（Malus‘Neville Copeman'）The region of DNA domain nucleic acid molecule formula
For G49G54G118G215T322T335M348R474G515C576A577T691；
' red long ' Malus spectabilis（Malus‘Red Long'）The nucleic acid molecule formula in the region of DNA domain be
G49R54S118G215T322T335C348G474G515Y576A577T691；
Wherein, M indicates A and C；W indicates A and T；Y indicates T and C；R indicates A and G；S indicates G and C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711030429.5A CN107699615B (en) | 2017-10-27 | 2017-10-27 | A method of identifying Malus spectabilis kind using DNA sequence dna structure nucleic acid molecule formula |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711030429.5A CN107699615B (en) | 2017-10-27 | 2017-10-27 | A method of identifying Malus spectabilis kind using DNA sequence dna structure nucleic acid molecule formula |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107699615A CN107699615A (en) | 2018-02-16 |
| CN107699615B true CN107699615B (en) | 2018-11-06 |
Family
ID=61176699
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711030429.5A Active CN107699615B (en) | 2017-10-27 | 2017-10-27 | A method of identifying Malus spectabilis kind using DNA sequence dna structure nucleic acid molecule formula |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107699615B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1248395A (en) * | 1999-09-03 | 2000-03-29 | 中国科学院昆明植物研究所 | Selective cultivation method for hybridized Begonia semperflorens Link et Otto and B. tuberhybrida Voss |
| CN102719543A (en) * | 2012-06-25 | 2012-10-10 | 中国科学院植物研究所 | Method for identifying plant varieties by utilizing chemical molecular formulas of nucleotides |
| CN103509869A (en) * | 2013-09-29 | 2014-01-15 | 中国科学院植物研究所 | Method for identifying juglans plant by using UBE3 gene-based nucleotide formula |
| CN104195243A (en) * | 2014-07-02 | 2014-12-10 | 中国科学院植物研究所 | Method for identifying plant variety by constructing nucleotide molecular formula by virtue of UBE3 gene |
-
2017
- 2017-10-27 CN CN201711030429.5A patent/CN107699615B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1248395A (en) * | 1999-09-03 | 2000-03-29 | 中国科学院昆明植物研究所 | Selective cultivation method for hybridized Begonia semperflorens Link et Otto and B. tuberhybrida Voss |
| CN102719543A (en) * | 2012-06-25 | 2012-10-10 | 中国科学院植物研究所 | Method for identifying plant varieties by utilizing chemical molecular formulas of nucleotides |
| CN103509869A (en) * | 2013-09-29 | 2014-01-15 | 中国科学院植物研究所 | Method for identifying juglans plant by using UBE3 gene-based nucleotide formula |
| CN104195243A (en) * | 2014-07-02 | 2014-12-10 | 中国科学院植物研究所 | Method for identifying plant variety by constructing nucleotide molecular formula by virtue of UBE3 gene |
Non-Patent Citations (3)
| Title |
|---|
| Classification of Chinese medicinal tree peony cultivars based on chloroplast DNA sequences;He LX et al.;《AASRI Procedia》;20121231;第1卷;第344-352页 * |
| 果树全基因组测序研究进展;乔鑫 等;《园艺学报》;20140115;第41卷(第1期);第165-177页 * |
| 苹果属部分观赏品种与中国野生种的亲缘关系;张宁 等;《园艺学报》;20071025;第34卷(第05期);第1227-1234页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107699615A (en) | 2018-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20130136264A (en) | Specific primers for pines distinction, analysis kit using its primers, and pines distinciton method using thereof | |
| CN104195245A (en) | Anthurium SSR (Simple Sequence Repeat) primer pairs and kit based on transcriptome sequencing development | |
| Dong et al. | Sixteen novel microsatellite markers developed for Dendrocalamus sinicus (Poaceae), the strongest woody bamboo in the world | |
| HUANG et al. | Analysis of SSRs information in Capsicum spp. from EST database | |
| KR102226016B1 (en) | Marker for identification of chloroplast derived from Ilex integra and Primer set for identification of Ilex x wandoensis | |
| CN102719543B (en) | Method for identifying plant varieties by utilizing chemical molecular formulas of nucleotides | |
| CN107699615B (en) | A method of identifying Malus spectabilis kind using DNA sequence dna structure nucleic acid molecule formula | |
| CN109486983A (en) | Buta-buta, Yunnan agalloch eaglewood, Aguilaria malaccensis Lamk SNP marker and application | |
| CN110878376A (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
| KR102082987B1 (en) | Primer set for discriminating cultivars of onion and method for cultivars of onion using HRM analysis | |
| CN108384885B (en) | Cinnamomum camphora SSR primer combination and variety identification method thereof | |
| Tasnuva et al. | Study on differentation of wheat varieties through morphological and molecular approaches | |
| Alam et al. | Genetic diversity analysis of rice (Oryza sativa L.) landraces through RAPD markers | |
| CN107164499B (en) | A method of identification calamander | |
| Saeki et al. | Development and evaluation of microsatellite markers for Acer miyabei (Sapindaceae), a threatened maple species in East Asia | |
| KR102135173B1 (en) | Method for identification of Koelreuteria paniculata genotypes using microsatellite markers | |
| CN103757114B (en) | Method for building nucleotide formula to identify plant variety by using ribosome deoxyribonucleic acid (DNA) | |
| CN109280722B (en) | Chinese pumpkin transcriptome SSR molecular marker primer and application thereof | |
| KR101359542B1 (en) | Microsatellite primer sets for discriminating cultivars of peach and uses thereof | |
| Dai et al. | Application of random amplified polymorphic DNA and inter‐simple sequence repeat markers in the genus Crataegus | |
| CN117887874B (en) | G-SSR (G-simple sequence repeat) labeled primer combination and application thereof in construction of fingerprint spectrum of camphor tree | |
| KR102429948B1 (en) | Method for identification of Acer tegmentosum genotypes using microsatellite markers | |
| CN116574835B (en) | SSR primer combination for identifying tea branch citrus varieties and application thereof | |
| US20070243533A1 (en) | Products and methods of organism identification in nutritional supplements | |
| KR102313439B1 (en) | Molecular marker for distinguishing Gentina macrophylla, Aconitum pseudolaeve and Aconitum longecassidatum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |