CN113832090B

CN113832090B - Recombinant bacillus natto for high-yield vitamin K2, preparation method and application

Info

Publication number: CN113832090B
Application number: CN202111157402.9A
Authority: CN
Inventors: 詹光煌; 卢英华; 钟锦潮; 陈必钦; 段然; 陈婷婷; 严必能; 李丹
Original assignee: INNER MONGOLIA KINGDOMWAY PHARMACEUTICAL CO Ltd; Xiamen Kingdomway Group Co
Current assignee: INNER MONGOLIA KINGDOMWAY PHARMACEUTICAL CO Ltd; Xiamen Kingdomway Group Co
Priority date: 2021-09-30
Filing date: 2021-09-30
Publication date: 2023-05-23
Anticipated expiration: 2041-09-30
Also published as: CN113832090A

Abstract

The invention discloses recombinant bacillus natto for high-yield vitamin K2. The strain comprises bacillus natto as a carrier skeleton and a nucleotide sequence for encoding the following genes: tryptophan positive feedback activates the signal peptide PtrpSP, the toxic polypeptide txpA and the cell wall endopeptidase cwlO, the shikimate kinase AroK, the chorismate synthase AroF and the 1, 4-dihydroxy-2-naphthoate-polyisoprene transferase MenA. The recombinant bacillus natto uses bacillus natto as a receptor strain, and the yield of MK-7 in the recombinant bacteria is improved by regulating and controlling a plurality of key enzymes in an MK-7 synthesis path, so that the yield of MK-7 is increased by 125% compared with that of a wild strain MK-7 in 96h fermentation, and the fermentation production of vitamin K2 has a huge industrial application prospect.

Description

Recombinant bacillus natto for high-yield vitamin K2, preparation method and application

Technical Field

The invention relates to a genetic engineering technology, in particular to recombinant bacillus natto for high-yield vitamin K2, a preparation method and application thereof.

Background

Vitamin K2, also known as menaquinone, is an indispensable fat-soluble vitamin that exists in many different isomers, expressed as MK-n, depending on the number of isoprene units at the C3 position on its molecular structure, with MK-7 having the highest bioactivity and the highest half-life. Vitamin K2 can promote synthesis of prothrombin by the liver, regulate synthesis of various blood coagulation factors, is also an essential cofactor for carboxylation of osteocalcin, plays an important role in bone development, helps to transfer calcium ions into bones, plays a key role in blood coagulation and osteoporosis prevention, and is considered as a fourth-generation anti-osteoporosis therapeutic drug. In addition, vitamin K2 is also involved in many important metabolic reactions in the organism as an electron transport carrier in respiratory metabolism. In recent years, the research shows that the vitamin K2 has a plurality of different functions in clinical application, for example, can be used for preventing and treating cardiovascular and cerebrovascular diseases, parkinson's disease and type II diabetes, promoting recovery of liver functions and the like, and has wide application prospects in the fields of medicines, foods and the like.

The human body can not synthesize vitamin K2 and can only supplement from food or nutritional health care products. However, the content of vitamin K2 in normal foods is very small, e.g., only about 1mg of vitamin K2 in 6kg pork or 7kg eggs, and thus supplementation from other sources is required. At present, three main sources of vitamin K2 production are: (1) extracted from plants or animals; (2) chemical synthesis; (3) microbial fermentation. The natural extraction method has low yield, the chemical synthesis method has complex steps and low yield, and the chemical synthesis is easy to produce different cis-isomers with low activity and a large amount of byproducts, causes environmental pollution and is difficult to form large-scale production. The microbial fermentation method has the characteristics of small pollution, low cost, high product activity, easy scale-up of production scale and the like, and the mode of producing vitamin K2 by utilizing microbial resources has become a future development trend.

In recent years, the preparation and industrialization of vitamin K2 has been the focus of research, wherein the related products using MK-7 are most widely used, and among strains capable of producing MK-7, strains of Bacillus are the main potential strains for producing vitamin K2 by microorganisms due to their safety and higher content of MK-7, and among these, bacillus natto is considered to have the potential for large-scale production of vitamin K2 (MK-7). However, because the metabolic pathway for MK-7 synthesis is very complex, in which multiple pathways such as glycolytic pathway, pentose phosphate pathway, mevalonate pathway and menaquinone pathway are involved, the anabolic flux of vitamin K2 is low and menaquinone content in wild strains is generally kept at an extremely low level.

The prior strain is genetically engineered to be an important means for improving the fermentation level of vitamin K2, and Ma et al over-express MK-7 speed-limiting enzymes in different combinations by genetic engineering to increase the MK-7 content in the recombinant strain from 4.5mg/L to 50mg/L (Ma X.C., et al, bioprocess biosystem Eng.2019May;42 (5): 817-827.). Yang et al (Yang S.M., et al ACS Synth biol.2019Jan18;8 (1): 70-81) split the MK-7 biosynthetic pathway into multiple modules and attempted to enhance the different modules, and finally the engineered strain obtained by integrating the multiple modules produced 69.5mg/L MK-7 with a more than 20-fold increase compared to the starting strain.

Disclosure of Invention

The invention aims to provide recombinant bacillus natto for high-yield vitamin K2. The signal peptide response mechanism is utilized to inhibit tryptophan metabolic bypass and promote the metabolic synthesis of vitamin K2, so that the purpose of high-yield vitamin K2 is achieved.

In order to achieve the above purpose, the invention provides a recombinant bacillus natto for high-yield vitamin K2, which is characterized in that the strain comprises bacillus natto as a carrier skeleton and a nucleotide sequence for encoding the following genes: tryptophan positive feedback activates the signal peptide PtrpSP, the toxic polypeptide txpA and the cell wall endopeptidase cwlO, the shikimate kinase AroK, the chorismate synthase AroF and the 1, 4-dihydroxy-2-naphthoate-polyisoprene transferase MenA.

Further, the nucleotide sequence of the tryptophan positive feedback activation signal peptide PtrpSP is shown as SEQ ID NO. 1, the nucleotide sequence of the toxic polypeptide txpA is shown as SEQ ID NO. 6, the nucleotide sequence of the cell wall endopeptidase cwlO is shown as SEQ ID NO. 7, the nucleotide sequence of the shikimate kinase AroK is shown as SEQ ID NO. 15, the nucleotide sequence of the branching acid synthase AroF is shown as SEQ ID NO. 14, and the nucleotide sequence of the 1, 4-dihydroxy-2 naphthoate-polyisoprene transferase MenA is shown as SEQ ID NO. 16.

The invention also provides a preparation method of the recombinant bacillus natto, which is characterized in that,

construction of the screening Circuit pAX 01-PtrpSP-txpA-cwlO: artificially synthesizing PtrpSP, and connecting the PtrpSP with an empty vector pAX01 by double enzyme digestion of restriction enzymes SphI and BamHI to obtain pAX01-PtrpSP; double-enzyme digestion is carried out on the TxpA fragment and the pAX01-PtrpSP vector by utilizing restriction enzymes AvrII and BamHI, and then the pAX01-PtrpSP-txpA vector is obtained; the restriction enzymes EcoNI and BamHI are utilized to carry out double digestion and then are connected to the CwlO fragment and pAX01-PtrpSP-txpA vector, thus obtaining a screening loop with the construction completed

pAX01-PtrpSP-txpA-cwlO; preferably, the TxpA fragment and the CwlO fragment are obtained by artificial synthesis or PCR amplification; more preferably, the TxpA fragment is obtained by PCR amplification, wherein an amplification template with TxpA at 2678240 th to 2678419 th positions of GenBank NC_000964.3 is artificially synthesized, and a PCR product obtained by PCR amplification is the TxpA fragment; the CwlO fragment is obtained by PCR amplification, wherein 3574363 th to 3575784 th positions of GenBank: NC_000964.3 are amplification templates of CwlO, and a PCR product obtained by PCR amplification is the CwlO fragment;

construction of the overexpression plasmid pHT 01-aroK-aroF-meno: obtaining gene fragments of chorismate synthase AroF, shikimate kinase AroK and 1, 4-dihydroxy-2 naphthalene formate-polyisoprene transferase MenA; double digestion is carried out on the AroK fragment and the plasmid pHT01 by utilizing BamHI and XbaI, and then the pHT01-aroK plasmid is obtained; carrying out linearization PCR on the pHT01-aroK plasmid, and carrying out POE-PCR connection on the obtained linearization plasmid fragment and aroF fragment to obtain plasmid pHT01-aroK-aroF; double-enzyme digestion is carried out on the MenA fragment and the plasmid pHT01-aroK-aroF by adopting restriction enzymes XbaI and SmaI, and then the connection is carried out, thus obtaining an over-expression plasmid pHT 01-aroK-aroF-menoA; preferably, the AroK fragment, aroF and MenA fragment are synthesized artificially or obtained by PCR amplification; more preferably, the AroK fragment is obtained by PCR amplification, wherein 333805 to 334365 of an artificially synthesized GenBank: AP011541.2 are amplification templates for amplifying AroK, and a PCR product obtained by PCR amplification is the AroK fragment; the AroF fragment is obtained by PCR amplification, wherein 2167761 to 2168951 of an artificially synthesized GenBank: AP011541.2 are amplification templates for amplifying AroF, and a PCR product obtained by PCR amplification is the AroF fragment; the MenA fragment is obtained by PCR amplification, wherein 3823548 th to 3824432 th positions of an artificially synthesized GenBank: AP011541.2 are amplification templates for amplifying the MenA, and a PCR product obtained by PCR amplification is the MenA fragment;

obtaining recombinant bacillus natto: transferring the pAX01-PtrpSP-txpA-cwlO and the over-expression plasmid pHT 01-aroK-aroF-meno into bacillus natto, screening the strain with the most sensitive tryptophan response, inoculating the strain into a fresh fermentation medium for culture, and selecting the strain with the highest yield of vitamin K2 to obtain the recombinant bacillus natto.

Further, the primer used for amplifying the toxic polypeptide TxpA is TxpA-F\TxpA-R, and the sequence of the primer is shown as SEQ ID NO. 2 and SEQ ID NO. 3;

the primer used for amplifying the cell wall endopeptidase CwlO is CwlO-F\CwlO-R, and the sequence of the primer is shown as SEQ ID NO. 4 and SEQ ID NO. 5;

the primer used for amplifying the chorismate synthase AroF is AroF-IF\AroF-IR, and the sequence of the primer is shown as SEQ ID NO. 8 and SEQ ID NO. 9;

the primer used for amplifying shikimate kinase AroK is AroK-F\AroK-R, and the sequence of the primer is shown as SEQ ID NO. 10 and SEQ ID NO. 11;

the primer used for amplifying the 1, 4-dihydroxy-2 naphthoate-polyisoprene transferase MenA is MenA-F\MenA-R, and the sequences of the primer are shown as SEQ ID NO. 12 and SEQ ID NO. 13;

the primer of the PCR linearized pHT01-aroK plasmid is pHT01-VF/pHT01-VR, and the sequence is shown as SEQ ID NO. 17 and SEQ ID NO. 18.

The invention also protects the application of the recombinant bacillus natto for producing vitamin K2.

The invention also provides a method for producing vitamin K2, which is characterized in that the recombinant bacillus natto is subjected to LB solid plate culture containing chloramphenicol and ampicillin resistance, single colony is selected for inoculation, and then shake culture is carried out to obtain seed liquid; inoculating seed liquid (preferably 1-5% of inoculation amount) into a fermentation medium, and fermenting and culturing at 30-40 ℃ for 60-140 h.

Further, the formula of the fermentation medium comprises 10g/L of bean cake powder, 25g/L of corn steep liquor dry powder, 0.4g/L of sodium chloride, 0.5g/L of magnesium sulfate, 0.5g/L of dipotassium hydrogen phosphate, 0.2g/L of zinc chloride and 40g/L of glycerol, and the pH is regulated to 7.0 by using a sodium hydroxide solution before sterilization.

The beneficial effects of the invention are as follows:

on the basis of a bacillus natto bacillus subtilis conversion system, a genetic engineering strain which overexpresses tryptophan positive feedback activation signal peptide Ptrp-SP, toxic polypeptide txpA, cell wall endopeptidase cwlO, chorismate synthase (aroF), shikimate kinase (aroK) and 1, 4-dihydroxy-2 naphthoate-polyisoprene transferase (MenA) genes in bacillus natto is constructed by adopting an electrotransgenic genetic transformation mode and performing a large number of screening and identification. The obtained strain has genetic stability of multiple passages.

On the anabolic pathway of vitamin K2, tryptophan metabolic bypass is inhibited, key enzymes for vitamin K2 synthesis are selected for expression, metabolic flow for vitamin K2 synthesis is enhanced, metabolic pathway for tryptophan synthesis is weakened, accumulation of vitamin K2 is improved, and a foundation is provided for industrially synthesizing vitamin K2 by the genetically engineered strain.

According to the invention, bacillus natto is used as a receptor strain, the yield of MK-7 in recombinant bacteria is improved by regulating and controlling a plurality of key enzymes in an MK-7 synthesis path, and the yield of MK-7 is increased by 125% compared with that of wild strain MK-7 in 96h fermentation, so that the fermentation production of vitamin K2 has a huge industrial application prospect.

Drawings

FIG. 1 is a schematic diagram of the screening circuit pAX 01-PtrpSP-txpA-cwlO.

FIG. 2 is a schematic diagram of the map structure of the over-expression plasmid pHT 01-aroK-aroF-meno.

FIG. 3 is a PCR electrophoresis of the toxic gene txpA and the lyase gene cwlO. Wherein M is marker; lane txpA in A is a txpA fragment obtained by PCR amplification; lane cwlO in B is the cwlO fragment obtained by PCR amplification.

FIG. 4 is a PCR electrophoretogram of the overexpressed gene aroK\aroF\meno, where lane M is marker; NC is negative control; lane aroK is aroK fragment obtained by PCR amplification, lane aroF is aroF fragment obtained by PCR amplification, and lane meno is meno fragment obtained by PCR amplification.

FIG. 5 is a PCR electrophoresis chart of plasmid pHT01-aroK linearization. Wherein lane M is marker; lanes pHT01-aroK are linearized pHT01-aroK fragments.

FIG. 6 is a graph showing the tryptophan response experimental results of the Bacillus natto engineering strain.

FIG. 7 is a graph showing comparison of vitamin K2 production of wild type strain of Bacillus natto and recombinant Bacillus natto prepared by the present invention.

Detailed Description

Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to like or similar elements or elements having like or similar functions throughout. The embodiments described below by referring to the drawings are illustrative and intended to explain the present invention and should not be construed as limiting the invention. The specific techniques or conditions are not identified in the examples and are performed according to techniques or conditions described in the literature in this field or according to the product specifications. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1 construction of a Signal peptide response mechanism screening Loop

The nucleotide sequence of PtrpSP fragment synthesized by Gene company is as follows:

CCGCGCTTACGAAGCCGCATTCTGACTGTCAGATGCGGCTTCGCTTCATTGTTACCACTCCTGTTATTCCTCAACCCTTTTTTTAA

ACATTAAAATTCTTACGTAATTTATAATCTTTAAAAAAAGCATTTAATATTGCTCCCCGAACGATTGTGATTCGATTCACATTTAAACAA

TTTCAGAATAGACAAAAACTCTGAGTGTAATAATGTAGCCTCGTGTCTTGCGAGGATAAGTGCATTATGAATATCTTACATATATGTGTG

ACCTCAAAATGGTTCAATATTGACAACAAAATTGTCGATCACCGCCCTTGATTTGCCCTTCTGTAGCCATCACCAGAGCCAAACCGATTA

GATTCAATGTGATCTATTTGTTTGCTATATCTTAATTTTGCCTTTTGCAAAGGTCATCTCTCGTTTATTTACTTGTTTTAGTAAATGATG

GTGCTTGCATATATATCTGGCGAATTAATCGGTATAGCAGATGTAATATTCACAGGGATCACTGTAATTAAAATAAATGAAGGATTATGT

AATGGAAAACTTTAAACATCTCCCTGAACCG。SEQ ID NO:1

the fragment and the shuttle empty vector pAX01 plasmid were digested and ligated with restriction enzymes SphI and BamHI, respectively, to give pAX01-PtrpSP.

The amplified template with TxpA at 2678240 th to 2678419 th positions of bacillus subtilis genome (GenBank: NC-000964.3) is synthesized artificially, the amplified template with CwlO at 3574363 th to 3575784 th positions of bacillus subtilis genome is synthesized artificially, and PCR amplification is performed by using primers TxpA-F\TxpA-R (SEQ ID NO:2 and SEQ ID NO: 3), cwlO-F\CwlO-R (SEQ ID NO:4 and SEQ ID NO: 5) and PrimerStar high-fidelity polymerase respectively to obtain toxic polypeptide TxpA and cell wall endopeptidase CwlO fragment (the two fragments can also be directly synthesized artificially).

TxpA-F：atcctaggATGTCGACCTATGAATCT SEQ ID NO:2；

TxpA-R：taggatccCTACCCTTTAATAGGAGG SEQ ID NO:3；

CwlO-F：atCCTATTAAAGGGTAGGTGAGAAAGAGTTTAATTACACTT

SEQ ID NO:4；

CwlO-R：atggatccTTATTGAACAACACGTCTTACA SEQ ID NO:5；

The underlined parts are the cleavage sites.

TxpA PCR program was: 94℃30s,56℃5s,72℃1.5min,35 cycles, and purifying the PCR product, 1% agarose gel electrophoresis of the purified product.

The CwlO PCR procedure was: 94℃for 30s,60℃for 30s,72℃for 1.5min,35 cycles, and purifying the PCR product, 1% agarose gel electrophoresis of the purified product.

The nucleic acid sequence of TxpA is as follows:

ATGTCGACCTATGAATCTCTAATGGTCATGATCGGCTTTGCCAATTTAATAGGCGGGATTATGACATGGGTAATATCTCTTTTAAC ATTATTATTCATGCTTAGAAAAAAAGACACTCATCCTATTTACATTACTGTAAAGGAAAAGTGTCTACACGAGGACCCTCCTATTAAAGG GTAG。SEQ ID NO:6；

the nucleic acid sequence of CwlO is as follows:

CCTATTAAAGGGTAGGTGAGAAAGAGTTTAATTACACTTGGTTTGGCTTCCGTCATCGGGACAAGCAGTTTTTTGATCCCATTTAC

AAGTAAAACTGCATCGGCGGAAACATTAGATGAAAAGAAACAAAAAATCGAAAGCAAGCAATCTGAGGTTGCTTCCAGCATTGAAGCGAA

GGAAAAAGAATTAACCGAGCTTCAGGAAAATCAATCAAAGATTGAAAAAGAACTGAAAGACATTAACGATAAGGCGCTTGATACAAGCAA

CAAGATTGAAGATAAAAAAGAAGAAAACGATAAAACAAAAGAAGAAATCAAAAAACTGAAAAAAGAGATTAAAGAAACTGAAGCACGCAT

CGAAAAACGCAATGAAATCCTGAAAAAACGCGTTCGTTCTTTACAGGAAAGCGGCGGATCTCAAGGATACATAGATGTTCTTTTAGGATC

AACAAGCTTTGGTGACTTTATCTCTCGTGCGACTGCGGTTTCATCTATTGTGGACGCAGACAAAGATTTAATCAAACAGCAAGAGCAGGA

TAAAGCGAAGCTCGAAGATTCTGAAGCGGATTTGAATGACAAGCTGAAAGAAGTTCAAGCTGCCTTGGCTAAATTAGAAACAATGCAAAA

AGACCTTGATAAACAGCTTAATGAAAAAGACAAGCTTTTCGACGAAGCAAAAGCAAGCCAAAAGAAAACGGCTAAAGCGATTTCTGAATT

AAAATCAGAGGCGTCTGAACTTGCAAATCAAAAAGCAAATACTGAAGCTGAACAAGCACGCATCAAAAAAGAACAAGAAGCAGCGGCTGC

TTTGATCAAAAAGCAGGAAGAAGCACAAAAAGCATCTGATGAAACACAAACAGATGACAGTCAAACGGCGACAACTGAATCATCAAAAGC

AAGCTCATCTGATGATTCTTCAGACAATTCTTCAGACAATTCTTCTAACGGTTCATCAAACAGTTCGTCAAACGGCTCATCTTCTAAGAA

GAGCAGCGGCTCAAACAGCAATTCAGGCGGCACTGTTATCAGCAACTCTGGCGGAATTGAAGGCGCGATCAGCGTTGGTTCAAGCATTGT

AGGACAATCTCCGTACAAGTTTGGCGGCGGACGCACTCAGTCTGATATCAACAACCGTATTTTTGACTGCTCATCATTCGTACGCTGGGC

ATACGCTTCTGCAGGTGTTAACCTTGGACCTGTAGGCGGAACAACAACTGATACGTTAGTTGGCAGAGGACAAGCTGTCAGCGCGTCTGA

AATGAAACGCGGAGACCTTGTGTTCTTTGACACTTACAAAACAAATGGACACGTAGGAATCTACTTAGGAAACGGTACTTTCCTAAACGA

CAATACATCTCATGGCGTATCTGTTGACTCTATGAGCAATCCTTACTGGAAAGCAGCATTTAAAGGTGTTGTAAGACGTGTTGTTCAATA

A。SEQ ID NO:7。

and (3) purifying and recovering the obtained PCR product fragment, and performing secondary enzyme digestion-connection on the TxpA fragment and the pAX01-PtrpSP vector by using restriction enzymes AvrII and BamHI to obtain the pAX01-PtrpSP-txpA vector.

The CwlO fragment and pAX01-PtrpSP-txpA vector were subjected to a third cleavage-ligation using restriction enzymes EcoNI and BamHI to obtain a constructed screening circuit pAX01-PtrpSP-txpA-cwlO (see recombinant vector map of FIG. 1).

After the connection operation is completed, the strain is transferred into escherichia coli for resistance verification, enzyme digestion verification and sequencing verification. FIG. 3 is a PCR electrophoresis of the toxic gene txpA and the lyase gene cwlO. Wherein M is marker; lane txpA in A is a txpA fragment obtained by PCR amplification; lane cwlO in B is the cwlO fragment obtained by PCR amplification. It can be seen that the PCR band size was correct: txpA is about 200bp and cwlO is about 1500bp.

EXAMPLE 2 construction of the overexpression vector

The gene fragments of chorismate synthase (AroF), shikimate kinase (AroK) and 1, 4-dihydroxy-2-naphthoate-polyisoprene transferase (MenA) were obtained by PCR amplification, respectively, based on the genome of Bacillus natto Bacillus subtilis subsp. Natto BEST195 (GenBank: AP 011541.2) (the template for amplifying AroK was synthesized at positions 333805 to 334365, the template for amplifying AroF was synthesized at positions 2167761 to 2168951, and the template for amplifying MenA was synthesized at positions 3823548 to 3824432).

PCR amplification was performed with primers AroF-IF\AroF-IR (SEQ ID NO:8 and SEQ ID NO: 9), aroK-F\AroK-R (SEQ ID NO:10 and SEQ ID NO: 11), menA-F\MenA-R (SEQ ID NO:12 and SEQ ID NO: 13), respectively, to obtain chorismate synthase (AroF) (shown in SEQ ID NO: 14), shikimate kinase (AroK) (shown in SEQ ID NO: 15) and 1, 4-dihydroxy-2 naphthoate-polyisoprene transferase (MenA) gene sequences (shown in SEQ ID NO: 16). Can be synthesized manually.

AroF-IF：ctgggatctttatcagccgatgtaTTAAAATTCCCTCGACAGTTTTCTC

SEQ ID NO:8；

AroF-IR：ctgccccggggacgtcgactctagaATGAAGGGAGAAGAAGTCATGAGAT

SEQ ID NO:9；

AroK-F：atggatccATGAACGCTAAACGAGCC SEQ ID NO:10；

AroK-R：gatctagaTTACATCGGCTGATAAAGATCCCA SEQ ID NO:11；

MenA-F：tatctagaTTATCGGAAATAGCTGATCAATAA SEQ ID NO:12；

MenA-R：atatcccgggATGGGGCAGATCCTTTGGCAGTTA SEQ ID NO:13。

The underlined parts are the cleavage sites.

AroK PCR procedure was: 94℃30s,64℃15s,72℃1.5min,35 cycles, and purifying the PCR product, 1% agarose gel electrophoresis of the purified product.

AroF PCR procedure was: 98℃for 5s,67℃for 20s,72℃for 18s,30 cycles, and purifying the PCR product, 1% agarose gel electrophoresis of the purified product.

The MenA PCR procedure was: 94℃for 30s,60℃for 30s,72℃for 1.5min,35 cycles, and purifying the PCR product, 1% agarose gel electrophoresis of the purified product.

The nucleic acid sequence of AroF is as follows:

TTAAAATTCCCTCGACAGTTTTCTCATATTCTCCACATTTTCTCTAATGCGGTCAATTTGATCTAATCCGAATTGTTCAACGACTG

CGTTCGCAATTTCCCAAGCGACAGCCGCTTCAGCGACTACACTTGCCGCAGGAACAGCACAGCTGTCTGAACGTTCAATGCTGGCGGAAA

ACGGTTCTTTCGTTTCAATATCGACACTTTTCAGAGGTTTATACAAAGTCGGAATCGGCTTCATGACTCCGCGGACAACGATTGGCATCC

CTGTCGTCATGCCGCCTTCCAGTCCGCCAAGTCTGTTAGTAGCACGGGTGTATCCTTTTTCCTCGTCCCAAATGATCTCGTCATGGACTT

CGCTTCCATTTCGGCCTGCCGCCTCAAATCCGATCCCGAATTCCACACCTTTAAATGCATTAATTGACAGTACAGCGGCAGCAAGCTTGC

TATCCAGTTTGCGGTCATAATGGACATAGCTGCCCACGCCTACCGGCATTCCCTCGACAATGACTTCTACTATTCCGCCGATGGAATCTC

CGTTTGCCTTTGCTTCATCAATGGCAGCCATCATTTTTTTGCCTGCCTCTTCATCGTAGCATCTGACAGGAGACTCTTCCGTTACGCGCT

GCAGGTCTTCAATTGACGTATATTCTGTTTTTTCAGCTTTAACAGCGCCAATTTGCAACACGTGGCCCGCCACCTTAATGCCAAGCTCAG

AAAGAATCTTTTTAGCTACAGCCCCTGCCGCCACTCTGACAGTTGTTTCCCTTGCTGAAGAACGCTCAAGCACATTTCTCATATCACGAT

GATTATATTTAATTGCACCGTTTAAGTCAGCGTGCCCAGGTCTAGGTCTGGAAATCTGGCGCTTCATTTCCTTTTCTTCATCTTCTGTAA

TCGGGGCGGCGCCCATGATTTTTGTCCAATGCTTCCAATCGTTATTTTCAACTACGAGAGCAATTGGTGAACCGAGTGTACGTGCATGGC

GCACCCCGCTCATAATTTTGGCCTGGTCTTTTTCGATCTGCATGCGGCGGCCGCGGCCGTGTCCTTTTTGGCGTCTGGCAAGCTCAAAAT

TGATATCTTCCTCCGTTATGTAAAGCCCGGCAGGTACACCCTCAATAATGGTTGTCAGTTGGGGGCCGTGTGATTCTCCGGCTGTTAAAT

ATCTCATGACTTCTTCTCCCTTCAT。SEQ ID NO:14；

the nucleic acid sequence of AroK is as follows:

ATGAACGCTAAACGAGCCATCCCAGTAAGAGAAAGAAATATCGTCCTGATCGGATTCATGGGTGTAGGAAAAACAACAATCGGCCA

ATTGGTCGCTAAAAAATTATATAGAGATTTTATTGATATTGACCAGCAGATCGAAAAGGATTTCAATATGTCAATTCCTGAGATATTTGA

GAAAAAGGGAGAAGACTTTTTCCGGAAAACGGAGAAGGAATATATTTTAGACATCTGCCATCATAAACGATTCAAAATCGTATCTCTGGG

CGGGGGATCTTTTAAACAAGAAGAAATCAGAAATTGCTGTCTGGAAAACTGTCTCGTGCTTCATCTGGACCTGTCATGGGAGAACTGGAA

GCAGCGCGCGGATTTATTGATCGAAAGCCGCCCTGTACTGCATAACCGTTCAATGGATGAAATGGAACAGCTGTTTAACGAAAGAAAAGT

CATTTATGACAAGCACAATTCAAAAGTGGCAACAGACAACCTTTCCCCGGAAGAGGTTGCCGATTACATTGTTGAGACATTAAAAATTGG

CTGGGATCTTTATCAGCCGATGTAA。SEQ ID NO:15。

the nucleic acid sequence of MenA is as follows:

TTATCGGAAATAGCTGATCAATAATCCGATCGAAAGCAGGAATCCGAAAAATGTATTTGTTTGGGCTGTTGATTTCATTGCGACAA

TCATATTCATCGGCATTTCTTTTTGGACGAAGCCCTTCACTGCCTGAACCGGCTTAGGCACGCTCAAAAAGACGACAAACAGCCATGGGC

TTGCGGCACCGGTAATAACCAAGCCGACAACCCAGATATAAGCGACGGCAAACGACGCAGCTAACAGAGTAACAGCTCCCTTATGCCCCA

TCAAAATCGCCAATGTTTTGCGGCCGCCTTTTTTGTCCTCTTCAATATCGCGAATGTTGTTTGACAAATTAATCGCGCCGACAAGAATCG

CAATCGGGATGGAAATCAAAATGCTTTGCGTGTTGATCATATCTGTCTGAATGAAAAACGAAATCAGCACAAACACCGAACCCATGCAAA

TGCCTGAGAATAATTCACCGAACGGCGTGTACGCAATCGGCAGCGGCCCGCCTGTATACAGGTAGCCGATCGCCATGCCGACAAGGCCGA

TCAGCGCAAGCCACCAGCTGCTGCTCGCACAAATATAGACACCGAGCAAAATGGCAATCCCGTATGATGCCAGAGCTAATTGCAAAATCG

TTTTAGGCTTCATTCCGTGGCGTACAATTGCCCCTCCGATTCCGACTGATTCTGCTGTATCTAATCCGCGTTTAAAATCATAATATTCAT

TAAATAAGTTCGTCGCGATCTGGATCCATAGGCAAGAAAACAGCATAGCCAAAAACAGCAGCAGATCAACCTTCACATAAAACATCGCCA

AAACGGTTCCGAGCAGCACAGGCACAAACGATGCGGTTAACGTATGAGGACGGGTTAACTGCCAAAGGATCTGCCCCAT。

SEQ ID NO:16。

the aroK fragment and plasmid pHT01 were digested and ligated with restriction enzymes BamHI and XbaI to obtain pHT01-aroK plasmid.

And (3) carrying out linearization PCR on the pHT01-aroK plasmid by using pHT01-VF/pHT01-VR primers (SEQ ID NO:17 and SEQ ID NO: 18) to obtain a linearization plasmid fragment, and then carrying out POE-PCR connection with the aroF fragment to obtain the plasmid pHT01-aroK-aroF.

pHT01-VF：ATCTCATGACTTCTTCTCCCTTCAT tctagagtcgacgtccccggggcag

SEQ ID NO:17；

pHT01-VR：gagaaaactgtcgagggaattttAATACATCGGCTGATAAAGATCCCAG

SEQ ID NO:18。

pHT01-aroK linearization PCR procedure was: 98℃for 5s,64℃for 20s,72℃for 2min for 10s,30 cycles, and the PCR products were electrophoretically verified.

The MenA fragment and pHT01-aroK-aroF were digested and ligated with restriction enzymes XbaI and SmaI to give an over-expression plasmid pHT 01-aroK-aroF-menoA (see recombinant vector map of FIG. 2).

After the enzyme digestion-connection operation is completed, the strain is transferred into escherichia coli for resistance verification, enzyme digestion verification and sequencing verification. Wherein FIG. 4 is a PCR electrophoresis diagram of the over-expressed gene aroK\aroF\meno wherein M is marker; NC is negative control; lane aroK is aroK fragment obtained by PCR amplification, lane aroF is aroF fragment obtained by PCR amplification, and lane meno is meno fragment obtained by PCR amplification. It can be seen that the PCR band size was correct: aroK was about 600bp, aroF was about 1200bp, and menA was about 1000bp, which substantially matches the size of each expansion fragment. FIG. 5 is a diagram of plasmid pHT01-aroK linearized PCR electrophoresis. Wherein lane M is marker; lanes pHT01-aroK are linearized pHT01-aroK fragments. It can be seen that the size of the linearized band is correct, about 9000-10000bp.

The digestion, ligation and validation procedure in the above examples:

1. enzyme digestion reaction

And (3) respectively carrying out double enzyme digestion on different vectors and PCR purified product fragments by using corresponding restriction enzymes, and recovering the gel. Enzyme cleavage System (50. Mu.L): restriction enzymes 2. Mu.L each, loading Buffer 5. Mu.L, plasmid or PCR purified product 20. Mu.L, and appropriate ddH was added ₂ O was added to the mixture to give a total volume of 50. Mu.L, and the mixture was digested in a water bath at 37℃for 2 hours. And (5) carrying out electrophoresis recovery on the enzyme digestion products by using 1% agarose gel.

2. Ligation reaction

And (3) connecting the gene fragment after enzyme digestion with the vector fragment by using T4 ligase, and connecting for 12 hours at 16 ℃ to obtain the recombinant overexpression vector or the screening loop vector. Ligation system (25 μl): 2. Mu.L of the target gene fragment, 1. Mu.L of the vector fragment after cleavage, 2.5. Mu.L of ligase buffer, 19.5. Mu.L of ddH ₂ O, connection is carried out for 12h at 16 ℃.

3. The ligation product transformed E.coli Trans110 competent cells by the following method:

taking 100 mu L of competent cells under aseptic condition, adding a connection product, uniformly mixing, and standing on ice for 30 minutes.

And (3) rapidly placing on ice for 3-5 minutes after heat shock for 90 seconds at 42 ℃.

The culture was incubated with 900. Mu.L of LB medium at 37℃for 1h at 150 r/min.

200. Mu.L of the cells were plated on LB plates containing 100. Mu.g/mL ampicillin resistance or 34. Mu.g/mL chloramphenicol resistance, and selected according to the resistance of the vector. The cells were incubated at 37℃overnight.

And (3) picking out the positive transformant, extracting the plasmid, and sequencing and verifying the result to prove that the connection is successful, thereby obtaining the recombinant over-expression vector.

Example 3 construction of Bacillus natto engineering Strain containing screening Circuit and overexpression vector

Preparation of bacillus subtilis competent cells of natto

(1) Single colonies of activated Bacillus natto (DSM 1088) on the plates were picked up to 3mL LB medium and grown overnight at 30℃with a 200r/min shaker.

(2) 2.5ml of overnight culture was inoculated into 40ml (LB+0.5M sorbitol), and cultured at 30℃and 200rpm until OD600 = 0.85-0.95.

(3) The bacterial liquid was subjected to ice-water bath for 10min, and then 5000g,5min and 4℃were centrifuged to collect the bacterial cells.

(4) The cells were resuspended in 50ml of pre-chilled electrotransfer medium (0.5M sorbitol, 0.5M mannitol, 10% glycerol), and the supernatant was centrifuged at 5000g,5min at 4℃and rinsed 4 times.

(5) The washed bacteria are resuspended in 1mL electrotransfer culture medium, and the cells are sub-packaged in 1.5mL sterile centrifuge tubes, each tube is sub-packaged in 100 mu L, and the cells are kept on ice for later use.

Electric transformation of bacillus subtilis natto

(1) 50ng of target DNA was added to 100. Mu.L of competent cells, incubated on ice for 2min, and placed in a pre-chilled electrocuvette (1 mm) on ice for 5min.

(2) Shock, 2.0kv, shock 1 time.

(3) Immediately, 1ml RM medium (LB+0.5M sorbitol+0.38mannitol) was added to the electric cup, and after resuscitating for 3 hours at 30℃and 200rpm, the plate was smeared.

(4) Culturing at 30deg.C overnight.

Screening and identification of bacillus natto bacillus subtilis overexpression vector and screening loop engineering strain

(1) Plate colonies were picked and inoculated into LB medium containing 100mg/L ampicillin and 34mg/L chloramphenicol, and cultured overnight at 30℃and 200 rpm.

(2) The overnight culture medium is transferred into fresh culture medium at a ratio of 2 percent, and is diluted for 10 after being cultured for 6 to 8 hours ⁸ -10 ⁹ Double, spread on LB plate containing ampicillin and chloramphenicol, and cultured at 30℃overnight in an inverted manner.

(3) Numbering and seed preservation are carried out on single colonies in the step (2), the single colonies are sequentially transferred to a fresh culture medium, bacterial liquid is split-packed into a sterilization culture tube when OD=0.3, tryptophan (0, 10, 20, 50, 100, 200, 500, 1000 mg/L) with different concentrations is respectively added, the culture is carried out for 24 hours at the temperature of 30 ℃, OD600 is measured, strains with the most sensitive tryptophan response (namely, a small amount of tryptophan is added to inhibit cell growth) are screened, and the strains are preserved in a refrigerator at the temperature of-80 ℃. The tryptophan response experiment is carried out on the strain, the result is shown in fig. 6, and fig. 6 is a graph of the tryptophan response experiment result of the bacillus natto engineering strain (experimental conditions: strains introduced with txpA and cwlO genes are cultured in LB culture media containing tryptophan with different concentrations), so that the strain is successfully screened, and the cell growth is inhibited as the tryptophan concentration increases.

(4) And inoculating the strain with sensitive tryptophan response into a fresh fermentation medium, culturing for 120 hours at 30 ℃, measuring the yield of vitamin K2, selecting the strain with highest yield for carrying out passage stability test, and preserving the strain with the yield not lower than 95% of the initial strain in a refrigerator at-80 ℃ after more than 5 times of continuous passages, wherein the strain is named BN-07.

The components of the fermentation medium are 10g/L of bean cake powder, 25g/L of corn steep liquor dry powder, 0.4g/L of sodium chloride, 0.5g/L of magnesium sulfate, 0.5g/L of dipotassium hydrogen phosphate, 0.2g/L of zinc chloride and 40g/L of glycerol, and a sodium hydroxide solution is used for regulating the pH value to 7.0 before sterilization.

Example 4 Bacillus natto screening Circuit and vitamin K2 content determination of over-expressed engineering Strain

Culturing fermentation seeds: the screened genetically engineered strain BN-07 is subjected to LB solid plate culture containing chloramphenicol and ampicillin resistance, single colony is selected and inoculated into a 250mL conical flask (50 mL containing LB liquid medium), and shake-cultured at 30 ℃ for 14h at 200 r/min.

Shaking bottle fermentation culture: inoculating 4mL of the cultured seed solution into a 500mL conical flask (containing 100mL of fermentation medium and the same formula as above), shaking at 30 ℃ for 120h at 200r/min, and sampling every 24 h.

The method for extracting and detecting the vitamin K2 content by collecting thalli comprises the following steps:

(1) 4 times of volume of extract (n-hexane: isopropanol volume ratio=2:1) was added to the fermentation broth, and the mixture was shaken for 40min in the absence of light.

(2) Standing and layering, sucking supernatant, and filtering with 0.22 μm organic filter membrane to obtain sample detection solution.

(3) Detecting the content of vitamin K2 by high performance liquid chromatography, and detecting conditions: the C18 column is used, the temperature of the column is 30 ℃, the flow rate of mobile phase methanol is 1.0ml/min, the detection wavelength is 254nm, the sample injection amount is 20uL, and the detection time is 35min. The detection result is calculated by an external standard method to obtain the vitamin K2 content in the fermentation broth, and the maximum vitamin K2 content reaches 72mg/L when the fermentation is performed for 96 hours.

The results are shown in FIG. 7, and FIG. 7 is a graph showing comparison of vitamin K2 production of wild type strain of Bacillus natto and recombinant Bacillus natto prepared by the present invention. Wherein WT represents a wild-type strain of Bacillus natto (DSM 1088), and BN-07 represents a recombinant Bacillus natto strain produced by the present invention. The result shows that the recombinant bacillus natto obtained by the method of the experiment has multiple passage genetic stability. The yield of vitamin K2 is also greatly improved, the maximum yield is 72mg/L when the fermentation is carried out for 96 hours, the wild strain is 32mg/L, and the yield is increased by 125 percent compared with the wild strain. The genetic engineering strain constructed by the method and the construction method lay a powerful foundation for subsequent theoretical research and industrial production.

Although embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives, and variations may be made in the above embodiments by those skilled in the art without departing from the spirit and principles of the invention.

SEQUENCE LISTING

<110> inner Mongolia Jindawei pharmaceutical Co., ltd

Xiamen Kingdomway Group Co.

<120> recombinant bacillus natto for high yield of vitamin K2, preparation method and use thereof

<130> JDWJ-20008-CNI

<160> 18

<170> PatentIn version 3.5

<210> 1

<211> 567

<212> DNA

<213> Synthesis

<400> 1

ccgcgcttac gaagccgcat tctgactgtc agatgcggct tcgcttcatt gttaccactc 60

ctgttattcc tcaacccttt ttttaaacat taaaattctt acgtaattta taatctttaa 120

aaaaagcatt taatattgct ccccgaacga ttgtgattcg attcacattt aaacaatttc 180

agaatagaca aaaactctga gtgtaataat gtagcctcgt gtcttgcgag gataagtgca 240

ttatgaatat cttacatata tgtgtgacct caaaatggtt caatattgac aacaaaattg 300

tcgatcaccg cccttgattt gcccttctgt agccatcacc agagccaaac cgattagatt 360

caatgtgatc tatttgtttg ctatatctta attttgcctt ttgcaaaggt catctctcgt 420

ttatttactt gttttagtaa atgatggtgc ttgcatatat atctggcgaa ttaatcggta 480

tagcagatgt aatattcaca gggatcactg taattaaaat aaatgaagga ttatgtaatg 540

gaaaacttta aacatctccc tgaaccg 567

<210> 2

<211> 26

<212> DNA

<213> Synthesis

<400> 2

atcctaggat gtcgacctat gaatct 26

<210> 3

<211> 26

<212> DNA

<213> Synthesis

<400> 3

taggatccct accctttaat aggagg 26

<210> 4

<211> 41

<212> DNA

<213> Synthesis

<400> 4

atcctattaa agggtaggtg agaaagagtt taattacact t 41

<210> 5

<211> 30

<212> DNA

<213> Synthesis

<400> 5

atggatcctt attgaacaac acgtcttaca 30

<210> 6

<211> 180

<212> DNA

<213> Bacillus subtilis

<400> 6

atgtcgacct atgaatctct aatggtcatg atcggctttg ccaatttaat aggcgggatt 60

atgacatggg taatatctct tttaacatta ttattcatgc ttagaaaaaa agacactcat 120

cctatttaca ttactgtaaa ggaaaagtgt ctacacgagg accctcctat taaagggtag 180

<210> 7

<211> 1437

<212> DNA

<213> Bacillus subtilis

<400> 7

cctattaaag ggtaggtgag aaagagttta attacacttg gtttggcttc cgtcatcggg 60

acaagcagtt ttttgatccc atttacaagt aaaactgcat cggcggaaac attagatgaa 120

aagaaacaaa aaatcgaaag caagcaatct gaggttgctt ccagcattga agcgaaggaa 180

aaagaattaa ccgagcttca ggaaaatcaa tcaaagattg aaaaagaact gaaagacatt 240

aacgataagg cgcttgatac aagcaacaag attgaagata aaaaagaaga aaacgataaa 300

acaaaagaag aaatcaaaaa actgaaaaaa gagattaaag aaactgaagc acgcatcgaa 360

aaacgcaatg aaatcctgaa aaaacgcgtt cgttctttac aggaaagcgg cggatctcaa 420

ggatacatag atgttctttt aggatcaaca agctttggtg actttatctc tcgtgcgact 480

gcggtttcat ctattgtgga cgcagacaaa gatttaatca aacagcaaga gcaggataaa 540

gcgaagctcg aagattctga agcggatttg aatgacaagc tgaaagaagt tcaagctgcc 600

ttggctaaat tagaaacaat gcaaaaagac cttgataaac agcttaatga aaaagacaag 660

cttttcgacg aagcaaaagc aagccaaaag aaaacggcta aagcgatttc tgaattaaaa 720

tcagaggcgt ctgaacttgc aaatcaaaaa gcaaatactg aagctgaaca agcacgcatc 780

aaaaaagaac aagaagcagc ggctgctttg atcaaaaagc aggaagaagc acaaaaagca 840

tctgatgaaa cacaaacaga tgacagtcaa acggcgacaa ctgaatcatc aaaagcaagc 900

tcatctgatg attcttcaga caattcttca gacaattctt ctaacggttc atcaaacagt 960

tcgtcaaacg gctcatcttc taagaagagc agcggctcaa acagcaattc aggcggcact 1020

gttatcagca actctggcgg aattgaaggc gcgatcagcg ttggttcaag cattgtagga 1080

caatctccgt acaagtttgg cggcggacgc actcagtctg atatcaacaa ccgtattttt 1140

gactgctcat cattcgtacg ctgggcatac gcttctgcag gtgttaacct tggacctgta 1200

ggcggaacaa caactgatac gttagttggc agaggacaag ctgtcagcgc gtctgaaatg 1260

aaacgcggag accttgtgtt ctttgacact tacaaaacaa atggacacgt aggaatctac 1320

ttaggaaacg gtactttcct aaacgacaat acatctcatg gcgtatctgt tgactctatg 1380

agcaatcctt actggaaagc agcatttaaa ggtgttgtaa gacgtgttgt tcaataa 1437

<210> 8

<211> 49

<212> DNA

<213> Synthesis

<400> 8

ctgggatctt tatcagccga tgtattaaaa ttccctcgac agttttctc 49

<210> 9

<211> 50

<212> DNA

<213> Synthesis

<400> 9

ctgccccggg gacgtcgact ctagaatgaa gggagaagaa gtcatgagat 50

<210> 10

<211> 26

<212> DNA

<213> Synthesis

<400> 10

atggatccat gaacgctaaa cgagcc 26

<210> 11

<211> 32

<212> DNA

<213> Synthesis

<400> 11

gatctagatt acatcggctg ataaagatcc ca 32

<210> 12

<211> 32

<212> DNA

<213> Synthesis

<400> 12

tatctagatt atcggaaata gctgatcaat aa 32

<210> 13

<211> 34

<212> DNA

<213> Synthesis

<400> 13

atatcccggg atggggcaga tcctttggca gtta 34

<210> 14

<211> 1191

<212> DNA

<213> Bacillus natto Bacillus subtilis subsp. Natto BEST195

<400> 14

ttaaaattcc ctcgacagtt ttctcatatt ctccacattt tctctaatgc ggtcaatttg 60

atctaatccg aattgttcaa cgactgcgtt cgcaatttcc caagcgacag ccgcttcagc 120

gactacactt gccgcaggaa cagcacagct gtctgaacgt tcaatgctgg cggaaaacgg 180

ttctttcgtt tcaatatcga cacttttcag aggtttatac aaagtcggaa tcggcttcat 240

gactccgcgg acaacgattg gcatccctgt cgtcatgccg ccttccagtc cgccaagtct 300

gttagtagca cgggtgtatc ctttttcctc gtcccaaatg atctcgtcat ggacttcgct 360

tccatttcgg cctgccgcct caaatccgat cccgaattcc acacctttaa atgcattaat 420

tgacagtaca gcggcagcaa gcttgctatc cagtttgcgg tcataatgga catagctgcc 480

cacgcctacc ggcattccct cgacaatgac ttctactatt ccgccgatgg aatctccgtt 540

tgcctttgct tcatcaatgg cagccatcat ttttttgcct gcctcttcat cgtagcatct 600

gacaggagac tcttccgtta cgcgctgcag gtcttcaatt gacgtatatt ctgttttttc 660

agctttaaca gcgccaattt gcaacacgtg gcccgccacc ttaatgccaa gctcagaaag 720

aatcttttta gctacagccc ctgccgccac tctgacagtt gtttcccttg ctgaagaacg 780

ctcaagcaca tttctcatat cacgatgatt atatttaatt gcaccgttta agtcagcgtg 840

cccaggtcta ggtctggaaa tctggcgctt catttccttt tcttcatctt ctgtaatcgg 900

ggcggcgccc atgatttttg tccaatgctt ccaatcgtta ttttcaacta cgagagcaat 960

tggtgaaccg agtgtacgtg catggcgcac cccgctcata attttggcct ggtctttttc 1020

gatctgcatg cggcggccgc ggccgtgtcc tttttggcgt ctggcaagct caaaattgat 1080

atcttcctcc gttatgtaaa gcccggcagg tacaccctca ataatggttg tcagttgggg 1140

gccgtgtgat tctccggctg ttaaatatct catgacttct tctcccttca t 1191

<210> 15

<211> 561

<212> DNA

<213> Bacillus natto Bacillus subtilis subsp. Natto BEST195

<400> 15

atgaacgcta aacgagccat cccagtaaga gaaagaaata tcgtcctgat cggattcatg 60

ggtgtaggaa aaacaacaat cggccaattg gtcgctaaaa aattatatag agattttatt 120

gatattgacc agcagatcga aaaggatttc aatatgtcaa ttcctgagat atttgagaaa 180

aagggagaag actttttccg gaaaacggag aaggaatata ttttagacat ctgccatcat 240

aaacgattca aaatcgtatc tctgggcggg ggatctttta aacaagaaga aatcagaaat 300

tgctgtctgg aaaactgtct cgtgcttcat ctggacctgt catgggagaa ctggaagcag 360

cgcgcggatt tattgatcga aagccgccct gtactgcata accgttcaat ggatgaaatg 420

gaacagctgt ttaacgaaag aaaagtcatt tatgacaagc acaattcaaa agtggcaaca 480

gacaaccttt ccccggaaga ggttgccgat tacattgttg agacattaaa aattggctgg 540

gatctttatc agccgatgta a 561

<210> 16

<211> 885

<212> DNA

<213> Bacillus natto Bacillus subtilis subsp. Natto BEST195

<400> 16

ttatcggaaa tagctgatca ataatccgat cgaaagcagg aatccgaaaa atgtatttgt 60

ttgggctgtt gatttcattg cgacaatcat attcatcggc atttcttttt ggacgaagcc 120

cttcactgcc tgaaccggct taggcacgct caaaaagacg acaaacagcc atgggcttgc 180

ggcaccggta ataaccaagc cgacaaccca gatataagcg acggcaaacg acgcagctaa 240

cagagtaaca gctcccttat gccccatcaa aatcgccaat gttttgcggc cgcctttttt 300

gtcctcttca atatcgcgaa tgttgtttga caaattaatc gcgccgacaa gaatcgcaat 360

cgggatggaa atcaaaatgc tttgcgtgtt gatcatatct gtctgaatga aaaacgaaat 420

cagcacaaac accgaaccca tgcaaatgcc tgagaataat tcaccgaacg gcgtgtacgc 480

aatcggcagc ggcccgcctg tatacaggta gccgatcgcc atgccgacaa ggccgatcag 540

cgcaagccac cagctgctgc tcgcacaaat atagacaccg agcaaaatgg caatcccgta 600

tgatgccaga gctaattgca aaatcgtttt aggcttcatt ccgtggcgta caattgcccc 660

tccgattccg actgattctg ctgtatctaa tccgcgttta aaatcataat attcattaaa 720

taagttcgtc gcgatctgga tccataggca agaaaacagc atagccaaaa acagcagcag 780

atcaaccttc acataaaaca tcgccaaaac ggttccgagc agcacaggca caaacgatgc 840

ggttaacgta tgaggacggg ttaactgcca aaggatctgc cccat 885

<210> 17

<211> 50

<212> DNA

<213> Synthesis

<400> 17

atctcatgac ttcttctccc ttcattctag agtcgacgtc cccggggcag 50

<210> 18

<211> 49

<212> DNA

<213> Synthesis

<400> 18

gagaaaactg tcgagggaat tttaatacat cggctgataa agatcccag 49

Claims

1. The recombinant bacillus natto for high-yield vitamin K2 is characterized in that the recombinant bacillus natto contains the following genes: tryptophan positive feedback activation signal peptide PtrpSP gene, toxic polypeptide txpA gene, cell wall endopeptidase cwlO gene, shikimate kinase AroK gene, chorismate synthase AroF gene and 1, 4-dihydroxy-2 naphthoate-polyisoprene transferase MenA gene;

the nucleotide sequence of the tryptophan positive feedback activation signal peptide PtrpSP gene is shown as SEQ ID NO. 1, the nucleotide sequence of the toxic polypeptide txpA gene is shown as SEQ ID NO. 6, the nucleotide sequence of the cell wall endopeptidase cwlO gene is shown as SEQ ID NO. 7, the nucleotide sequence of the shikimate kinase aroK gene is shown as SEQ ID NO. 15, the nucleotide sequence of the branching acid synthetase aroF gene is shown as SEQ ID NO. 14, and the nucleotide sequence of the 1, 4-dihydroxy-2 naphthoate-polyisoprene transferase MenA gene is shown as SEQ ID NO. 16.

2. A process for preparing the recombinant bacillus natto of claim 1, wherein,

construction of the screening Circuit pAX 01-PtrpSP-txpA-cwlO: artificially synthesizing PtrpSP genes, and connecting the PtrpSP genes with an empty vector pAX01 by utilizing restriction enzymes SphI and BamHI after double enzyme digestion to obtain pAX01-PtrpSP; double-enzyme digestion is carried out on the TxpA gene fragment and the pAX01-PtrpSP vector by utilizing restriction enzymes AvrII and BamHI, and then the pAX01-PtrpSP-txpA vector is obtained; double-enzyme digestion is carried out on the CwlO gene fragment and the pAX01-PtrpSP-txpA vector by using restriction enzymes EcoNI and BamHI, and then the connection is carried out, so that a constructed screening loop pAX01-PtrpSP-txpA-cwlO is obtained;

construction of the overexpression plasmid pHT 01-aroK-aroF-meno: obtaining gene fragments of chorismate synthase AroF, shikimate kinase AroK and 1, 4-dihydroxy-2 naphthalene formate-polyisoprene transferase MenA; double enzyme digestion is carried out on the AroK gene fragment and plasmid pHT01 by utilizing BamHI and XbaI, and then the pHT01-aroK plasmid is obtained; carrying out linearization PCR on the pHT01-aroK plasmid, and carrying out POE-PCR connection on the obtained linearization plasmid fragment and aroF gene fragment to obtain plasmid pHT01-aroK-aroF; double-enzyme digestion is carried out on the MenA gene fragment and the plasmid pHT01-aroK-aroF by adopting restriction endonucleases XbaI and SmaI, and then the connection is carried out, thus obtaining an over-expression plasmid pHT 01-aroK-aroF-menoA;

3. The method for preparing recombinant bacillus natto according to claim 2, wherein in the step of constructing the screening circuit pAX01-PtrpSP-txpA-cwlO, the txpA gene fragment and the cwlO gene fragment are artificially synthesized or amplified by PCR.

4. The method for preparing recombinant bacillus natto of claim 3, wherein the TxpA gene fragment is amplified by PCR as follows: artificially synthesizing an amplification template with TxpA at 2678240 th to 2678419 th positions of GenBank NC_000964.3, and performing PCR amplification to obtain a PCR product which is a TxpA gene fragment; the CwlO gene fragment is obtained by PCR amplification: the amplified template with CwlO at 3574363 th to 3575784 th positions of GenBank NC_000964.3 is synthesized artificially, and PCR amplification is carried out to obtain a PCR product which is a CwlO gene fragment.

5. The method for preparing recombinant bacillus natto of claim 2, wherein the construction of the over-expression plasmid pHT 01-aroK-aroF-meno is performed by artificially synthesizing or amplifying the aroK gene fragment, aroF gene fragment and MenA gene fragment.

6. The method for preparing recombinant bacillus natto of claim 5, wherein the AroK gene fragment is amplified by PCR as follows: artificially synthesizing an amplified template of AroK at 333805 to 334365 of GenBank (AP 011541.2), and performing PCR amplification to obtain a PCR product which is an AroK gene fragment; the AroF gene fragment is amplified by PCR to obtain: artificially synthesizing an AroF gene fragment by using 2167761 th to 2168951 th positions of an AP011541.2 as an amplification template for amplifying the AroF and performing PCR amplification to obtain a PCR product; the MenA gene fragment was amplified by PCR as follows: the 3823548 th to 3824432 th positions of the GenBank: AP011541.2 are amplification templates for amplifying the MenA, and PCR amplification is carried out to obtain PCR products which are the MenA gene fragments.

7. The method for preparing recombinant bacillus natto of claim 4, wherein the primer used for amplifying the toxic polypeptide TxpA gene is TxpA-FTxpA-R, and the sequences of the primers are shown as SEQ ID NO. 2 and SEQ ID NO. 3;

the primer used for amplifying the cell wall endopeptidase CwlO gene is CwlO-FCwlO-R, and the sequences of the primer are shown as SEQ ID NO. 4 and SEQ ID NO. 5.

8. The method for preparing recombinant bacillus natto according to claim 6, wherein the primer used for amplifying the chorismate synthase AroF gene is AroF-iforof-IR, and the sequences of the primers are shown in SEQ ID NOs 8 and 9;

the primer used for amplifying the shikimate kinase AroK gene is AroK-FAroK-R, and the sequence of the primer is shown as SEQ ID NO. 10 and SEQ ID NO. 11;

the primer used for amplifying the 1, 4-dihydroxy-2 naphthoate-polyisoprene transferase MenA gene is MenA-FMena-R, and the sequence of the primer is shown as SEQ ID NO. 12 and SEQ ID NO. 13.

9. The method for preparing the recombinant bacillus natto according to claim 2, wherein the primer for linearizing pHT01-aroK plasmid by PCR is pHT01-VF/pHT01-VR, and the sequences are shown as SEQ ID NO. 17 and SEQ ID NO. 18.

10. Use of the recombinant bacillus natto of claim 1 for the production of vitamin K2.

11. A method for producing vitamin K2 is characterized in that the recombinant bacillus natto of claim 1 is subjected to LB solid plate culture containing chloramphenicol and ampicillin resistance, single colony is selected for inoculation, and then shake culture is carried out to obtain seed liquid; inoculating the seed liquid into a fermentation culture medium for fermentation culture for 60-140 h at the temperature of 30-40 ℃.

12. The method for producing vitamin K2 according to claim 11, wherein the seed solution is inoculated into the fermentation medium in an inoculum size of 1 to 5% by volume.

13. The method for producing vitamin K2 according to claim 11 wherein the fermentation medium is formulated of 10g/L of bean cake flour, 25g/L of corn steep liquor dry powder, 0.4g/L of sodium chloride, 0.5g/L of magnesium sulfate, 0.5g/L of dipotassium hydrogen phosphate, 0.2g/L of zinc chloride, 40g/L of glycerin, and the pH is adjusted to 7.0 using sodium hydroxide solution prior to sterilization.