CN107686845A - A kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method - Google Patents
A kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method Download PDFInfo
- Publication number
- CN107686845A CN107686845A CN201610639854.3A CN201610639854A CN107686845A CN 107686845 A CN107686845 A CN 107686845A CN 201610639854 A CN201610639854 A CN 201610639854A CN 107686845 A CN107686845 A CN 107686845A
- Authority
- CN
- China
- Prior art keywords
- sequence
- rice
- carrier
- sgrna
- bases
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of plant genetic, and in particular to a kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method.The present invention knocks out related gene using CRISPR/CAS9 technique to high-efficiency rice transformation and obtains a kind of carrier, and the carrier is named as pCXUN CAS9 sgRNA.Described carrier is included just like sequence table SEQ ID NO：Nucleotide sequence shown in 1.The present invention obtains Efficient Conversion carrier using sgRNA methods mutation rice target gene, it is a kind of unitary carrier, the recombinant vector of the present invention can be used for orthomutation rice target gene, and the function of related gene and effect, can be used for building corresponding gene mutation body and large fragment deletion in Study On Rice.The carrier of the present invention has very high transformation efficiency and target practice mutation efficiency, can stable heredity and application in rice.
Description
Technical field
The invention belongs to field of plant genetic, and in particular to a kind of rice high efficient conversion carrier pCXUN-
Cas9-sgRNA and its construction method.The present invention obtains Efficient Conversion carrier using sgRNA methods mutation rice target gene.This hair
Bright recombinant vector can be used for orthomutation rice target gene, and the function of related gene and effect, can also be used in Study On Rice
In the corresponding gene mutation body of structure and large fragment deletion.
Background technology
Mali and Cong etc. (2013) exists《Science》Magazine ran is based on CRISPR-Cas9 technologies in cell line
The new method of gene knockout is carried out, this method is different from conventional method, is to come from streptococcic Cas9 nucleases using one kind,
The constant tracrRNA of one sequence (trans-activating cr RNA) and one and target gene specific are complementary
20nt-crRNA (CRISPR RNAs) is formed.The higher structure that tracrRNA 3 ' ends are formed combines and activates Cas9,
TracrRNA 5 ' ends are connected with crRNA 3 ' end complementations, and the 5 ' of crRNA ends and target gene complementary pairing, are thus guided
Cas9 is reached and is cut off target sequence.Two kinds of tiny RNAs are fused into a RNA chain now, abbreviation sgRNA (single RNA), adopted
Operated with sgRNA easier.One section of specific crRNA sequence for being directed to target gene of design is only needed, can realize that gene is determined
Point knocks out.This method is employed in the genetic improvement of animals and plants rapidly.
At present, existing many reports apply the report in different biologies on CRISPR/CAS9 technologies, but in rice
In certain methods, the shortcomings that transformation efficiency is low, and different tissues genotype is inconsistent, and phenomenon of missing the target happens occasionally still be present,
Thus the effect of its application is restricted.
The content of the invention
The defects of it is an object of the invention to overcome prior art, obtaining one by orthomutation rice target gene can
The Efficient Conversion carrier of orthomutation rice target gene, the carrier be based on overexpression carrier pCXUN (chen et al.,
2009) build.The recombinant vector that the present invention is built not only zero background, and PCR primer efficiently can be connected to load
Among body, the medium DNA containing double XcmI sites that overexpression carrier pCXUN is introduced can produce T- by once digestion
Carrier, by target dna Cas9 (miao et al., 2013) PCR primer clone wherein with plasmid vector pCXUN- among forming
CAS9, after then described middle plasmid vector pCXUN-CAS9 is digested with KpnI, water is introduced with the quick connection method of a step
The sgRNA that rice U3 promoters or rice U6 promoter sequences start, obtain the conversion carrier that slewing knocks out target gene
pCXUN-Cas9-sgRNA.The recombinant vector of the present invention can be used for orthomutation rice target gene, related gene in Study On Rice
Function and effect, can be used for building corresponding gene mutation body and large fragment deletion, recombinant vector of the invention can be with
For excavating New function gene.
The present invention is achieved through the following technical solutions：
A kind of carrier pCXUN-Cas9-sgRNA of Efficient Conversion rice, the carrier are prepared through the following steps：
(1) with SEQ ID NO：The initial vector pCXUN of sequence shown in 1 is material, is cut off with Xcm1 in the carrier
The gene number of logging in：NC_007635.1 ccd genes；
(2) orientation insertion SEQ on the position (744-438bp) of carrier ccd genes has been cut off in the Xcm1 described in step (1)
ID NO：CAS9 genetic fragments shown in 4, obtain such as SEQ ID NO：Intermediate carrier pCXUN-CAS9 shown in 4；
(3) by intermediate carrier pCXUN-CAS9 resulting in step (2), linear DNA is digested to KpnI, is introduced
SgRNA, described sgRNA's is introduced as one of following manner:
1) sgRNA is transcribed by template of rice U3 promoter sequences, the sequence of its adapter-primer is as follows：
OsU3-F:CCCCTTTCGCCAGGGGTACCgtaattcatccaggtctccaag,
OsU3-R:TACGAATTCGAGCTCGGTACCgctgtgccgtacgacggtacg；
The base that capitalization represents in above-mentioned primer is the cohesive terminus,cohesive termini repetitive sequence that KpnI digested carrier, above-mentioned to draw
The base that thing lowercase represents as rice U3 promoters front end primer extension increasing sequence；
Or
2) sgRNA is transcribed by template of rice U6 promoter sequences, the sequence of its adapter-primer is as follows：
OsU6-F:CCCCTTTCGCCAGGGGTACCtatgtacagcattacgtagg,
OsU6-R:TACGAATTCGAGCTCGGTACCgatggtgcttactgtttag；
The base that capitalization represents in above-mentioned primer is the cohesive terminus,cohesive termini repetitive sequence that KpnI digested carrier, above-mentioned to draw
The base that thing lowercase represents as rice U6 promoters front end primer extension increasing sequence；
(4) target gene specific sequence crRNA is found, with NEB Cutter softwares in http://nc2.neb.com/
Objective gene sequence is inputted on NEBcutter2/ web station interfaces, 23nt target sequence, last three alkali of target sequence are found in screening
Base is NGG；Using rice U3 promoter sequences as template, preceding 20nt target sequences are started with base A, and primer sequence is as follows：
U3CRP-F:ANNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTA,
N in above-mentioned primer sequence represents 19 bases after the target sequence A bases of target gene；
U3CRP-R:GMMMMMMMMMMMMMMMMMMMTGCCACGGATCATCTGCACAAC；
N in above-mentioned primer sequence represents 19 bases after the target sequence G bases of target gene；Or
U6 is that template is then started with bases G, and primer sequence is as follows：
Using rice U6 promoter sequences as template, preceding 20nt target sequences are started with base A, and primer sequence is as follows：
U6CRP-F:GNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTA,
N in above-mentioned primer sequence represents 19 bases after the target sequence A bases of target gene；U6CRP-R:
CMMMMMMMMMMMMMMMMMMMCAACCTGAGCCTCAGCGCAGC；
N in above-mentioned primer sequence represents 19 bases after the target sequence C bases of target gene；
(5) the rice U3 promoter sequences for including sgRNA or rice U6 promoter sequences are incorporated into described in step 3)
Intermediate carrier among, obtain rice conversion carrier pCXUN-Cas9-sgRNA.
A kind of Efficient Conversion rice carrier pCXUN-Cas9-sgRNA preparation method, comprises the following steps：
(1) with SEQ ID NO：The initial vector pCXUN of sequence shown in 1 is material, is cut off with Xcm1 in the carrier
The gene number of logging in：NC_007635.1 ccd genes；
(2) orientation insertion SEQ on the position (744-438bp) of carrier ccd genes has been cut off in the Xcm1 described in step (1)
ID NO：CAS9 genetic fragments shown in 4, obtain such as SEQ ID NO：Intermediate carrier pCXUN-CAS9 shown in 4；
(3) by intermediate carrier pCXUN-CAS9 resulting in step (2), linear DNA is digested to KpnI, is introduced
SgRNA, described sgRNA's is introduced as one of following manner:
1) sgRNA is transcribed by template of rice U3 promoter sequences, the sequence of its adapter-primer is as follows：
OsU3-F:CCCCTTTCGCCAGGGGTACCgtaattcatccaggtctccaag,
OsU3-R:TACGAATTCGAGCTCGGTACCgctgtgccgtacgacggtacg；
The base that capitalization represents in above-mentioned primer is the cohesive terminus,cohesive termini repetitive sequence that KpnI digested carrier, above-mentioned to draw
The base that thing lowercase represents as rice U3 promoters front end primer extension increasing sequence；
Or
2) sgRNA is transcribed by template of rice U6 promoter sequences, the sequence of its adapter-primer is as follows：
OsU6-F:CCCCTTTCGCCAGGGGTACCtatgtacagcattacgtagg,
OsU6-R:TACGAATTCGAGCTCGGTACCgatggtgcttactgtttag；
The base that capitalization represents in above-mentioned primer is the cohesive terminus,cohesive termini repetitive sequence that KpnI digested carrier, above-mentioned to draw
The base that thing lowercase represents as rice U6 promoters front end primer extension increasing sequence；
(4) target gene specific sequence crRNA is found, with NEB Cutter softwares in http://nc2.neb.com/
Objective gene sequence is inputted on NEBcutter2/ web station interfaces, 23nt target sequence, last three alkali of target sequence are found in screening
Base is NGG；Using rice U3 promoter sequences as template, preceding 20nt target sequences are started with base A, and primer sequence is as follows：
U3CRP-F:ANNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTA,
N in above-mentioned primer sequence represents 19 bases after the target sequence A bases of target gene；
U3CRP-R:GMMMMMMMMMMMMMMMMMMMTGCCACGGATCATCTGCACAAC；
N in above-mentioned primer sequence represents 19 bases after the target sequence G bases of target gene；Or
U6 is that template is then started with bases G, and primer sequence is as follows：
Using rice U6 promoter sequences as template, preceding 20nt target sequences are started with base A, and primer sequence is as follows：
U6CRP-F:GNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTA,
N in above-mentioned primer sequence represents 19 bases after the target sequence A bases of target gene；U6CRP-R:
CMMMMMMMMMMMMMMMMMMMCAACCTGAGCCTCAGCGCAGC；
N in above-mentioned primer sequence represents 19 bases after the target sequence C bases of target gene；
(5) the rice U3 promoter sequences for including sgRNA or rice U6 promoter sequences are incorporated into described in step 3)
Intermediate carrier among, obtain rice conversion carrier pCXUN-Cas9-sgRNA.
A kind of rice high efficient conversion carrier pCXUN-Cas9-sgRNA of the present invention can be in the application in rice conversion.
A kind of Efficient Conversion rice carrier pCXUN-Cas9-sgRNA of this year invention preparation method can be in rice conversion
In application.
The positive effect of the present invention is：
1st, the present invention inserts Cas9 gene orders in starting vector pCXUN, Cas9 albumen effectively can be incorporated into water
Among each histoorgan of rice.
2nd, the carrier pCXUN-Cas9-sgRNA that the present invention is built, Cas9 genes and sgRNA are melted among a carrier,
It is more convenient, simple to convert host.
3rd, knockout target gene can be oriented with Efficient Conversion rice and expeditiously using the carrier that builds of the present invention.
More detailed technical scheme and its application referring to《Embodiment》.
Brief description of the drawings
Sequence table SEQ ID NO：1 is the initial vector pCXUN obtained nucleotide sequence.Sequence length is
12008bp.。
Sequence table SEQ ID NO：2 be Rice U3 promoter nucleotide sequences.Sequence length is 874bp.
Sequence table SEQ ID NO：3 be Rice U6 promoter nucleotide sequences.Sequence length is 878bp.
Sequence table SEQ ID NO：4 be Rice optimized CAS9 nucleotide sequence.Sequence length is 4123bp.
Sequence table SEQ ID NO：5 be middle interstitial granules pCXUN-Cas9 nucleotide sequence.Sequence length is 15450bp.
Fig. 1：It is initial vector pCXUN and intermediate carrier pCXUN-Cas9 structure figures of the present invention.
Fig. 2：Be the present invention rice high efficient conversion carrier pCXUN-Cas9-sgRNA building process figure and obtain
Conversion carrier pCXUN-Cas9-sgRNA plasmid figure.
Fig. 3:It is the PCR gel electrophoresis figures for expanding Rice optimized CAS9.Description of reference numerals：Swimming lane 1,2,3 is equal
For CAS9 amplified production.
Fig. 4:It is the gel electrophoresis glue figure of CAS9 positive detection.Description of reference numerals：Swimming lane 14,20 is negative findings；
Remaining swimming lane is positive test symbol.
Fig. 5:It is the phenotypic map of taa1-cr homozygous mutation body representativeness plant.Description of reference numerals：Fig. 5 left figure is
11 (or ZH11) are spent in rice varieties, Fig. 5 right side is the mutant taa1-cr materials that figure is the present invention.
Embodiment
The preparation of embodiment 1 initial vector, middle plasmid vector
1.Cas9 genetic fragments must obtain
With rice CAS9 genes, (State Key Laboratory of Crop Genetic Improvent Qu Li is good to be provided, nucleosides
Acid sequence is shown in SEQ ID NO：4) plasmid (miao et al., 2013) for, being cloned into pH-Ubi-cas9-7 is template, with
(5 '-ATGGCCCCAAAGAAGA AGCG-3 ' and Cas9-R (5 '-TCAATCGCCGCCGAGTTGTG-3 ') are primer to Cas9-F
Enter performing PCR amplification PCR amplifications, obtain about 4.1k b genetic fragment (see Fig. 2, and sequence table SEQ ID NO：4), will be obtained
The PCR primer obtained is cloned into pCXUN carriers, and (sequence is shown in SEQ ID NO：1) on (chen et al., 2009), by positive colony
(sequencing of Beijing Qing Ke bio tech ltd) is sequenced in counter sample, with the correctness of verifying purpose PCR primer.
PCR processes are as follows：
Cas9 purpose fragments are used for carrier through gel electrophoresis and after digging glue reclaim (recovery column for using QIAGEN companies)
PCXUN-CAS9 structure.
(2. sequence is shown in SEQ ID NO to the structure of the conversion carrier pCXUN-Cas9 with Cas9 purpose fragments：5)
By plasmid pCXUN XcmI enzyme digestions, carrier T is formed, reaction system is as follows：
37 DEG C of 3 hours of reaction, then dig glue, cross post, recovery.
The Cas9 fragments in step 1 are connected into the pCXUN carriers cut through in step 2 overnight through the 16 DEG C of reactions of T4 ligases again
Form intermediate carrier pCXUN-Cas9.
3.U3 and U6 promoters are all to expand to obtain among rice genome, are cloned on intermediate carrier pGEMT,
It is easy to follow-up test to carry out.
The conversion carrier pCXUN-Cas9-sgRNA of embodiment 2 structure
It is that target gene devises specific sgRNA with the OsTAA1 genes (LOC_Os01g07500) in rice,
The TIGR Serial No. LOC_Os01g07500 of OsTAA1 genes, target sequence areCCCGACCATGTTCGAGGAGTTCT (underscores
For PAM sequences).By intermediate carrier pCXUN-Cas9 resulting in embodiment 1, linear DNA is digested to KpnI, with overlapping
The method of PCR amplifications introduces sgRNA.Comprise the following steps that；
1) using the plasmid for carrying U3 promoters as template, adapter-primer (capitalization KpnI before and after U3 promoters is designed
Cohesive end repetitive sequence caused by digestion on carrier) it is as follows：
OsU3-F:CCCCTTTCGCCAGGGGTACCgtaattcatccaggtctccaag
OsU3-R:TACGAATTCGAGCTCGGTACCgctgtgccgtacgacggtacg
2) target gene specific sequence AGAACTCCTCGAACATGGTC is introduced into U3 promoters, it is soft with NEB Cutter
Part (http://nc2.neb.com/NEBcutter2/), find 23nt target sequences, behind 3nt be PAM sequences NGG；If (make
It is that then 20nt target sequences must be started template with base A with U3), the OsTAA1 target sequence sgRNA primers designed accordingly are as follows：
U3OsTAA1CR-F:AGAACTCCTCGAACATGGTCGTTTTAGAGCTAGAAATAGCAAGTTA
U3OsTAA1CR-R:GACCATGTTCGAGGAGTTCTGCCACGGATCATCTGCACAAC
Over-lap PCR program is as follows：
PCR 1 reacts, and reaction system is as follows：
We enter performing PCR 2 and reacted simultaneously, as follows：
3) using PCR 1 and the products of PCR 2 as template, enter performing PCR 3 and react, it is as follows：
Dig the products of glue reclaim PCR 3, and the carrier cut through with the products of one-step method connection mix mixing PCR 3 and KpnI
PCXUN-CAS9,50 DEG C are reacted one hour, take 1 μ l electricity to turn (1800V), and be coated on containing kanamycins (50 μ g/ml) resistance
On LB culture mediums.Picking monoclonal bacterium colony, extract plasmid and carry out positive detection, send sequencing company to be sequenced.
Embodiment 3 converts Agrobacterium using recombinant vector pCXUN-Cas9-sgRNA and rice host is converted
Positive plasmid pCXUN-Cas9-sgRNA (OsTAA1CR) electricity after sequencing is transformed into Agrobacterium (EHA105),
And infect Rice Callus.Conversion kind is that 11 (ZH11, from Chinese Academy of Agricultural Sciences's crop science research are spent in rice
Institute), specific step of converting is as follows：
1) mature embryo that 11 are spent in rice varieties is shelled, steeps 1min, 0.15% mercuric chloride sterilization 20min with 70% ethanol,
It is sterile to wash 3~4 times；The explant of gained is inoculated on inducing culture, in 26 DEG C of light culture evoked callus；
2) after Fiber differentiation 35d, take energetic, granular callus to be transferred to Oc subculture mediums and carry out subculture training
Support；
3) particle of squamous subculture 20d callus is taken, is accessed on Ol precultivation mediums, the light culture at 26 DEG C
4d；
4) at the 3rd day of preculture, with LA (LB+1.5% agar) streak inoculation agrobacterium strains, 28 DEG C of static gas wave refrigerators
2d；Afterwards, Agrobacterium is all scraped into suspension medium；In 28 DEG C, 200r/m shaken cultivations 0.5-1h；In spectrophotometer
600nm wavelength light measurement bacterial concentrations, are adjusted to 1.0OD values；
5) callus after preculture is accessed into 100ml conical flasks (about at 40ml), adds the agriculture bar modulated
Bacterium bacterium solution, 30min is soaked, during which shaken for several times.Prepare suspension medium:(500 μ lAS+5ml50% glucose)；
6) bacterium solution is gone, callus is placed in sterilizing filter paper and blots surface bacterium solution and (bacterium solution must be blotted, be allowed to
(what) turns white), but can not directly electricity consumption blowing drying), access co-culture culture medium (formula：250 μ lAS+5ml50% grapes
Sugar), light culture 3d, then be transferred on 250ml co-cultivation culture mediums and co-cultured；
7) callus after co-cultivation is shaken into cleaning twice with sterilized water is first quick；Then sterilized water immersion is added
10min, make the thalline separate out of interior of callus；Washing lotion is gone, adds the Cn sterilized waters immersion containing 400mg/L
15min；Dry-cleaning liquid, callus is placed in sterilizing filter paper and blotted, access screening and culturing medium；26 DEG C of light cultures.Every 3 weeks after
In generation, once common subculture was twice.A plasmid is often converted, need to sterilize single 1~2 bottle of water of steaming, wherein when screening for the first time, in 300ml
500ulCn and 300ul Hn are added in screening and culturing medium；During second of subculture screening, 400ulCn is added in screening and culturing medium
And 300ul.
8) resistant calli of screening and culturing medium culture is accessed into pre- differential medium, 26 DEG C of light cultures one week.9) will
The resistant calli that pre- differentiation is cultivated one week is transferred to differential medium (50ml/ bottles；Use triangular flask instead or flat based tubes are cultivated
Bottle)；25 DEG C, 2000Lux illumination cultivations, transfer-gen plant is obtained by regenerating.
10) 3~5cm of plantlet is treated；It is transferred to hestening rooting on root media.
11) the healthy and strong plant of root system is moved into basin alms bowl, 3~5d of mat shelter transition；Then move on under natural conditions and grow, until
It is ripe.
Any of the above culture medium prescription is shown in specification the end of writing.
Embodiment 4 detects the positive efficiency with orthomutation of genetically modified plants
1) rice leaf of maturation is taken, and DNA sample is extracted through CTAB methods；
2) the positive primer of design detection genetically modified plants：
CAS9CHECK-F:GCATGAAGAGGATCGAGGAG,
CAS9CHECK-R:GATCTCTTGCTCGGACTTGG；
PCR reaction systems：
Primer size is 750bp, and obtained glue figure is shown in Fig. 1, and positive statistical result is shown in Table 1.
The CAS9 positive test symbols of table 1
| Result (is translated into Chinese) | Positive (is translated into Chinese) | Negative (is translated into Chinese) |
| No. | 38/40 | 2/40 |
3) site design PCR amplifications are knocked out for target gene OsTAA1 and sequencing primer is as follows：
OsTAA1SEQ-F:GTGTTCGTCCCAATAAAGCA
OsTAA1SEQ-R:GTAGAGCGCGGCCATGAAG
Picking 20 plants enters performing PCR amplification, and reaction system is as follows：
PCR primer is taken to be sequenced, sequencing result statistics is as shown in table 2：
The ratio that 2 various genotype of table occur
| Genotype | Wild type | Homozygote | Heterozygote |
| No. | 2/20 | 3/20 | 15/20 |
Wherein, the representational phenotypic results of homozygote are as shown in Figure 4.
Experiment shows that the recombinant vector pCXUN-Cas9-sgRNA that the present invention is built has high turn in rice conversion
Change efficiency and mutation efficiency.Identified, whether using U3 or U6 promoters, the recombinant vector prepared using the present invention is mutated
Efficiency can reach 60%~90%.Annex：Various tissue culture culture medium prescriptions of the present invention
Inducing culture
Subculture medium
Pre-culture medium
Co-culture culture medium
Suspension medium
Screening and culturing medium
Differential medium
Root media
Leading reference
1.Prashant Mali,Luhan Yang,Kevin M.Esvelt,John Aach,Marc Guell,James
E.DiCarlo,Julie E.Norville,George M.Church,RNA-Guided Human Genome
Engineering via Cas9.Science,2013,339:823-826
2.Le Cong,F.Ann Ran,David Cox,Shuailiang Lin,Robert Barretto,Naomi
Habib,Patrick D.Hsu,Xuebing Wu,Wenyan Jiang,Luciano A.Marraffini,Feng Zhang,
Multiplex Genome Engineering 3.Using CRISPR/Cas Systems.Science,2013,339:819-
823
4.Jin Miao,Dongshu Guo,Jinzhe Zhang,Qingpei Huang,Genji Qin,Xin
Zhang,Jianmin Wan,Hongya Gu and Li-Jia Qu,Targeted mutagenesis in rice using
CRISPR-Cas system.Cell Research,2013,23:1233-1236
5.Songbiao Chen,Pattavipha Songkumarn,Jianli Liu,and Guo-Liang Wang,A
Versatile Zero Background T-Vector System for Gene Cloning and Functional
Genomics.Plant Physiology,2009,150:1111-1121。
Claims (4)
1. a kind of carrier pCXUN-Cas9-sgRNA of Efficient Conversion rice, it is characterised in that the carrier is made through the following steps
It is standby to obtain：
(1) with SEQ ID NO：The initial vector pCXUN of sequence shown in 1 is material, and logging in the carrier is cut off with Xcm1
Number be NC_007635.1 ccd genes；
(2) position of carrier ccd genes has been cut off in the Xcm1 described in step (1), i.e., insertion is oriented on 744-438 bases position
SEQ ID NO：CAS9 genetic fragments shown in 4, obtain such as SEQ ID NO：Intermediate carrier pCXUN-CAS9 shown in 4；
(3) by intermediate carrier pCXUN-CAS9 resulting in step (2), linear DNA is digested to KpnI, introduces sgRNA, institute
The sgRNA's stated is introduced as one of following manner:
1) sgRNA is transcribed by template of rice U3 promoter sequences, the sequence of its adapter-primer is as follows：
OsU3-F:CCCCTTTCGCCAGGGGTACCgtaattcatccaggtctccaag,
OsU3-R:TACGAATTCGAGCTCGGTACCgctgtgccgtacgacggtacg；
The base that capitalization represents in above-mentioned primer is the cohesive terminus,cohesive termini repetitive sequence that KpnI digested carrier, and above-mentioned primer is small
Front end primer extension increasing sequence of the female base represented of writing as rice U3 promoters；
Or
2) sgRNA is transcribed by template of rice U6 promoter sequences, the sequence of its adapter-primer is as follows：
OsU6-F:CCCCTTTCGCCAGGGGTACCtatgtacagcattacgtagg,
OsU6-R:TACGAATTCGAGCTCGGTACCgatggtgcttactgtttag；
The base that capitalization represents in above-mentioned primer is the cohesive terminus,cohesive termini repetitive sequence that KpnI digested carrier, and above-mentioned primer is small
Front end primer extension increasing sequence of the female base represented of writing as rice U6 promoters；
(4) target gene specific sequence crRNA is found, with NEB Cutter softwares in http://nc2.neb.com/
Objective gene sequence is inputted on NEBcutter2/ web station interfaces, 23nt target sequence, last three alkali of target sequence are found in screening
Base is NGG；Using rice U3 promoter sequences as template, preceding 20nt target sequences are started with base A, and primer sequence is as follows：
U3CRP-F:
ANNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTA,
N in above-mentioned primer sequence represents 19 bases after the target sequence A bases of target gene；
U3CRP-R:
GMMMMMMMMMMMMMMMMMMMTGCCACGGATCATCTGCACAAC；
N in above-mentioned primer sequence represents 19 bases after the target sequence G bases of target gene；Or
U6 is that template is then started with bases G, and primer sequence is as follows：
Using rice U6 promoter sequences as template, preceding 20nt target sequences are started with base A, and primer sequence is as follows：
U6CRP-F:
GNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTA,
N in above-mentioned primer sequence represents 19 bases after the target sequence A bases of target gene；U6CRP-R:
CMMMMMMMMMMMMMMMMMMMCAACCTGAGCCTCAGCGCAGC；
N in above-mentioned primer sequence represents 19 bases after the target sequence C bases of target gene；
(5) in the rice U3 promoter sequences for including sgRNA or rice U6 promoter sequences being incorporated into described in step 3)
Between among carrier, obtain rice conversion carrier pCXUN-Cas9-sgRNA.
2. a kind of Efficient Conversion rice carrier pCXUN-Cas9-sgRNA preparation method, it is characterised in that comprise the following steps：
(1) with SEQ ID NO：The initial vector pCXUN of sequence shown in 1 is material, and logging in the carrier is cut off with Xcm1
Number be NC_007635.1 ccd genes；
(2) position of carrier ccd genes has been cut off in the Xcm1 described in step (1), i.e., insertion is oriented on 744-438 bases position
SEQ ID NO：CAS9 genetic fragments shown in 4, obtain intermediate carrier pCXUN-CAS9；
(3) by intermediate carrier pCXUN-CAS9 resulting in step (2), linear DNA is digested to KpnI, introduces sgRNA, institute
The sgRNA's stated is introduced as one of following manner:
1) sgRNA is transcribed by template of rice U3 promoter sequences, the sequence of its adapter-primer is as follows：
OsU3-F:CCCCTTTCGCCAGGGGTACCgtaattcatccaggtctccaag,
OsU3-R:TACGAATTCGAGCTCGGTACCgctgtgccgtacgacggtacg；
The base that capitalization represents in above-mentioned primer is end sequence that KpnI digested carrier, above-mentioned primer lowercase generation
The base of table is the preceding terminal sequence of rice U3 promoters,
Or
2) sgRNA is transcribed by template of rice U6 promoter sequences, the sequence of its adapter-primer is as follows：
OsU6-F:CCCCTTTCGCCAGGGGTACCtatgtacagcattacgtagg,
OsU6-R:TACGAATTCGAGCTCGGTACCgatggtgcttactgtttag；
The base that capitalization represents in above-mentioned primer is end sequence that KpnI digested carrier, above-mentioned primer lowercase generation
The base of table is the preceding terminal sequence of rice U6 promoters；
(4) target gene specific sequence crRNA is found, with NEB Cutter softwares in http://nc2.neb.com/
Objective gene sequence is inputted on NEBcutter2/ web station interfaces, 23nt target sequence, last three alkali of target sequence are found in screening
Base is NGG；Using rice U3 promoter sequences as template, preceding 20nt target sequences are started with base A, and primer sequence is as follows：
U3CRP-F:
ANNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTA,
N in above-mentioned primer sequence represents 19 bases after the target sequence A bases of target gene；
U3CRP-R:
GMMMMMMMMMMMMMMMMMMMTGCCACGGATCATCTGCACAAC；
N in above-mentioned primer sequence represents 19 bases after the target sequence G bases of target gene；Or
U6 is that template must then be started with bases G, and primer sequence is as follows：
Using rice U6 promoter sequences as template, preceding 20nt target sequences are started with base A, and primer sequence is as follows：
U6CRP-F:
GNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTA,
N in above-mentioned primer sequence represents 19 bases after the target sequence A bases of target gene；
U6CRP-R:
CMMMMMMMMMMMMMMMMMMMCAACCTGAGCCTCAGCGCAGC；
N in above-mentioned primer sequence represents 19 bases after the target sequence C bases of target gene；
(5) in the rice U3 promoter sequences for including sgRNA or rice U6 promoter sequences being incorporated into described in step 3)
Between among carrier, obtain rice conversion carrier pCXUN-Cas9-sgRNA.
A kind of 3. applications of rice high efficient conversion carrier pCXUN-Cas9-sgRNA in rice conversion described in claim 1.
4. the preparation method of Efficient Conversion rice carrier pCXUN-Cas9-sgRNA described in claim 2 a kind of is in rice conversion
In application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610639854.3A CN107686845A (en) | 2016-08-07 | 2016-08-07 | A kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610639854.3A CN107686845A (en) | 2016-08-07 | 2016-08-07 | A kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107686845A true CN107686845A (en) | 2018-02-13 |
Family
ID=61152066
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610639854.3A Pending CN107686845A (en) | 2016-08-07 | 2016-08-07 | A kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107686845A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109097389A (en) * | 2018-09-07 | 2018-12-28 | 福建省农业科学院生物技术研究所 | A kind of method that gene editing technology target practice Ghd7 gene does sth. in advance Rice Heading |
| CN111019967A (en) * | 2019-11-27 | 2020-04-17 | 南京农业大学 | Application of GmU3-19g-1 and GmU6-16g-1 promoters in soybean polygene editing system |
| CN111837964A (en) * | 2019-04-24 | 2020-10-30 | 中国科学院分子植物科学卓越创新中心 | Novel gene TSG1 for regulating and controlling tillering number and grain type of rice and application thereof |
-
2016
- 2016-08-07 CN CN201610639854.3A patent/CN107686845A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109097389A (en) * | 2018-09-07 | 2018-12-28 | 福建省农业科学院生物技术研究所 | A kind of method that gene editing technology target practice Ghd7 gene does sth. in advance Rice Heading |
| CN111837964A (en) * | 2019-04-24 | 2020-10-30 | 中国科学院分子植物科学卓越创新中心 | Novel gene TSG1 for regulating and controlling tillering number and grain type of rice and application thereof |
| CN111837964B (en) * | 2019-04-24 | 2022-03-01 | 中国科学院分子植物科学卓越创新中心 | Novel gene TSG1 for regulating and controlling tillering number and grain type of rice and application thereof |
| CN111019967A (en) * | 2019-11-27 | 2020-04-17 | 南京农业大学 | Application of GmU3-19g-1 and GmU6-16g-1 promoters in soybean polygene editing system |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhong et al. | Improving plant genome editing with high-fidelity xCas9 and non-canonical PAM-targeting Cas9-NG | |
| Du et al. | Efficient targeted mutagenesis in soybean by TALENs and CRISPR/Cas9 | |
| CN104846010B (en) | A kind of method for deleting transgenic paddy rice riddled basins | |
| Eid et al. | Multiallelic, targeted mutagenesis of magnesium chelatase with CRISPR/Cas9 provides a rapidly scorable phenotype in highly polyploid sugarcane | |
| CN108441520A (en) | The gene conditionity knockout technique built using CRISPR/Cas9 systems | |
| CN105936907B (en) | A kind of breeding method for reducing rice grain cadmium content | |
| CN107365793A (en) | A kind of method of extensive genome editor suitable for plant | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN105154566B (en) | A kind of method for screening rice target gene editor plant | |
| CN106636182A (en) | Construction of CRISPR-Cas9 system of tomato PSY 1 gene and application thereof | |
| JP6994730B2 (en) | Genome editing method for filamentous fungus genome editing by direct introduction of protein | |
| CN109706148A (en) | A kind of gRNA, gRNA composition and electric shifting method for knocking out BCL11A gene or BCL11A genetic enhancer | |
| CN108165554A (en) | Control corn leaf width gene ZmNL4 and its application | |
| CN107686845A (en) | A kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method | |
| CN104745616B (en) | The arthrobacterium and its construction method of a kind of inosine dehydrogenase gene deficiency and application | |
| CN106868036B (en) | A kind of method and its application of rite-directed mutagenesis initiative corn compact plant germplasm | |
| CN108513583A (en) | Recombinate corn B chromosome sequence and application thereof | |
| CN104628839B (en) | A kind of paddy endosperm amyloplast development associated protein and its encoding gene and application | |
| CN108165578B (en) | Efficient preparation method for mutant aiming at multiple members of same gene family of cabbage mustard simultaneously | |
| CN110791487A (en) | Rice receptor kinase gene LOC _ Os11g47290, and coding protein and application thereof | |
| CN105671075B (en) | Application of rice OsCSA gene and site-specific knockout method thereof | |
| CN116536327A (en) | Wheat yellow mosaic disease gene TaEIF4E and application thereof | |
| CN108795976A (en) | A method of conversion wild rice cDNA library improves rice varieties | |
| CN112522299A (en) | Method for obtaining rice with increased tillering by using OsTNC1 gene mutation | |
| CN111235181B (en) | Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180213 |