CN107603934A - The engineered strain of one plant of heterogenous expression histon deacetylase (HDAC) inhibitor and its application - Google Patents
The engineered strain of one plant of heterogenous expression histon deacetylase (HDAC) inhibitor and its application Download PDFInfo
- Publication number
- CN107603934A CN107603934A CN201710813845.6A CN201710813845A CN107603934A CN 107603934 A CN107603934 A CN 107603934A CN 201710813845 A CN201710813845 A CN 201710813845A CN 107603934 A CN107603934 A CN 107603934A
- Authority
- CN
- China
- Prior art keywords
- tdp
- strain
- thailandepsin
- inhibitor
- hdac
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses one plant of heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A engineered strain; the Strain Designation is the tdp A of engineered strain 7029; it using Burkholderia sp.DSM7029 is starting strain to be, the biological synthesis gene cluster (tdp) for incorporating Thailandepsins on its genome by the method for swivel base obtains.The invention also discloses application of the engineered strain in histon deacetylase (HDAC) inhibitor Thailandepsin A are prepared.Experiment confirms：The tdp A of engineered strain 7029 of the present invention are compared with wild strain Burkholderia thailandensis E264; 1 times of Thailandepsin A output increased, this is that prepare with scale and exploitation histon deacetylase (HDAC) inhibitor class medicine are laid a good foundation.
Description
Technical field
The present invention relates to engineered strain and its structure and application, and in particular to heterogenous expression histon deacetylase (HDAC) suppresses
Agent Thailandepsin A engineered strain and its structure and application, belong to biosynthesis technology field.
Background technology
Histon deacetylase (HDAC) (histone deacetylases, HDACs) can be residual from the lysine of histone N-terminal
Acetyl group is removed on base, chromatin is maintained a more open transcriptional activity state, so as to regulate and control silent tumour
The expression of suppressor.Romidepsin is the hdac inhibitor of first embodiment antitumor activity, is initially from Japanese soil
Separated in bar-shaped Gram-negative bacteria Chromobacterium violaceum in sample.Romidepsin's is anti-
Cancer drug preparation (parenteral solution) trade name Istodax, developed by Gloucester Pharmaceuticals companies of the U.S.,
It is approved listing by U.S. FDA on November 9th, 2009.Romidepsin also known as FK228 or Depsipeptide, it is a kind of high
Effect and selective hdac inhibitor (HDACI).
Burkholderia E264 (Burkholderia thailandensis E264) is isolated from Thailand rice field
, it can synthesize the compound Thailandepsins with bicyclic depsipeptides structure, including Burkholdac A,
Thailandepsin A and Thailandepsin B etc..Wherein, yield of the Thailandepsin A in its wild strain is most
It is high.
Thailandepsin A are class I histone deacetylase inhibitor (HDACI), with medicine Romidepsin's
Structure is similar.National Cancer Institute NCI60 data show that Thailandepsin A have extensive suppression cancer cell
Proliferation activity, especially there is obvious effect to colon cancer, melanoma, oophoroma and kidney.Thailandepsin A are not only one
The cancer therapy drug of kind significant effect, while it can also be as the precursor of a variety of cancer-resisting substances.Therefore, Thailandepsin A
As a kind of natural products and effective hdac inhibitor in the exploitation of tumour medicine great prospect.
Although Thailandepsin A are expected to conduct in the near future as a kind of cancer therapy drug of great DEVELOPMENT PROSPECT
Commodity medicine is promoted, but the purified material for how obtaining heavy dose is one of current maximum limitation.On the one hand, by wild strain
The product amount that Burkholderia thailandensis E264 ferment to obtain is relatively limited, on the other hand, artificial fully synthetic side
It is extremely difficult without PRODUCTION TRAITS value that method prepares Thailandepsin A.In consideration of it, how efficiently to produce and purify
Thailandepsin A are problems urgently to be resolved hurrily at present.Through retrieval, the biosynthesis gene to Thailandepsins is utilized
Cluster (tdp) realizes that expression can express histone deacetylase to obtain in heterologous host bacterium Burkholderia sp.DSM7029
The document for changing enzyme inhibitor Thailandepsin A engineered strain has not been reported.
The content of the invention
Lost for the wild strain Burkholderia thailandensis E264 of production Thailandepsin A at present
Biography operating difficulties and the relatively limited deficiency of obtained Thailandepsin A product amounts of fermenting, the problem to be solved in the present invention
Be to provide it is a kind of can heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A engineered strain and its structure with
Using.
Heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A of the present invention engineered strain,
It is characterized in that：The Strain Designation is engineered strain 7029-tdp-A, and its genotype is：[Polyangium]brachysporum
strain DSM 7029,apramycin resistance,tdpA,tdpB,tdpC1,tdpDE1,tdpC2,tdpE2,tdpF,
TdpG, tdpH, tdpI and tdpJ, it using Burkholderia sp.DSM7029 is starting strain to be, passes through the side of swivel base
The biological synthesis gene cluster (tdp) that method incorporates Thailandepsins on its genome obtains.
The structure of heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A of the present invention engineered strain
Construction method, step are：
(1) Red/ET DNA recombinant techniques are utilized by Thailandepsins direct gram of biological synthesis gene cluster (tdp)
It is grand on p15A-cm-tetR-tetO-hyg-ccdB carriers, structure obtains plasmid p15A-cm-tetR-tetO-tdp；
(2) transposable element is inserted on the plasmid p15A-cm-tetR-tetO-tdp of step (1) structure, structure obtains table
Up to plasmid p15A-tnpA-apra-tetR-tetO-tdp；
(3) the expression plasmid p15A-tnpA-apra-tetR-tetO-tdp electricity that step (2) is built is gone to
In Burkholderia sp.DSM7029, expression plasmid expresses transposase in Burkholderia sp.DSM7029 will
Thailandepsins biological synthesis gene cluster (tdp) is incorporated on Burkholderia sp.DSM7029 genome, is obtained
To energy heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A engineered strain, engineered strain is named as
7029-tdp-A。
Heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A of the present invention engineered strain is being made
Application in standby histon deacetylase (HDAC) inhibitor Thailandepsin A.
Engineered strain 7029-tdp-A involved in the present invention has no report in the literature, is right first
Thailandepsins biological synthesis gene cluster (tdp) is realized in heterologous host bacterium Burkholderia sp.DSM7029
Expression.Experiment confirms：Engineered strain provided by the invention and wild strain Burkholderia thailandensis E264 phases
1 times than, Thailandepsin A output increased.It is expected to provide experiment and reason for large-scale production Thailandepsin A
By basis, there is important value in clinical practice exploitation.
Brief description of the drawings
Fig. 1：The Direct Cloning process of Thailandepsins biological synthesis gene clusters (tdp).
Fig. 2：Thailandepsins expression plasmids p15A-tnpA-apra-tetR-tetO-tdp structure.
Fig. 3：The digestion identification of Thailandepsins biological synthesis gene clusters (tdp) Direct Cloning recon.
Wherein：(A) Thailandepsins biological synthesis gene clusters (tdp) Direct Cloning recon p15A-cm-tetR-
TetO-tdp PstI restriction analysis.No.1 and no.2 digestions are correct in 20 recons.Marker is on the left of cleavage map
NEB 1kb.(B) with PstI to the further restriction analysis of no.1 and no.2.Caused banding pattern is respectively 8526 after PstI digestions,
6789,4977,4162,3690,2736,2650,2539,2156,2122,954bp.Marker is NEB 1kb on the left of cleavage map.
Fig. 4：The digestion identification of expression plasmid p15A-tnpA-apra-tetR-tetO-tdp recons.
Wherein：Caused banding pattern is respectively 10336,9833,6201,5734,5241,4824,1040bp after NcoI digestions.
For 23 recons in addition to no.12 is incorrect, remaining whole digestion is correct.Marker is NEB 1kb on the left of cleavage map.C is
Control plasmid p15A-cm-tetR-tetO-tdp.
Fig. 5：The engineered strain 7029-tdp-A of bacterium colony PCR detection structures.
Wherein：It is DL5000marker on the left of cleavage map.6 clones (No.1,2,3,4,5,6) of each pair primer detection, "-"
For negative control, i.e., using starting strain Burkholderia sp.DSM7029 as template, "+" is positive control, i.e., with plasmid
P15A-tnpA-apra-tetR-tetO-tdp is as template.Using a1-tdp/a2-tdp as primer, bacterium colony PCR fragment size is
720bp, using b1-tdp/b2-tdp as primer, bacterium colony PCR fragment size is 200bp, using c1-tdp/c2-tdp as primer, bacterium colony
PCR fragment size is 1231bp.
Fig. 6：Engineered strain 7029-tdp-A expression Thailandepsin A High Performance Liquid Chromatography/Mass Spectrometry detection.
Wild strain Burkholderia thailandensis E264, starting strain Burkholderia
The HPLC-MS of sp.DSM7029 and engineered strain 7029-tdp-A extractive from fermentative is analyzed, and mass spectrogram shows Thailandepsin
[M+H] of A extraction ion streams (EIC)+Peak (548.1917 ± 0.01+All of EIC MS).
Embodiment
The present invention is described in detail below in conjunction with accompanying drawing and instantiation, to more fully understand the present invention, but the content
It is not intended to limit the protection content of the present invention.
General explanation：Restructuring expression of enzymes bacterial strain GB05-dir, restructuring expression of enzymes bacterial strain involved by following examples
GB08-Red, recombinase expression plasmid pSC101-BAD-ETgA-tet, plasmid p15A-cm-tetR-tetO-hyg-ccdB and
PR6K-oriT-tnpA-apra is purchased from German GeneBridges companies；Starting strain Burkholderia sp.DSM7029
It is purchased from German DSMZ (preserving numbers：DSM7029)；Wild strain Burkholderia thailandensis E264 are purchased from Germany
DSMZ (preserving numbers：DSM13276).Burkholderia thailandensis E264 genome sequences are shown in what is delivered in NCBI
Genom sequence.Thailandepsins biological synthesis gene clusters (tdp) gene order is shown in the sequence delivered in NCBI.Plasmid
Gene sequencing is completed by Huada gene company in structure.Other do not refer to that plasmid is commercially available conventional plasmid, electricity be transferred to by
Method in body bacterium is conventional method.
Other reagents being related to and consumptive material are domestic.Experimental method and reagent in embodiment unless otherwise specified,
For this area conventional method and commercial reagent.
Embodiment 1：The structure of Thailandepsins biological synthesis gene clusters (tdp) expression plasmid
(1) Direct Cloning of Thailandepsins biological synthesis gene clusters (tdp)
The process of Thailandepsins biological synthesis gene clusters (tdp) Direct Cloning is shown in Fig. 1.
Concretely comprise the following steps：Restriction enzyme A vaI digested plasmids p15A-cm-tetR-tetO-hyg-ccdB obtains fragment
(large fragment is reclaimed in digestion to p15A-cm-tetR-tetO, and glue goes to bottom and cuts glue again, and glue reclaim specific practice is with reference to Tiangeng reagent
Box specification).Then using p15A-cm-tetR-tetO as pcr template, with primer p15A-cm-tet-5 and p15A-cm-
Tet-3 pcr amplified fragment p15A-cm-tetR-tetO, obtained PCR primer p15A-cm-tetR-tetO vector for
Tdp both ends carry the homology arm of the terminal sequence of Thailandepsins biological synthesis gene clusters (tdp) two.Then PCR is expanded and produced
Thing p15A-cm-tetR-tetO vector for tdp and Burkholderia thailandensis E264's passes through limitation
Property restriction endonuclease DraI digestions and purifying after genomic DNA common-battery convert to containing temperature sensitive type recombinase expression plasmid
In pSC101-BAD-ETgA-tet bacterial strain GB05-dir.
p15A-cm-tet-5:GACCGAATCGGTCAATTCGATGTAGCCGATCTTTACCCACGTCTTTagatccgaa
aaccccaagttacggat
p15A-cm-tet-3:TCCGACTTAACCTTGCTTTTCAGATGCGCATCGCTTCGGGGCTCGACCACagatc
Ctttctcctctttagatcttt) (capitalization is homology arm in primer, and lowercase is primer).
Electric step of converting is：By the bacterial strain GB05- containing temperature sensitive type recombinase expression plasmid pSC101-BAD-ETgA-tet
Dir added with 4 μ g/ml tetracyclines LB culture mediums (low salt, 1%Triptone, 0.5%yeast extract, 0.1%
NaCl 30 DEG C of overnight incubation (OD in)600=3~4).By 40 μ l overnight cultures (OD600=3~4) it is transferred to added with 4 μ g/ml
In the 1.3ml LB of tetracycline, upper 30 DEG C of Eppendorf thermomixer, 950rpm culture 2h (OD are placed in600=0.35~
0.4).Add 20 μ l 10%L- arabinoses into culture, be placed in upper 37 DEG C of Eppendorf thermomixer, 950rpm trainings
Support 40min.Cell, 9,400g 30sec are collected by centrifugation.Supernatant is abandoned, precipitation uses 1ml H2O suspends.Repeated centrifugation, resuspension, again from
The heart, supernatant is abandoned, with 20 μ l H2O suspension cells.Add 200ng pcr amplification product p15A-cm-tetR-tetO vector
For tdp's and 1 μ g Burkholderia thailandensis E264 passes through restriction enzyme DraI digestions and purifying
Genomic DNA afterwards, the mixed liquor of cell and DNA is transferred in 1mm electric shock cups, with Eppendorf electroporator
2510 are shocked by electricity, voltage 1350V, electric capacity 10 Μ f, the Ω of resistance 600.Add 1ml LB into electric shock cup, wash cell and by its
It is transferred to and pricks in the 1.5ml pipes in hole, is placed in upper 37 DEG C of Eppendorf thermomixer, 950rpm cultures 1h.Finally will be all
Bacterium solution is applied on the LB flat boards added with 30 μ g/ml chloramphenicol, and 37 DEG C are incubated overnight.
Under the mediation of recombinase, p15A-cm-tetR-tetO vector for tdp and Thailandepsins biologies
Line line homologous recombination occurs for synthetic gene cluster (tdp).Picking single bacterium colony, with restriction enzyme PstI digestions (restriction enzyme digestion and electrophoresis point
Fig. 3 is shown in analysis), screen correct recombinant plasmid p15A-cm-tetR-tetO-tdp.20 recombinant clones of picking carry out PstI digestions
It is correctly to clone that identification, which has 2,.By the correct recombinant plasmid of restriction endonuclease analysis respectively with primer p15A-tdp-1,
P15A-tdp-2, p15A-tdp-3 and p15A-tdp-4 are sequenced, to ensure that the sequence positioned at homologous arm region does not occur
Change.
The sequence of homologous arm region is carried out primer sequence used is sequenced as follows：
p15A-tdp-1：gattccgacctcattaagcagctc
p15A-tdp-2：cttcaatatccggctgcgcaac
p15A-tdp-3：cgaggaacaatgggaggatg
p15A-tdp-4：gagcgtagcgagtcagtgagcg.
It is specific with primer p15A-cm-tet-5 and p15A-cm-tet-3 pcr amplified fragment p15A-cm-tetR-tetO
Way is as follows：
PCR amplification system：
PCR programs：94 DEG C of pre-degeneration 2min；98 DEG C of denaturation 15s；58 DEG C (being set according to primer Tm) annealing 30s；72℃
Extension 4min (extension of time is according to the length determination expanded, 1kb/1min)；Circulation 30 times；Last 72 DEG C, 10min.Experiment
Used in the process of primer be p15A-cm-tet-5 and p15A-cm-tet-3.Template is p15A-cm-tetR-tetO-hyg-
CcdB linearizes product with restriction enzyme A vaI.
(2) Thailandepsins biological synthesis gene clusters (tdp) expression plasmid p15A-tnpA-apra-tetR-tetO-
Tdp structure
Expression plasmid p15A-tnpA-apra-tetR-tetO-tdp building process is shown in Fig. 2.
Concretely comprise the following steps：Restriction enzyme NheI digested plasmids pR6K-oriT-tnpA-apra obtains fragment oriT-
(large fragment is reclaimed in digestion to tnpA-apra, and glue goes to bottom and cuts glue again, and glue reclaim specific practice is with reference to Tiangeng kit explanation
Book).Fragment oriT-tnpA-apra both ends carry the homology arm at cm genes both ends in plasmid p15A-cm-tetR-tetO-tdp.
Then 200ng DNA fragmentation oriT-tnpA-apra and 200ng plasmid p15A-cm-tetR-tetO-tdp common-batteries are transformed into 20
Wire loop restructuring is carried out in the μ l 10%L- arabinose induced expressions bacterial strain GB08-red of Red α/βs/γ recombinases.Recombinating
In the presence of enzyme, the cm on plasmid p15A-cm-tetR-tetO-tdp is replaced by oriT-tnpA-apra, so as to obtain recombinating matter
Grain p15A-tnpA-apra-tetR-tetO-tdp.Cell after recovery is applied to added with apramycin (20 μ g/ml)
On LB flat boards, 37 DEG C of overnight incubations.Then picking single bacterium colony, with restriction enzyme NcoI digestions, (figure is shown in restriction enzyme digestion and electrophoresis analysis
4) correct recombinant plasmid p15A-tnpA-apra-tetR-tetO-tdp, is screened.
Expression plasmid p15A-tnpA-apra-tetR-tetO-tdp is on the basis of p15A-cm-tetR-tetO-tdp
Swivel base original paper, i.e. IR-tps cassette are added, IR is one section of inverted repeats, and tps is MycoMar swivel base expression of enzymes bases
Cause.After plasmid p15A-tnpA-apra-tetR-tetO-tdp is transferred in Burkholderia sp.DSM7029, turning
Gene cluster radom insertion can be made to the genome of host in the presence of seat enzyme, so that gene cluster can be stable in Host Strains
In the presence of.
Embodiment 2：The structure of heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A engineered strain
By plasmid p15A-tnpA-apra-tetR-tetO-tdp electricity conversions into Burkholderia sp.DSM7029,
Electric step of converting is：By Burkholderia sp.DSM7029 in CYMG (Casitone 8g/L, MgCl24g/L, Yeast
Extract 4g/L, 50%glycerol 10ml/L) 30 DEG C of culture 12h in culture medium.40 μ l cultures are transferred to CYMG trainings
Support (OD in base600≈ 0.1), it is placed in upper 30 DEG C of Eppendorf thermomixer, 950rpm culture 14h (OD600≈1.8).From
The heart collects cell, 9,400g 30sec.Supernatant is abandoned, precipitation uses 1ml H2O suspends.Repeated centrifugation, resuspension, centrifuge again, with 20 μ l
H2O suspension cells.1 μ g plasmid p15A-tnpA-apra-tetR-tetO-tdp are added, cell and DNA mixed liquor are transferred to
In 1mm electric shock cups, shocked by electricity with Eppendorf electroporator 2510, voltage 1250V, the Μ f of electric capacity 10, resistance
600Ω.Add 1ml CYMG culture mediums into electric shock cup, wash cell and transfer them to and prick in the 1.5ml pipes in hole, be placed in
Upper 30 DEG C of Eppendorf thermomixer, 950rpm cultivate 3h.Coated plate is in the CYMG added with apramycin (20 μ g/ml)
On flat board, 30 degree of cultures 2-3 days are to growing monoclonal.
Then it is carried out with 3 pairs of primers (a1-tdp/a2-tdp, b1-tdp/b2-tdp and c1-tdp/c2-tdp) respectively
Bacterium colony PCR identifies that qualification result is shown in Fig. 5.
The sequence of above-mentioned bacterium colony PCR primer is：
a1-tdp：cgcatctgaaaagcaaggtt
a2-tdp：ggatgcgcgttcgcacagac
b1-tdp：cttaccgggcggaaccgcatc
b2-tdp：tcacttcggcgcatcacatga
c1-tdp：tagtgaaaaaccttgttggca
c2-tdp：ggatgcgcgttcgcacagac.
Bacterium colony PCR specific practices are as follows：
PCR amplification system：
PCR programs：
94 DEG C of pre-degeneration 1min；98 DEG C of denaturation 10s；56-60 DEG C (being set according to primer Tm) annealing 15s；68 DEG C of extensions
(extension of time is according to the length determination expanded, 1kb/1min)；Circulation 30 times；Last 72 DEG C, 10min.Institute in experimentation
Primer is a1-tdp/a2-tdp, b1-tdp/b2-tdp and c1-tdp/c2-tdp respectively.Template is the bacterium solution shaken,
Bacterium solution can be clearly visible muddiness, then take out 100 μ l, twice of the sterile washings of 1000ml, clean culture medium.Then boiling water boiling is used
15min.Cooling can work as template and use.
As a result confirm：The expression plasmid p15A-tnpA-apra-tetR-tetO-tdp electricity of structure is gone to
Burkholderia sp.
In DSM7029, expression plasmid expresses transposase in Burkholderia sp.DSM7029 will
Thailandepsins biological synthesis gene cluster (tdp) is incorporated on Burkholderia sp.DSM7029 genome, is obtained
To energy heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A engineered strain, engineered strain is named as
7029-tdp-A。
Embodiment 3：Engineered strain 7029-tdp-A of the present invention is preparing histon deacetylase (HDAC) inhibitor
Application in Thailandepsin A
Engineered strain 7029-tdp-A is inoculated in the CYMG culture mediums for having added apramycin (20 μ g/ml), 30 DEG C
Cultivate 24h.1% inoculum concentration by volume, by overnight culture be inoculated into containing the fresh CYMG culture mediums of 50ml (A Bo draw it is mould
20 μ g/ml of element) in.30 DEG C, 200rpm, after cultivating 2 days, the XAD-16 macroporous absorbent resins of final concentration 2% are added, continue to train
Support 2 days.8000rpm centrifugations 10min collects cell and macroporous absorbent resin, is then extracted with methanol.By rotary evaporation by first
Alcohol is removed, and remaining extract is dissolved in 1ml methanol.3 μ l are taken to be analyzed for HPLC-MS after 0.22 μm of membrane filtration.It is high
Effect liquid phase chromatogram instrument model UltiMateTM3000 RSLC.Chromatographic condition is：AcclaimTM RSLC 120C18,5 μm, 4.6
×250mm；Solvent orange 2 A is ultra-pure water (0.1% trifluoroacetic acid) and B acetonitriles (0.1% trifluoroacetic acid)；Solvent Gradient is 0-5min,
5%B, 5-45min, 5%-95%B, 45-60min, 95%B；Column flow rate is 0.75ml/min.The model of high-resolution mass spectrometer
Bruker microOTOF-Q II, ESI-Q-TOF MS (electron spray level Four bar time of-flight mass spectrometer).Mass Spectrometry Conditions：Auto
MS2, Mass range (50-1500), precursor ion 2.
As a result show, Thailandepsins biological synthesis gene clusters (tdp) are in Burkholderia sp.DSM7029
The primary product of expression is Thailandepsin A, as a result sees Fig. 6.
Embodiment 4：Engineered strain 7029-tdp-A and wild strain the Burkholderia thailandensis of structure
The comparison of E264 production Thailandepsin A amount
The engineered strain 7029-tdp-A that the present invention is built and wild strain Burkholderia thailandensis
E264 production Thailandepsin A amount relatively mainly uses peak area comparison method, specific as follows：First, it is right
[M+H] of Thailandepsin A extraction ion streams (EIC)+(548.1917 ± 0.01+All of EIC MS) is integrated at peak,
Obtain peak area；Then ratio is carried out to peak area, ratio is close to 2:1.It is demonstrated experimentally that the expression histone that the present invention is built is gone
Acetylase inhibitor Thailandepsin A engineered strain 7029-tdp-A and wild strain Burkholderia
Thailandensis E264 are compared, Thailandepsin A output increased 1 times.
Claims (3)
1. one plant of heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A engineered strain, it is characterised in that：
The Strain Designation is engineered strain 7029-tdp-A, and its genotype is：[Polyangium]brachysporum strain DSM
7029,apramycin resistance,tdpA,tdpB,tdpC1,tdpDE1,tdpC2,tdpE2,tdpF,tdpG,tdpH,
TdpI and tdpJ, it using Burkholderia sp.DSM7029 is starting strain to be, by the method for swivel base in its gene
The biological synthesis gene cluster (tdp) that Thailandepsins is incorporated in group obtains.
2. heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A engineered strain described in claim 1
Construction method, step are：
(1) using Red/ET DNA recombinant techniques by Thailandepsins biological synthesis gene cluster (tdp) Direct Cloning extremely
On p15A-cm-tetR-tetO-hyg-ccdB carriers, structure obtains plasmid p15A-cm-tetR-tetO-tdp；
(2) transposable element is inserted on the plasmid p15A-cm-tetR-tetO-tdp of step (1) structure, structure obtains expressing matter
Grain p15A-tnpA-apra-tetR-tetO-tdp；
(3) the expression plasmid p15A-tnpA-apra-tetR-tetO-tdp electricity that step (2) is built is gone into Burkholderia
In sp.DSM7029, expression plasmid expresses transposase by Thailandepsins's in Burkholderia sp.DSM7029
Biological synthesis gene cluster (tdp) is incorporated on Burkholderia sp.DSM7029 genome, and obtaining can heterogenous expression group egg
White deacetylase inhibitor Thailandepsin A engineered strain, is named as engineered strain 7029-tdp-A.
3. heterogenous expression histon deacetylase (HDAC) inhibitor Thailandepsin A as claimed in claim 1 engineered strain
Application in histon deacetylase (HDAC) inhibitor Thailandepsin A are prepared..
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710813845.6A CN107603934B (en) | 2017-09-11 | 2017-09-11 | Engineering strain for heterologous expression of histone deacetylase inhibitor and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710813845.6A CN107603934B (en) | 2017-09-11 | 2017-09-11 | Engineering strain for heterologous expression of histone deacetylase inhibitor and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107603934A true CN107603934A (en) | 2018-01-19 |
| CN107603934B CN107603934B (en) | 2020-08-28 |
Family
ID=61063488
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710813845.6A Active CN107603934B (en) | 2017-09-11 | 2017-09-11 | Engineering strain for heterologous expression of histone deacetylase inhibitor and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107603934B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108728477A (en) * | 2017-04-24 | 2018-11-02 | 华东理工大学 | A kind of efficient Transpositional mutation system and construction method |
| CN115947774A (en) * | 2022-09-15 | 2023-04-11 | 山东大学 | Compound spiroruchostatin E and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008098199A2 (en) * | 2007-02-08 | 2008-08-14 | Uwm Research Foundation, Inc. | Sequences for fk228 biosyntnesis and methods of synthesizing fk228 and fk228 analogs |
-
2017
- 2017-09-11 CN CN201710813845.6A patent/CN107603934B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008098199A2 (en) * | 2007-02-08 | 2008-08-14 | Uwm Research Foundation, Inc. | Sequences for fk228 biosyntnesis and methods of synthesizing fk228 and fk228 analogs |
Non-Patent Citations (5)
| Title |
|---|
| WANG C ET AL: "Thailandepsins: bacterial products with potent histone deacetylase inhibitory activities and broad-spectrum antiproliferative activities", 《JOURNAL OF NATURAL PRODUCTS》 * |
| XIAOYING BIAN ET AL: "Heterologous production and yield improvement of epothilones in Burkholderiales strain DSM 7029", 《ACS CHEMICAL BIOLOGY》 * |
| 刘冰: "Burkolderia thailandensis E264生产抗癌药物Thailandepsin A的研究", 《中国优秀硕士学位论文全文数据库》 * |
| 惠俊渊 等: "Burkholderia thailandensis E264/pBMTL3-tdpR发酵生产抗癌药物Thailandepsin A的研究", 《高校化学工程学报》 * |
| 郑文韬 等: "Red/ET同源重组技术及其在微生物基因组挖掘中的应用进展", 《微生物学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108728477A (en) * | 2017-04-24 | 2018-11-02 | 华东理工大学 | A kind of efficient Transpositional mutation system and construction method |
| CN115947774A (en) * | 2022-09-15 | 2023-04-11 | 山东大学 | Compound spiroruchostatin E and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107603934B (en) | 2020-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106190937B9 (en) | Method for biosynthesizing 2' -fucosyllactose by constructing recombinant escherichia coli | |
| JP2021517828A (en) | Yeast producing tyrosol and hydroxytyrosol and its production method | |
| CN110157654B (en) | Bacillus natto recombinant strain and construction method and application thereof | |
| CN101565710B (en) | 3-sterone-Delta[1]-dehydrogenase gene, relevant carriers, engineering strains and applications thereof | |
| WO2019120132A1 (en) | Engineered strain for efficient heterologous expression of disorazole z, gene cluster for constructing the strain and applications thereof | |
| CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| CN107603934A (en) | The engineered strain of one plant of heterogenous expression histon deacetylase (HDAC) inhibitor and its application | |
| CN108138126B (en) | Mycobacterium genetic engineering bacteria and application thereof in preparation of steroid compound | |
| CN105602880B (en) | The method of one plant of Corynebacterium glutamicum and its excessive synthetic phospholipid acyl serine | |
| CN108913645B (en) | Knock out application of the B. licheniformis strain of malR in bacitracin production | |
| WO2024099089A1 (en) | Genetically engineered strain for producing pseudouridine, construction method therefor and use thereof | |
| CN107760693A (en) | Application of the Chlamydomonas reinhardtii LRR genes in Chlamydomonas reinhardtii cadmium tolerance is regulated and controled | |
| CN110964649A (en) | Engineering strain for accumulating emodin-8-methyl ether and construction method and application thereof | |
| CN113481233B (en) | Method for constructing ectoin producing strain | |
| CN116121163A (en) | Method for changing biosynthesis of thaxtomin A through transcription factor gene bldD in streptomyces scab | |
| CN113832090B (en) | Recombinant bacillus natto for high-yield vitamin K2, preparation method and application | |
| CN102793915B (en) | Production method of acellular pertussis vaccine | |
| CN112795587B (en) | Escherichia coli engineering bacteria producing surfactant, construction method and application thereof | |
| CN109097374A (en) | A kind of preparation method, bacterial strain and its application of pseudomonas aeruginosa engineered strain | |
| CN113717998A (en) | Application of recombinant bacillus subtilis and method for producing tetrahydropyrimidine by using wastewater generated in synthesis of carnosine by enzyme method | |
| CN114525215A (en) | Recombinant strain for producing terpenoid, construction method thereof, method for producing terpenoid through fermentation and application of recombinant strain | |
| CN109628361B (en) | Integrated double-copy functional F4 pilus operon gene pig-derived probiotic EP1 clone strain, construction method and application | |
| CN105112351A (en) | Construction method and application of engineered strain for producing phenol through glycerol fermentation | |
| ES2543167T3 (en) | Microorganisms with increased sucrose mutase activity | |
| CN110540943A (en) | Gene engineering strain for producing emodin and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |