CN110540943A - Gene engineering strain for producing emodin and construction method and application thereof - Google Patents

Abstract

The invention discloses a genetic engineering strain for producing emodin and downstream derivatives thereof, wherein the starting strain of the genetic engineering strain is aspergillus terreus, and the genetic engineering strain is prepared by over-expressing a transcription regulatory factor ATEG _08453 in the aspergillus terreus. Compared with the original strain, the genetic engineering strain can be used for synthesizing emodin.

Description

gene engineering strain for producing emodin and construction method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a genetic engineering strain for producing emodin and a construction method and application thereof.

Background

Rhubarb is an important Chinese medicine and is used in various Chinese medicine compound formulas, and emodin (CAS:518-82-1) is the main effective component of the Chinese medicine compound. The research results of the biological activity of the emodin and the derivatives thereof in recent years show that the emodin and the derivatives thereof also have important potential medical value in the aspects of preventing and treating various diseases. Besides, the emodin is a natural pigment, and can also be used in health care and daily chemical products, such as hair care and skin care products. At present, emodin is mainly extracted from plants such as rheum officinale and polygonum cuspidatum, the content of active ingredients is low, byproducts are more, the time and labor for planting the plants are consumed, and the plants are greatly influenced by environmental factors, so that the production cost of the emodin is high, the supply amount is small, and the downstream application and development of the emodin are limited. Oversized flavins and their derivatives are also found in some fungal cultures, but at very low levels. Further biochemical and molecular biological studies have shown that the emodin biosynthetic pathway does exist in these fungi, but emodin is only an intermediate product of the entire synthetic pathway and does not accumulate in large amounts.

At the genomic level, many microorganisms have a large capacity for the synthesis of secondary metabolites, and have synthetic genes or gene clusters that synthesize a variety of secondary metabolites. However, the biosynthesis mechanism of natural products is very complex, and is not only influenced by various environmental factors, but also regulated by complex regulation networks such as internal signal transduction, global regulation, specific transcription regulation and the like. Therefore, under normal conditions, most of the secondary metabolite synthesis pathways are inactive, and no or only a small amount of the relevant product can be synthesized. In aspergillus terreus, emodin is an intermediate in the biosynthesis of destomycin, and is synthesized only in a very small amount and cannot be efficiently accumulated under normal conditions. The invention discloses a novel method for preparing emodin, which is characterized in that the fungus is subjected to genetic engineering modification, so that emodin can be efficiently synthesized and accumulated and is used for fermenting and synthesizing emodin.

Disclosure of Invention

the invention provides a genetic engineering strain for producing emodin or downstream derivatives thereof, wherein the starting strain of the genetic engineering strain is Aspergillus terreus (Aspergillus terreus).

In one embodiment, the downstream derivative of emodin comprises one or more of Questin, Ethyl asterate, hydroxysulchrin, omega-Hydroxyemodin-5-methytheri, monomethyosylic acid, sunochrin, and asteric acid.

The genetic engineering strain is prepared by over-expressing a transcription regulatory factor ATEG _08453 in aspergillus terreus.

The overexpression in the present invention includes increasing the expression level of a gene by introducing an additional copy of the target gene, increasing the copy number of the target gene in a cell, or increasing the expression level of the target gene by replacing a promoter of the gene.

in one embodiment, the overexpression comprises the step of replacing the promoter of ATEG _08453 in aspergillus terreus with a strong promoter; preferably, the strong promoter is the promoter PgpdAt.

In another embodiment, the overexpression comprises the step of introducing an additional copy of ATEG _08453 into aspergillus terreus.

In one embodiment, the "introduction" comprises constructing the gene of interest into an exogenous expression vector, and introducing the exogenous expression vector into Aspergillus terreus to overexpress ATEG-08453; preferably, the exogenous expression vector comprises pXH2-1, pXH43, pTRII, pGSF 957.

In another embodiment, the "introduction" comprises inserting the gene of interest into the genome of aspergillus terreus; preferably, the insertion into the genome of aspergillus terreus can adopt a homologous recombination double exchange method; in one embodiment, the target gene and the homology arm are inserted into a vector, then the vector is transferred into aspergillus terreus, and the homology arm and the aspergillus terreus genome are subjected to homologous recombination double exchange so as to insert the target gene into a proper genome position; in other embodiments, gene editing can also be used, for example, using the CRISPR/Cas system to cleave at a desired genomic site while inserting the gene of interest as an exogenous donor at the cleavage site.

In a preferred embodiment, when an additional copy of ATEG _08453 is inserted into the aspergillus terreus genome, the additional copy of ATEG _08453 is expressed under the action of a strong promoter; preferably, the strong promoter is the promoter PgpdAt.

In a preferred embodiment, the additional copy of ATEG _08453 is inserted into the aspergillus terreus genome at any position within the ku80 gene; in a preferred embodiment, the CDS region of ku80 gene is replaced with the additional copy of ATEG _08453 to achieve insertion of ATEG _08453 into the aspergillus terreus genome.

Furthermore, the gene engineering strain for producing emodin also comprises a mutant O-methyltransferase gene (gedA) in the aspergillus terreus.

Further, the starting strain is an aspergillus terreus strain with ku80 gene mutation.

Mutations described herein include means in which the function of a gene is at least partially inactivated by gene deletion, gene insertion, or gene substitution; in a preferred embodiment, the at least partial inactivation is a complete inactivation of gene function.

Further, the aspergillus terreus comprises aspergillus terreus ATCC20542, CICC40205, NIH2624, NRRL 1960.

further, the sequence of the promoter PgpdAt is shown as SEQ ID No. 1.

Further, the ATEG _08453 sequence includes an amino acid sequence shown as SEQ ID No. 5.

it is understood that the sequences according to the invention also include sequences having a high degree of homology with the sequence of interest, preferably at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% or 90% homology with the sequence of interest, without losing the activity of the prokaryotic nucleotide sequence or amino acid sequence.

On the other hand, the invention also provides a construction method of the genetic engineering strain.

further, the construction method includes the step of performing the objective gene mutation and/or the introduction of the foreign sequence in the original strain by a conventional method.

In one aspect, the construction method comprises the steps of replacing the original promoter of ATEG _08453 with a strong promoter; preferably, the strong promoter is the promoter PgpdAt.

In another aspect, the construction method comprises the step of introducing an additional copy of the ATEG 08453 gene into aspergillus terreus; in one embodiment, the introducing comprises the steps of constructing the ATEG _08453 gene into an expression vector, and then transferring the expression vector into aspergillus terreus; in other embodiments, the introducing comprises the step of inserting an additional copy of the ATEG 08453 gene into the aspergillus terreus genome. Preferably, the additional copy of the ATEG _08453 gene is expressed under the action of a strong promoter; the strong promoter is preferably the promoter PgpdAt, PcitA, PgpdA, PtrpC, Pgpk, Ppgmd.

The above promoters are all known in the art, for example PgpdAt is disclosed in journal literature Huang X et al cloning, characterization and application of a native glycerol dehydrogenase promoter for Aspergillus terreus J.Ind. Microbiol Biotechnol 2014,41: 585. 592. PcitA is disclosed in journal articles Huang X et al direct production of itranic acid from soluble corn stage by genetic engineered Aspergillus terreus Microbial cells efficiencies 2014,13:108, and journal articles Dave K et al Utility of Aspergillus niger citrate promoter or heterologous expression J Biotechnology 2011,155: 173-. The documents Kim JG et al, genetic transformation of Monascus purpureus DSM1379 Biotechnol Lett,2003,25: 1509-1514 disclose Pmgpd and Ptrp (i.e., PtrpC). PgpdA is disclosed in Punt PJ, et al, functional elements in the promoter region of the Aspergillus nidulans gpdA gene encoding glycerol-3-phosphate dehydrogenase, 1990,93: 101-. Ppgk is disclosed in the Nara, F.et al, cloning and sequencing of the 3-phosphoglycerate kinase (PGK) gene from Penicillium citrinum and its application to heterologous gene expression, Curr Genet,1993,23(2): 132-.

Kim JG et al.Genetic transformation of Monascus purpureus DSM1379.Biotechnol Lett,2003,25:1509–1514；；Prabha,VL et al.Genetic transformation in Aspergilli:tools of the trade.Indian J Biochem Biophys, 2004,41(5):205-215

Further, the construction method further comprises the step of mutating an O-methyltransferase gene (gedA) in Aspergillus terreus.

preferably, the amino acid sequence of the gedA is shown in SEQ ID No. 6.

On the other hand, the invention also provides the application of the gene engineering strain for producing emodin in the production of emodin.

Drawings

the accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this application, illustrate embodiment(s) of the application and together with the description serve to explain the application and not to limit the application. In the drawings:

FIG. 1 shows the BLAST analysis result (A) of ATEG-08452 and the sequence alignment result (B) thereof with the fungal secondary metabolic transcription activator mdpA.

FIG. 2, map of plasmids pXH2-1(A) and pXH-106(B)

FIG. 3 is a schematic diagram of construction of a transcription regulatory factor overexpression engineering strain, wherein A: constructing a strategy schematic diagram; TFs are transcription control genes to be over-expressed, namely ATEG _08438, ATEG _08442, ATEG _08452, ATEG _08453 and ATCC20542-OETFs are engineering strains for respectively over-expressing the transcription control factors; b: the genomic PCR validation with primer pair Uku80-F/Dku80-R showed DNAmarker M, the original strain ATCC 20542-apyrG in lane 1,

Lane 2 is the engineered strain ATCC20542-OE08438 overexpressing ATEG-08438,

Lane 3 is the engineered strain ATCC20542-OE08442 overexpressing ATEG-08442,

Lane 4 is the engineered strain ATCC20542-OE08452 overexpressing ATEG-08452,

lane 5 is the engineered strain ATCC20542-OE08453 overexpressing ATEG _ 08453.

FIG. 4 HPLC analysis of secondary metabolites of over-expression regulatory factor engineered and wild type strains

FIG. 5 shows the structure of emodin and emodin derivatives produced by fermentation of engineering strains

FIG. 6 is a schematic diagram of the replacement of the activation strategy by the ATEG _08453 promoter, in which: a: the transcription regulatory factor ATEG _08453 promoter replacement experiment strategy schematic diagram is shown, and ATCC20542-PR08453 is an engineering strain after promoter replacement; b: and (3) carrying out genome PCR verification by using a primer U-08453-F/D-08453-R pair, wherein M is DNAmarker, lane 1 is an original strain ATCC 20542-delta pyrG, b is a wild-type band, lanes 2 and 3 are engineering strains ATCC20542-PR08453 after the promoter is replaced, and a is a positive PCR band.

FIG. 7 HPLC analysis of secondary metabolites of regulatory factor ATEG _08453 promoter replacement engineered and wild type strains

FIG. 8 plasmid map of pDONR-ptrA

FIG. 9 plasmid map of pDONR-ptrA-gedA

FIG. 10 plasmid map of pDONR-ptrA-gedF

FIG. 11 PCR validation of knock-out gedA engineered strain ATCC20542-OE08453- Δ gedA

FIG. 12 PCR validation of the GedF knockout engineered strain ATCC20542-OE08453- Δ gedF

FIG. 13 HPLC analysis chart of emodin synthesized by fermentation of engineering strain ATCC20542-OE08453- Δ gedA

FIG. 14 shows comparison results of ultraviolet absorption analysis of emodin synthesized by engineering strain ATCC20542-OE08453- Δ gedA

FIG. 15 mass spectrum analysis of emodin synthesized by engineering strain ATCC20542-OE08453- Δ gedA

Detailed Description

The present invention will be described in further detail with reference to the following specific examples and drawings, and the present invention is not limited to the following examples. Variations and advantages that may occur to those skilled in the art may be incorporated into the invention without departing from the spirit and scope of the inventive concept, and the scope of the appended claims is intended to be protected. The procedures, conditions, reagents, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited. Such as described in Sambrook et al, molecular cloning, A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

IPM liquid medium: 60g/L glucose, 2g/L NH4NO3, 20mg/L (NH4)2HPO4, 20mg/L FeSO4, 0.4g/L MgSO4, 4.4mg/L ZnSO4, 0.5g/L corn steep liquor and the balance of deionized water, the pH value is 3.5, and autoclaving is carried out at 121 ℃ for 20 minutes.

enzymolysis liquid: 0.4g of cellulase (Sigma product, catalog No. C1184), 0.4g of lyase (Sigma product, catalog No. L1412), 0.2g of snailase (product of Biotechnology engineering, Shanghai, Ltd., catalog No. SB0870) were weighed out and dissolved in 50mL of a 0.6M aqueous solution of MgSO4, and sterilized by filtration through a 0.22 μ M sterile filter.

In the present invention, Plasmid Extraction was performed using the Plasmid Mini Kit I Kit (D6942-01) from OMEGA, DNA fragment recovery was performed using the Cycle-Pure Kit (D6492-01) from OMEGA, and Gel recovery was performed using the Gel Extraction Kit (D2500-01) from OMEGA.

PDB top agar: 24g/L of potato and potato culture medium PDB dry powder (product of BD company, catalog number: 7114771), 1.2M sorbitol, 4g/L of agarose and the balance of deionized water, sterilizing at 121 ℃ for 20 minutes under high pressure, and keeping the temperature at 48 ℃.

PDA flat panel: 39g/L of potato/potato medium PDA dry powder (product of BD company, catalog No. 633840), and the balance deionized water, was autoclaved at 121 ℃ for 20 minutes, and was cooled to about 60 ℃ to prepare a plate.

PDAS plate: 39g/L of potato/potato medium PDA dry powder (product of BD company, catalog No. 633840), 1.2M sorbitol, and the balance of deionized water, autoclaved at 121 ℃ for 20 minutes, and prepared into plates after cooling to about 60 ℃.

SMP seed Medium: 9g/L glucose, 10g/L sucrose, 1g/L yeast extract, 1g/L peptone, 1g/L sodium acetate, 0.04g/L KH2PO4, 0.1g/L MgSO4, 5g/L soybean meal, 1.5g/L calcium carbonate, pH6.8, and the balance deionized water, and autoclaving at 121 ℃ for 20 minutes.

SMP fermentation medium: 70g/L glucose, 20g/L sucrose, 1.5g/L yeast extract (product of Angel Yeast Co., Ltd., catalog number: FM888), 20g/L peptone, 7g/L sodium acetate, 0.5g/L KH2PO4, 0.5g/L MgSO4, 5g/L soybean meal, 5g/L calcium carbonate, 0.1mL/L natural killer, pH6.2, and the balance deionized water, and autoclaving at 121 ℃ for 20 minutes.

example 1 construction of high-efficiency Gene targeting platform for Aspergillus terreus

A strain of Aspergillus terreus ATCC20542 was studied, and this example was conducted in the same manner as in the example of patent publication No. ZL201510275491.5 except that "ZL 201510275491.5" of example 2 of the invention patent "A method and application of Gene targeting technique to Aspergillus terreus", KU80 of Aspergillus terreus ATCC20542 was knocked out, and Aspergillus oryzae ATCC20542- Δ ku80(ATCC20542, Δ ku80:: ptrA) having high gene targeting efficiency was constructed, and further, in example 5 of the patent application, a pyrG gene was knocked out to construct an undercarriage cell strain Aspergillus terreus ATCC20542- Δ pyrG (ATCC20542, Δ ku80:: ptrA, Δ pyrG) which was genetically transformed and selected based on uracil auxotrophy, except that the host strain was replaced with Aspergillus terreus ATCC 20542.

example 2 activation of the emodin biosynthetic pathway by regulatory factor overexpression in A.terreus ATCC20542

1) Construction of transcriptional regulatory factor-activated DNA elements

The following primers were designed and synthesized:

Uku80-F：5’-agcacaaacatattgatcagc-3’；

pyrGAn-R:5’-ggatcctcccagagtgtaagcatcaaatcgtcgtaccgca-3’；

trpC-F3:5’-aagcttgagatccacttaacgttactgaaatcatc-3’；

Dku80-R:5’-gaaggcgaaaagtagtctcgtg-3’；

PgpdAt-F743:5’-ttacactctgggaggatccaggtac-3’；

PgpdAt-R1:5’-tgtgatgattgatgagttgttg-3’。

To amplify the DNA sequences of the transcriptional regulators ATEG _08438, ATEG _08442, ATEG _08452, and ATEG _08453, primers were designed as follows:

08438-F：ACAACTCATCAATCATCACATGTCTGTCCAGAAACGCGCAC,

08438-R：GTTAAGTGGATCTCAAGCTTCACAGACTGGCTGGTCTTGGG；

08442-F：ACAACTCATCAATCATCACATGTTCATCACACTGAAATGTC，

08442-R：GTTAAGTGGATCTCAAGCTTCTACGGATGGCTCACGGCAAA；

08452-F：ACAACTCATCAATCATCACATGCTGCTGTGTGATTCCCTTAG,

08452-R：GTTAAGTGGATCTCAAGCTTTTAGAACGAAGATGGCAACGCG；

08453-F：ACAACTCATCAATCATCACATGTCTGCAGAAGGACACAAGC，

08453-R：GTTAAGTGGATCTCAAGCTTTATTCTGCTAATTGCAACATC。

PCR was performed using the genomic DNA of Aspergillus terreus ATCC20542 as a template and primer sets 08438-F/08438-R, 08442-F/08442-R, 08452-F/08452-R, and 08453-F/08453-R, respectively, to obtain DNA fragments of genes ATEG _08438, ATEG _08442, ATEG _08452, and ATEG _ 08453. The amino acid sequences of the genes ATEG _08438, ATEG _08442, ATEG _08452 and ATEG _08453 are shown as SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5 respectively.

Among them, ATEG _08453, ATEG _08442 and ATEG _08438 are zn (ii)2Cys6 transcription factor-like regulatory factors, and the BLAST analysis of ATEG _08452 showed a high similarity to two fungal secondary metabolite regulatory factors (fig. 1).

The upstream homology arm Uku80-pyrGAN and the downstream homology arm TtrpC-Dku80 were obtained by PCR using plasmids pXH-106 (map shown in FIG. 2) as templates and primer pairs Uku80-F/pyrGAN-R and TtrpC-F3/Dku80-R, respectively. The plasmid pXH2-1 (map is shown in FIG. 2) is used as a template, PCR amplification is carried out by using a primer pair PgpdAt-F743/PgpdAt-R1, and a promoter PgpdAt is obtained, wherein the sequence of the promoter PgpdAt is shown in SEQ ID No. 1.

Uku80-pyrGAN, promoter PgpdAt, regulatory factor gene (ATEG _08438 or ATEG _08442 or ATEG _08452 or ATEG _08453) and TtrpC-Dku80 are fused by using a fusion PCR method, and C-ku80-F3 (5'-ttccagagacgaatgactaacaag-3') and C-ku80-R3 (5'-gcgaaaggatcttgtgatcaatgc-3') are subjected to PCR amplification by using primers as templates to obtain targeting elements Uku80-pyrGAN-Pgpd At-08452, ATEG _08452 and ATEG _08453, Uku 80-pyrGAN-Pgpd-08442-TtrpC-Dku 80, Uku 80-pyrGAN-Pgpd-08452-TtrpC-Dku 80, Uku 80-pyrGAN-Pgpd-08452-TtrpC-Dku 80 and Uku 80-pyrGAn-AtrpC-08 Dku80 of over-expression regulatory factors.

As shown in FIG. 3A, the fragment can be homologously recombined at the ku80 gene site by using upstream and downstream homology arms Uku80 and Dku80, and expression elements of four regulatory factors are respectively introduced, so that overexpression of the regulatory factors (ATEG _08438, ATEG _08442, ATEG _08452, and ATEG _08453) by using a strong promoter PgpdAt is respectively realized.

2) Construction of over-expression regulation factor aspergillus terreus engineering strain

A protoplast suspension of the engineered strain ATCC20542- Δ pyrG was prepared by the method described in the example of patent ZL201510275491.5, and 10. mu.l of the DNA fragment Uku80-pyrGAN-PgpdAt-08453-TtrpC-Dku80 (about 2. mu.g) was added to 150. mu.l of the protoplast suspension. Then 50. mu.l of ice-bath PSTC was added, mixed gently and ice-cooled for 30 min. Adding 1mL of PSTC at normal temperature, mixing uniformly, and standing at room temperature for 20 min. Then mixed with 30mL of PDB top agar and poured onto 10 blocks of PDAS, and incubated at 30 ℃ for 5-7 days.

selecting transformants to be transferred on a PDA (personal digital assistant) plate for passage purification twice, selecting 4 transformants with stable passage for monospore separation and purification, selecting obtained monospore colony spores to be inoculated in 5mL of IPM liquid culture medium, culturing at 30 ℃ and 200rpm for 48 hours, and collecting hyphae to extract genome DNA. PCR validation was performed with primers Uku80-F/Dku80-R, while the genome of ATCC20542- Δ pyrG strain was used as a control. Theoretically, the genomic DNA of ATCC20542- Δ pyrG should amplify a band of about 4.1kb as a template, and the genomic DNA of candidate transformants, which have regulatory element expression elements integrated, should amplify a band of about 7.0kb-kb (Uku 80-pyrGAN-PgpdAt-regulatory element-TtrpC-Dku 80). As shown in FIG. 3B, lanes 2, 3, 4 and 5 are engineered strains incorporating expression elements of the regulatory factors ATEG _08438, ATEG _08442, ATEG _08452 and ATEG _08453, respectively, and are designated ATCC20542-OE08438, ATCC20542-OE08442ATCC20542-OE08452 and ATCC20542-OE08453, respectively.

Example 3 analysis of emodin and emodin derivatives produced by fermentation of engineered strains

the constructed engineered strains ATCC20542-OE08438, ATCC20542-OE08442ATCC20542-OE08452, ATCC20542-OE08453 and the control strain ATCC 20542-delta ku80 were inoculated to PDA solid plates, respectively, and cultured at 30 ℃ for 7 days to obtain spores. The spores were inoculated into 35mL of SMP seed medium (250mL Erlenmeyer flask) and cultured with shaking at 28 ℃ and 22rpm for 48 hours. 3.5mL of the seed solution was inoculated into 50mL of a fermentation medium (250mL triangular flask) of LSMP, and shake-cultured at 28 ℃ and 220rpm for 8 days to obtain fermentation broth of each strain.

And (2) analyzing and comparing the fermented crude extract, after the fermentation is finished, separating the thalli and bacterial liquid by using 200-mesh nylon cloth, soaking the thalli for three times by using dichloromethane and methanol (V/V1: 1), ultrasonically extracting the bacterial liquid for three times by using equal-volume ethyl acetate through soaking and stirring, combining organic phases, performing reduced pressure concentration to obtain the crude extract, dissolving the crude extract by using methanol to prepare a solution of 100mg/ml, filtering the solution by using a 0.22-micron filter membrane, and analyzing the crude extract by using an HPLC (high performance liquid chromatography) analysis method, wherein the analysis method comprises the following: mobile phase A (100% H2O + 0.05% FA) mobile phase B (100% ACN + 0.05% FA), gradient elution, 95-76% A for 0-5min, 76-38% A for 5-35min, 38% A for 35-50min, 38-0% A for 50-55min, 0-95% A for 55-60min, and 95% A for 60-65 min. Analytical column (Agilent ZORBAX Eclipse XDB-C184.6mm. times.150 mm 5 μm), flow rate 1ml/min, detection wavelength 250nm ]. HPLC analysis showed that the fermentation products of the engineered strains overexpressing the regulators ATEG _08438, ATEG _08442, and ATEG _08452 were not significantly changed compared to the control strain, while overexpression of ATEG _08453 gave a significant increase in the number of new compound absorption peaks (FIG. 4). The structures of the newly added compounds in the fermentation liquor of the engineering strain ATCC20542-OE08453 are analyzed, and the compound 8 is emodin, and other compounds are derivatives of the compound 8 (figure 5). This indicates that overexpression of ATEG _08453 successfully activates the emodin synthesis pathway, whereas overexpression of several other regulatory factors did not have this effect.

Separating and purifying metabolites of engineering strains ATCC20542-OE08453, extracting and concentrating an organic phase after strain fermentation is finished to obtain a crude extract, mixing the crude extract and silica gel according to a mass ratio of 1:5-10, then loading the crude extract and normal phase silica gel (200 meshes and 300 meshes) into a column according to a height ratio of 1:3-5, and performing reduced pressure silica gel column chromatography to obtain four components (Fr.1-Fr.2) by adopting a gradient elution mode of 10% ethyl acetate-petroleum ether, 50% ethyl acetate-petroleum ether, 60% ethyl acetate-petroleum ether and 100% ethyl acetate-petroleum ether (the percentages are expressed as 10% ethyl acetate-petroleum ether and refer to the volume fraction of ethyl acetate in the petroleum ether solution); the Fr.1 component is subjected to reverse phase reduced pressure silica gel column chromatography, and gradient elution with 30% acetonitrile-water, 40% acetonitrile-water, 70% acetonitrile-water and 100% acetonitrile (the percentages are expressed as 30% acetonitrile-water and refer to the volume fraction of acetonitrile in water) is adopted to obtain four components (Fr.1.1-Fr.1.4), wherein the Fr.1.2 component is subjected to semi-preparative liquid phase separation (elution method 45% acetonitrile (0.05% formic acid) -55% water (0.05% formic acid)) to obtain compounds 6 and 7 respectively at retention time of 4.9min and 5.8min, and the Fr.1.3 component is subjected to 20% ethyl acetate-petroleum ether silica gel column chromatography to obtain compound 8. The fr.2 fraction was eluted with 30% acetonitrile-water reduced pressure reverse phase silica gel column and then with normal phase silica gel column chromatography using a gradient (20% ethyl acetate-petroleum ether, 40% ethyl acetate-petroleum ether and 100% ethyl acetate-petroleum ether) to obtain three fractions (fr.2.1-fr.2.3) wherein the fr.2.2 fraction was subjected to semipreparative liquid phase separation (elution method 33% acetonitrile (0.05% formic acid) -67% water (0.05% formic acid)) at retention times of 7.5min and 12.4min to obtain compounds 4 and 5, respectively, and the fr.2.3 fraction was subjected to semipreparative liquid phase separation (gradient method: 0-10min 70% -55% a, 10-10.1min 55% -70% a, 10.1-12min 70% a. wherein a: water (0.05% formic acid), B: acetonitrile (0.05% formic acid)) at retention time of 7.0min to obtain compound 3. The Fr.3 fraction was subjected to gradient elution with reverse-phase reduced pressure silica gel column chromatography (40% methanol-water, 60% methanol-water and 100% methanol) to obtain three fractions (Fr.3.1-Fr.3.3), wherein the Fr.3.1 fraction was further subjected to reverse-phase silica gel column chromatography using 20% acetonitrile-water, and then separated with a semi-preparative liquid phase (25% acetonitrile (0.05% formic acid) -75% water (0.05% formic acid)) for a retention time of 4.6min to obtain Compound 1, and wherein the Fr.3.2 fraction was further subjected to reverse-phase silica gel column chromatography using 20% acetonitrile-water to obtain Compound 2.

As shown in fig. 5, compound spectral data are as follows:

Hydroxysulochrin(1),HREISMS m/z calculated for CHO 347.0772, experimental 347.0775[M-H]H NMR(acetone-d,600MHz)δ3.66(3H,s),3.69(3H,s), 4.51(2H,s),6.37(2H,s),6.74(1H,s),7.02(1H,s)；C NMR(acetone-d,150MHz)δ51.3, 55.6,63.1,100.0,103.2,104.5,107.6,110.4,127.2,128.7,151.8,157.4,158.2,165.8, 200.0。

ω-Hydroxyemodin-5-methylether(2),HREISMS m/z calculated for CHO299.6561,experimental 299.0562[M-H].1H NMR(acetone-d,600MHz)δ3.99(3H, s),4.78(2H,s),6.95(1H,d,J＝2.4Hz),7.28(1H,d,J＝1.2Hz),7.35(1H,d,J＝2.4Hz), 7.69(1H,d,J＝1.2Hz),13.38(1H,s).C NMR(DMSO-d,150MHz)δ56.7,62.4,105.4,107.5, 112.9,115.5,116.3,121.4,132.5,137.2,151.6,162.1,163.9,165.1,182.8,186.8。

Monomethylosoic acid(3),HREISMS m/z calculated for CHO 333.0616, experimental 333.0619[M-H]H NMR(acetone-d,600MHz)δ2.16(3H,s),3.81(3H,s), 5.92(1H,s),6.47(1H,s),6.94(1H,s),7.12(1H,s)；C NMR(acetone-d,150MHz)δ22.0, 56.7,100.8,105.6,106.0,109.6,112.4,125.8,134.9,147.8,154.8,156.9,159.3,163.9, 166.4,171.5。

Thiaochracin, Sulochrin (4), hreissm/z calculated for C17H15O7331.0823, experimental 331.0829[ M-H ] -1H NMR (acetone-d6,600mhz) δ 2.18(3H, s),3.65(3H, s),3.69(3H, s),6.18(2H, s),6.72(1H, d, J ═ 1.8Hz),7.01(1H, d, J ═ 1.8 Hz); 13C NMR (acetone-d6,150MHz) delta 21.9,52.2,56.4,104.0,108.5,108.7,110.5,128.0,129.6,148.2,158.3,159.0,162.9,166.7,200.7.

Kojic acid, Asterric acid (5), HREISMS M/z calculated for C17H15O8347.0772, experimental 347.0771[ M-H ] -1H NMR (acetone-d6,600MHz) delta 2.16(3H, s),3.73(3H, s),3.81(3H, s),5.90(1H, s),6.47(1H, s),6.94(1H, s),7.04(1H, s); 13C NMR (acetone-d6,150MHz) delta 22.0,152.7,56.7,100.8,105.6,106.1,109.3,112.5,125.7,134.7,147.6,154.8,156.9,159.5164.2,165.7,171.7.

Questin(6),HREISMS m/z calculated for CHO 283.0612,experimental 283.0613[M-H]H NMR(acetone-d,600MHz)δ2.44(3H,s),3.98(3H,s),6.93(1H,d,J＝ 2.4Hz),7.10(1H,d,J＝1.2Hz),7.35(1H,d,J＝2.4Hz),7.49(1H,d,J＝1.2Hz),13.33(1H, s)；C NMR,(CDOD,150MHz)δ21.9,26.9,105.7,108.4,114.6,116.0,120.6,125.4,134.0, 138.9,148.3,163.7,165.2,166.3,184.1,188.7。

Ethyl asterrate(7),HREISMS m/z calculated for CHO 375.1085, experimental 375.1082[M-H]H NMR(acetone-d,600MHz)δ1.32(3H,t,J＝6.6Hz),2.12 (3H,s),3.65(3H,s),3.76(3H,s),4.40(2H,q,J＝6.6Hz),5.86(1H,s),6.37(1H,s),6.83 (1H,s),6.90(1H,s)；C NMR,(acetone-d,150MHz)δ14.5,21.9,52.3,56.6,61.9,102.3, 105.6,106.7,108.7,111.1,127.1,136.0,146.4,154.7,156.0,161.0,163.5,166.2, 171.7。

Emodin, Emodin (8), HREISMS M/z calculated for C15H9O5269.0455, experimental 269.0460[ M-H ] -1H NMR (acetone-d6,600MHz) delta 2.45(3H, s),6.66(1H, s),7.11(1H, s),7.24(1H, s),7.53(1H, s),12.06(1H, s),12.16(1H, s); 13C NMR, (acetone-d6,150MHz) delta 22.0,108.9,109.9,110.3,114.5,121.5,124.9,134.3,136.6,149.5,163.3,166.3,166.8,182.2,191.7.

Example 4 activation of the emodin biosynthetic pathway in A.terreus by replacement of the promoter of ATEG-08453

1) Construction of promoter replacement DNA element of ATEG _08453

Primers were designed as follows:

U08453-F：AGATGCCCGAGCGGGCATTGC

U08453R：GGATCCTCCCAGAGTGGTAAGCCGATTTCCACCATACGTAGAC

D08453-F：ACAACTCATCAATCATCACATGTCTGCAGAAGGACACAAGC

D08453-R：CTATTCTGCTAATTGCAACATC

C08453-F：CTGCGCTACGTTTCGTTGTACAG

C08453-R：GATGGTCCATCACGATCGTTGAG

pyrGAn-F：TAAGGGAGATGGTGATTGAACTAG

PgpdAt-R1：TGTGATGATTGATGAGTTGTTG

PCR amplification was carried out using the genomic DNA of Aspergillus terreus ATCC20542 as a template and the primer pair U08453-F/U08453-R, D08453-F/D08453-R, respectively, to obtain upstream and downstream homologous arm fragments U08453 and D08453 required for promoter replacement. The DNA fragment Uku80-pyrGAN-PgpdAt-08453-TtrpC-Dku80 constructed above was used as a template, and PCR was performed with the primer pyrGAN-F/PgpdAt-R1 to obtain a DNA fragment pyrGAN-PgpdAt carrying the pyrGAN selection marker and PgpdAt promoter. U08453, pyrGAN-PgpdAt and D08453 were fused by fusion PCR, and C08453-F/C08453-R was PCR-amplified with primers using the fusion product as a template to obtain the gene targeting element U08453-pyrGAN-PgpdAt-D08453 required to replace the original promoter of ATEG _08453 with the strong promoter PgpdAt.

Protoplasts of the engineered strain ATCC20542- Δ pyrG were prepared as described in example 2 and protoplast transformation was accomplished by adding the gene targeting element U08453-pyrGAN-PgpdAt-D08453. Selecting transformants to be transferred on a PDA (personal digital assistant) plate for passage purification twice, selecting 4 transformants with stable passage for monospore separation and purification, selecting obtained monospore colony spores to be inoculated in 5mL of IPM liquid culture medium, culturing at 30 ℃ and 200rpm for 48 hours, and collecting hyphae to extract genome DNA. PCR validation was performed with primers U08453-F/Dku80-R, while the genome of ATCC20542- Δ pyrG strain was used as a control. Theoretically, the genomic DNA of ATCC20542- Δ pyrG should amplify a band of about 2.5kb, and the genomic DNA of the promoter-replacement transformant should amplify a band of about 4.4 kb. As a result, as shown in FIG. 6B, the candidate transformants in lanes 2 to 3 were all positive transformants having the original promoter of ATEG-08453 replaced with the promoter of PgpdAt and were designated as ATCC20542-PR 08453.

The fermentation analysis was carried out on the engineered strain ATCC20542-PR08453 with reference to example 3, and the HPLC analysis results of the fermentation products showed that ATCC20542-PR08453 showed the same results as ATCC20542-OE08453 and absorption peaks of emodin and derivatives thereof were observed in comparison with the control strain ATCC20542- Δ ku80 (FIG. 7). This shows that the transcription expression of the regulatory factor ATEG _08453 promoter can be replaced to activate the emodin biosynthetic pathway and lead the emodin biosynthetic pathway to synthesize emodin or derivatives thereof.

Example 5 construction and fermentation analysis of an emodin-accumulating engineering Strain

13 genes exist in a terramycin biosynthesis gene cluster of aspergillus terreus, and the O-methyltransferases GedA and GedF in the genes are probably related to the metabolism of emodin through bioinformatics prediction; the inventor probably can construct an aspergillus terreus strain capable of accumulating emodin by genetic manipulation of the two genes.

1) Knockout of O-methyltransferase gedA gene and oxidoreductase gedF gene in A.terreus

1.1) using the genome of aspergillus terreus ATCC20542 as a template, carrying out PCR amplification by using specific primers gedA up F and gedA up R to obtain a gedA (ATEG _08449) upstream homologous arm, and carrying out PCR amplification by using specific primers gedA down F and gedA down R to obtain a gedA (ATEG _08449) downstream homologous arm; the upstream homology arm of gedF (ATEG _08455) is obtained by PCR amplification with specific primers gedF up F and gedF up R, the downstream homology arm of gedF (ATEG _08455) is obtained by PCR amplification with specific primers gedF down F and gedF down R, and all fragments are purified by using the OMEGA Cycle Pure Kit (the method is referred to the Kit instruction). The amino acid sequences of the genes ATEG _08449 and ATEG _08455 are respectively shown as SEQ ID No.6 and SEQ ID No. 7. The nucleotide sequence of the specific primer is as follows:

gedA up F：

TAGGGATAACAGGGTAATTTCCAGTAACGGTCAGCAGCCTAT；

gedA up R：

GGGGACAAGTTTGTACAAAAAAGCAGGCTAACTCTGATCTGTCTGGAGCCTGTTT；

gedA down F：

GGGGACCACTTTGTACAAGAAAGCTGGGTATTCTCCAAATGCGTTGTTGTCCAG；

gedA down R：

ATTACCCTGTTATCCCTAAACTTTGTCATCACCGAGCCTACA；

gedF up F：

TAGGGATAACAGGGTAATCGCTGCGGATCTACTTGAACCAG；

gedF up R：

GGGGACAAGTTTGTACAAAAAAGCAGGCTAAAGCCAGGGATATTATCATTGGTCGA；

gedF down F：

GGGGACCACTTTGTACAAGAAAGCTGGGTATGGTTCCGTTCCAAGTTGTGATTC；

gedF down R：

ATTACCCTGTTATCCCTATGTAGACTGACCACCTCCACTCCC；

The PCR reaction conditions were as follows:

Pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 1-2 min, and reaction for 30 cycles; final extension at 72 deg.C for 10 min;

The PCR reaction system is as follows:

The upstream homology arm of the gedA obtained by PCR amplification is a 1.15kb fragment of the upstream of the ORF of the gene, and the concentration is 212 ng/mu l; the downstream homology arm of gedA was a 1.39kb fragment downstream of the ORF of the gene at a concentration of 202 ng/. mu.l.

The upstream homology arm of the gedF obtained by PCR amplification is a 1.06kb fragment of the upstream of the gene ORF, and the concentration is 182 ng/mu l; the downstream homology arm of gedF is a 1.23kb fragment downstream of the ORF of the gene at a concentration of 168 ng/. mu.l.

1.2) connecting the upstream and downstream homology arms prepared in step 1.1 to pDONR TM221 vector (Invitrogen) with ptrA selection marker by using BP colne reaction kit (figure 8) according to the instruction of Invitrogen, picking up the transformant that can grow on a Km resistance plate to culture in a liquid medium for 18h, extracting the plasmid by using OMEGA plasmid extraction kit (method is shown by the instruction of kit), detecting the plasmid lag condition by 1% agarose gel electrophoresis, selecting the lagged plasmid for PCR verification, and simultaneously amplifying the plasmid with the upstream and downstream homology arms, namely the plasmid with Δ gedA: ptrA (shown in figure 9) or Δ gedF: ptrA (shown in figure 10) knockout box which is successfully constructed;

1.3) performing PCR amplification using the plasmid containing the Δ gedA: ptrA knockout cassette obtained in step 1.2 as a template and the specific primers A up F and A down R to obtain a gedA knockout fragment; the plasmid containing the Δ gedF: ptrA knockout cassette obtained in step 1.2 was used as a template for PCR amplification with the specific primers F up F and F down R to obtain the gedF knockout fragment. All knockout fragments obtained by PCR amplification were purified using the OMEGA's Cycle Pure Kit (methods refer to Kit instructions). The nucleotide sequence of the specific primer is as follows:

A up F：TTCCAGTAACGGTCAGCAGCCTAT；

A down R：AACTTTGTCATCACCGAGCCTACA；

F up F：CGCTGCGGATCTACTTGAACCAG

F down R：TGTAGACTGACCACCTCCACTCCC

The PCR reaction conditions were as follows:

pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 7-8 min, and reaction for 30 cycles; final extension at 72 deg.C for 10 min;

The PCR reaction system is as follows:

The Δ gedA: ptrA knockout cassette obtained by PCR amplification was 6.7kb in length and at a concentration of 150 ng/. mu.l; Δ gedF: ptrA knockout cassette is a 6.6kb fragment in length and at a concentration of 120 ng/. mu.l.

1.4) Using the A.terreus ATCC20542-OE08453 constructed in example 2 as the starting strain, the gedA and gedF genes were knocked out, respectively, using the Δ gedA: ptrA knockout cassette and the Δ gedF: ptrA knockout cassette fragment obtained by PCR amplification in step 1.3, according to the protoplast transformation procedure described in example 2. Colonies that germinated on PDA regeneration medium plates containing 0.1mg/ml pyridylthioamine were picked and subjected to colony PCR verification using the Thermo Scientific Phe Plant Direct PCR Kit (method see Kit instructions). And performing upstream and downstream anchoring verification on the gedA knockout transformant by respectively using gedA upF/pDONR-ptrA F and gedA an downR/pDONR-Km R as primers, and performing upstream and downstream anchoring verification on the gedF knockout transformant by using gedF an upF/pDONR-ptrA F and gedF an downR/pDONR-Km R as primers. The nucleotide sequence of the specific primer is as follows:

gedA an upF：GTATTCCTGAATGGACGGATCTCA

gedA an downR：TCCGTACTCTTAGCACGTATGTCG

pDONR-ptrA F：AGTAAATGACTCACTACCCGAATG

pDONR-Km R：CAGCCAGTTTAGTCTGACCATCTC

gedF an upF：CATCCGTGGACATGGTCTTTGTGA

gedF an downR：CCATCCTCCGTCTGAATGATCTTCT

Theoretically, genomic DNA from ATCC20542-OE08453 should not amplify any band, while the gedA knock-out was successful and the upstream and downstream anchors should amplify bands of about 1.5kb and 1.4kb, respectively. The results are shown in FIG. 11, and 10 of the 11 transformants picked gave the expected anchor band, indicating that the gedA gene had been successfully knocked out, and this engineered strain was designated ATCC20542-OE08453- Δ gedA; if the gedF knockout is successful, the upstream and downstream anchorages should amplify bands of about 1.8kb and 1.6kb, respectively. As a result, as shown in FIG. 12, 8 of the 11 transformants picked obtained the expected anchor band, indicating that the gedF gene had been successfully knocked out, and the engineered strain was designated ATCC20542-OE08453- Δ gedF.

2) fermentation analysis of the ability of the engineered strains ATCC20542-OE08453- Δ gedA and ATCC20542-OE08453- Δ gedF to synthesize emodin

2.1) inoculating 107 spores of the constructed engineering strains ATCC20542-OE08453- Δ gedA, ATCC20542-OE08453- Δ gedF and the control strain ATCC20542-OE08453 respectively in an Aspergillus terreus SMP culture medium, and performing shake culture at 30 ℃ and 220rpm/min for 8 days to obtain fermentation liquor of each strain. 1ml of fermentation liquor is extracted for three times by ethyl acetate, then the extraction liquid is dried by nitrogen, and after being redissolved by methanol, the fermentation liquor is waited for further analysis.

2.2) analysis of the extracted compounds of step 2.1 was performed using Agilent 1260HPLC on an Agilent Eclipse Plus C18 column (5 μm,4.6 mm. times.250 mm). The analysis method is as follows: mobile phase a (100% H2O + 0.05% FA), mobile phase B (100% ACN + 0.05% FA), gradient elution (0-5min 95-76% a, 5-35min 76-38% a, 35-50min 38% a,50-55min 38-0% a,55-60min 0-95% a,60-65min 95% a.), flow rate of 1ml/min, detection wavelength of 250 nm. As shown in FIG. 13, the fermentation product of the engineered strain ATCC20542-OE08453- Δ gedA showed a peak consistent with the retention time of the emodin standard. Further research shows that the ultraviolet absorption peak of the compound is completely consistent with that of an emodin standard product as shown in figure 14. This compound was not present in the ATCC20542-OE08453- Δ gedF fermentation product.

2.3) the compounds suspected of emodin in ATCC20542-OE08453- Δ gedA fermentation products were analyzed by anion high resolution mass spectrometry, as shown in FIG. 15, where M/z was 269.0454(([ M-H ] -, formula [ C15H9O5] -), consistent with the mass spectrometry of emodin anions (269.0449).

The above description is only an example of the present application and is not intended to limit the present application. Various modifications and changes may occur to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Sequence listing

<110> institute of bioenergy and Process in Qingdao, China academy of sciences

<120> gene engineering strain for producing emodin and construction method and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 743

<212> DNA

<213> Aspergillus terreus

<400> 1

ttacactctg ggaggatcca ggtacttcca ttcttactag gaagtatttc ggcctagact 60

aatacaacga aagaaactgt tcgattctac gggaaaagta ctccaattcc attacatcat 120

cgcattctcc ctctcgtaag gtacctacca caaaccccca ctatcgttca tccgtccccg 180

gttacaacgg gaagaaaaag cccggggaga gggggaagaa gaaaatccca agggacggga 240

atagccgtgc ggaagagaag acgattagcc taggtagaag cctcatggcc gaccatttga 300

ttccgaaaag ctggcaaaac attcacgaga tagacacagt gaggacccgg acgatgccct 360

atgcggcgcg ctgattggcc aggccgggca gtgccgaagc agcaaatatc gtgagtctcc 420

tgctttgccc ggtgtatgaa accggaaagg gttgctgggg agctggtcag cggcgcaagc 480

cgggagggcg actgagctct gtagcttttg ccccgtctgt ccgtccggtg tagagtggca 540

gaccaccgcc tgctgcgcct cccattgggt cttccccaac gtgactgggt cgttgcgtca 600

gtccatgtcg ctgccttttt cttcctcccc ctcccccgct gtccttcttc ttcttcttct 660

tctctctttc tcccatcatc ctctcatcct ctgcctttcc catcgaactc acttcttcta 720

ccaacaactc atcaatcatc aca 743

<210> 2

<211> 841

<212> PRT

<213> Aspergillus terreus

<400> 2

Met Ser Val Gln Lys Arg Ala Pro Ala Arg Thr Gln Gly Ser Arg Ile

1 5 10 15

Arg Arg Gln Asn His Ser Cys Asp Gln Cys Arg Arg Ser Lys Arg Ala

20 25 30

Cys Asp Ala Gln Trp Pro Ser Gln Thr Arg Arg Ala Ser Phe Asp Asn

35 40 45

Val Asp Ser Arg Arg Ser Pro Cys Ser Tyr Cys Ala Lys Thr Asn Lys

50 55 60

Arg Cys Thr Met Glu Trp Ala Gln Ser Lys Val Gln Ser Val Leu Asn

65 70 75 80

Ser Leu Ser Gln Gln Pro Asn Ser Glu Cys Leu Ser Gly Glu Pro Leu

85 90 95

Val Pro Pro Phe Glu Ala Asp Glu Ser Tyr Leu Glu Ala Gly Ser Gly

100 105 110

Thr Trp Asp Asp Leu Leu Arg Ser Asn Pro Ala His Glu Met Met Ala

115 120 125

Trp Glu Pro Ala Arg Leu Asp Leu Pro Gly Ser Leu Thr Thr Cys Asp

130 135 140

Arg Val Leu His Asn Pro Met Leu Ser Asp Ser Glu Ala Ala Gln Glu

145 150 155 160

Ala Gln Thr Glu Val Pro Ala Thr Phe Thr Ser Ala His Ser Leu Ser

165 170 175

Asp Phe Leu Pro Ser Glu Leu Ser Asp Ala Ser Asp Ile Ser Thr Gln

180 185 190

Gln Leu Ser Asp Leu Glu Phe Asp Pro Met Cys His Gln Ile Trp Pro

195 200 205

Ala Ser Arg Ala Ser Gln Thr Ser Gln Ala Tyr Ser Asn Leu Gln Ser

210 215 220

Thr Ser Ser Lys Ser Pro Trp Gln Leu Glu Glu Ser Ala Gln Leu Phe

225 230 235 240

Ser Asn Lys Gln Cys Ser Arg Trp Ser Val Thr Gln Tyr Ser Leu Ser

245 250 255

Pro Phe Ser Ile Asp Gln Gln Leu Ile Ser Thr Thr Asn His Gln Leu

260 265 270

Thr Ser Ala Asn Leu Leu Gln Ile Tyr His Asp Val Leu Glu His Asn

275 280 285

Leu Ser Cys Trp Leu Thr Glu Met Thr Cys Pro Tyr Leu Pro Arg Ser

290 295 300

Arg Ser Pro Ala Lys Val Val Pro Glu Trp Gly Ser Ser Trp Ser Asn

305 310 315 320

Arg Ile Tyr Gln Arg Thr Ile Lys Leu Asp Arg Val Ala Gln Ser Cys

325 330 335

Gln Leu Leu Arg Leu Thr Arg Ser Glu Asp Arg Ala Ala Ser Lys Ala

340 345 350

Leu His Leu Ala Ile Met Ala Phe Ala Thr Gln Trp Ala Gln Gly Ser

355 360 365

His Arg Gln Arg Glu Lys Tyr Ser His Arg Ser Leu Asn His Ala Gly

370 375 380

Asp Glu Ile Ala Asp Gly Ile Thr Gly Glu Phe Asp Gln Ile Leu Arg

385 390 395 400

Asn Tyr Phe Trp Asp Gln Ala His His Ala Leu Glu Gln Val Ser Glu

405 410 415

Val Glu Ser Tyr Arg Val Ala Cys Ala Glu Leu Ile Phe Gly Leu Thr

420 425 430

Gln Arg Pro Cys Asn Ala Asp Asn Gln Ser Leu Glu Pro Gln Ile Glu

435 440 445

Ala Arg Tyr Arg Lys Phe Ala Ile Asp Ser Val Met Ser Gln Val Arg

450 455 460

Asp Ile Ile Arg Arg Glu Gly Pro Pro Arg Tyr Met Glu Ser Ala Ala

465 470 475 480

Arg Lys Met His Ala Leu Lys Tyr Arg Cys Asp Ala Tyr Glu Lys Gly

485 490 495

Leu Gly Lys Gln Arg Gly Ser Arg Glu Lys Asp Ala His Gly Ile Ala

500 505 510

Ala Met Ser Ser Glu Asp Arg Ala Thr Ile Gly Leu Leu Tyr Trp Leu

515 520 525

Ala Ile Met Phe Asp Thr Ile Ser Ser Ser Met Asn Glu Arg Pro Val

530 535 540

Val Val Val Asp Glu Glu Cys Glu His Glu Ala Gln Lys Glu Lys Gln

545 550 555 560

Lys Ile Ala Lys Met Asp Gln Ala Leu Val Arg Gly Arg Trp Asn Leu

565 570 575

Glu Leu Leu Ile Gln Gly Ser Val Asp Asn Thr His Gln Thr His Trp

580 585 590

Pro Cys Ser Tyr Glu Ala Ala Ala Glu Asp Val Ile Lys Ser Ala Pro

595 600 605

Val Lys Val Leu Ile Phe Arg His Leu Ser Tyr Leu Gln Asn Ala Val

610 615 620

Arg Lys Gly Ser His Glu Gly His Ile Glu Asp Ile Ile Ser Ser Thr

625 630 635 640

Met Ser Leu Tyr His Tyr Trp Asn Lys Thr His Gly Ala Phe Phe Gly

645 650 655

Glu Leu Val Gln Asn Tyr Ser Ala Val Pro Gln Arg Ile Gln Gly Trp

660 665 670

Phe Val Cys Ile Ser Ala His Trp His Leu Ala Ala Leu Leu Leu Ala

675 680 685

Asp Leu Leu Asp Phe Ile Asp Glu Asn Ala Leu Gly Met Glu Asp Ala

690 695 700

Thr Cys Asn Arg Arg Thr Ser Gln Met Ala Trp Arg Ile Arg Lys His

705 710 715 720

Ser Ala Arg Glu Leu Ser Asp Leu Ala Arg Val Ala Thr Pro Pro Asp

725 730 735

Gly Asp Ile Asn Leu Gly Val Pro Gln Met Pro Asp Phe His His Ala

740 745 750

Val Asn Glu Gly Thr Leu Leu Thr Glu Pro Trp Thr Met Leu Leu Ile

755 760 765

Arg Ala Phe Thr Thr Ala Ser Thr Val Leu Leu Gly Glu Ala Asp Glu

770 775 780

Thr Leu Arg Tyr Asp Glu Ser Thr Leu Gly His Asn Ser His Asp Phe

785 790 795 800

Glu Arg Ile Met Glu Arg Ala Glu Asp Cys Val Lys Gly Leu Trp Leu

805 810 815

Leu Gly Lys Lys Ser Asp Met Ala Arg Met Ile Ala Asp Thr Leu Ser

820 825 830

Leu Ala Leu Gly Ser Leu Arg Asn Glu

835 840

<210> 3

<211> 454

<212> PRT

<213> Aspergillus terreus

<400> 3

Met Phe Ile Thr Leu Lys Cys Pro Ser Gly Asp Gly Asp Thr Glu Met

1 5 10 15

Glu Gln Val Ala Thr Arg Gly Ala Ser Pro Gly Gln Glu Arg Ser Arg

20 25 30

Met Arg Leu Gly Arg Arg Pro Ala Cys Ile Ser Cys Gln Thr Arg Lys

35 40 45

Leu Arg Cys Thr Gly Arg Ile Gly Asn Cys Asp Arg Cys Arg Ala Lys

50 55 60

Ser Ile Ala Cys Val Phe Pro Ser Ala Gln Ala Lys Thr Pro Thr Trp

65 70 75 80

Thr Ser Pro Leu Gly Arg Pro Asn Pro Ala Ser Thr Val Glu Thr Val

85 90 95

Val Glu Pro Pro Asn Leu Ser Lys Ser Pro Ser Pro Pro Glu Gly Glu

100 105 110

Arg Pro Gly Pro Asn Ser Glu Ser His Pro Gly Gly Ala Leu Phe Asp

115 120 125

Val Asn Phe Glu Asn Leu Leu Val Asp Leu Glu Glu Val Thr Arg Ser

130 135 140

Asn Ser His Ile Arg Ala Thr Asp Leu Leu Ser Val Leu Asp Pro Gln

145 150 155 160

Asn Thr Glu Gln Tyr Asp Pro Asp Gly Gly Leu Pro His Ala Arg Asn

165 170 175

Leu Pro Arg Pro Leu Thr Pro Ser Arg Pro Thr Phe Ser Leu Asp Pro

180 185 190

Val Met Ala Ser Ser Glu Pro Ala Thr Glu Pro Val Ile Gly Asp Leu

195 200 205

Leu Leu Asp Ser Phe Ser His Pro Thr Ser Ser Ala Pro Ser Asn Gly

210 215 220

Pro Met Leu Glu Thr Ala Met Asp Ala Ser Ala Leu Trp Thr Lys Asn

225 230 235 240

Asp Gly Cys Ser Cys Met Tyr Asn Ala Val Arg Val Val Gln Gln Leu

245 250 255

Asp Asp Asp Asp Phe Arg Ile Thr Thr Leu Ser Leu Gly Gln Val Leu

260 265 270

Gln Leu Gln Lys Trp Ile Ile Ala Gln Cys Ser Lys Pro Leu Asp Cys

275 280 285

Val Asn Cys Lys Leu Leu Pro Thr Val His Thr Val Leu Val Ile Ile

290 295 300

Cys Asp Arg Leu Ala Glu Met Phe Glu Cys Ile His Lys Arg Ile Lys

305 310 315 320

Lys Ala Asn Gln Arg Ile Ser Gly Leu Ser Asp Ser Ser Asp Gln Ser

325 330 335

Ser Ala Gly Ser Ser Asp Ser Ser Val Pro Ser Pro Glu Arg Leu Gly

340 345 350

Glu Leu Tyr Cys Thr Ser Ser Arg Gly Ala Ala Ser Lys Ala Gln Cys

355 360 365

Asn Pro Glu Leu Phe Ala Ser Asp Phe Gln Ser Met Tyr Ser Ser Glu

370 375 380

Glu Gln Val His Ile Ile Ser Val Leu Leu Lys Leu Gln Val Arg Asn

385 390 395 400

Phe Arg Ala Leu Leu Met Arg Val Gly Ser Ala Ser Gln Ile Thr Gly

405 410 415

Ser Glu Ala Arg Thr Ala Lys Val Lys Ser Ile Ile Ile Arg Leu Ser

420 425 430

Arg Ala Ala Ser Asp Ile Asp Ala Ser Leu Arg Ala Val Leu Gln Phe

435 440 445

Phe Ala Val Ser His Pro

450

<210> 4

<211> 389

<212> PRT

<213> Aspergillus terreus

<400> 4

Met Leu Leu Cys Asp Ser Leu Ser Phe Phe Gln Gln Leu Ala Trp His

1 5 10 15

Val Gln Leu Leu Ala Cys Leu Gln Trp Leu Gly Arg Ser Gln Val Leu

20 25 30

Ile Cys Leu Pro Leu Gly Ser Ser Phe Ser Val Arg Asp Leu Ala Gln

35 40 45

Leu Cys Gly Val Ser Glu Thr Thr Leu Ser Arg Val Val Arg Leu Thr

50 55 60

Ala Thr Ala Gly Phe Leu Gln Glu Pro Gln Pro Gly Gln Ile Met His

65 70 75 80

Thr Pro Leu Ser Gly Ala Phe Gly Gly Gln Pro Ser Leu Arg Asp Ala

85 90 95

Thr Leu Phe Leu Ser Asn Arg Ile Thr Pro Ser Ala Leu Gln Met Ala

100 105 110

Ser Thr Leu His Leu Gly Arg Thr Glu Ser Ala Ala Glu Ser Ala Tyr

115 120 125

Asn Leu Ala Phe Ala Thr Ser Arg Thr Phe Arg Asp Ala Cys Arg Val

130 135 140

Thr Pro Lys Leu His Arg Gln Trp Ile Ala Tyr Leu Arg Asn Thr Gly

145 150 155 160

Asp Ser Asp Asp Ser Ile Thr Glu Val Leu Thr Arg Leu Asp Trp Ala

165 170 175

His Leu Gly Arg Ser Cys Ile Val Glu Ser Gly Ala Arg Ser Thr Thr

180 185 190

Arg Ala Arg Val Leu Ser Lys Leu Tyr Pro Ala Leu Arg Phe Val Val

195 200 205

Gln Leu Ser Gly Pro Asp Gln Asp Ala His Asp Thr Arg Ala Ser Leu

210 215 220

Thr Pro Val Pro Ser Ile Pro Gly Ile Ile Gln Leu Asp Glu Asn Tyr

225 230 235 240

Pro His Ile Ser Val Gln Thr Arg Asn Leu Gly Leu Ala Gln Pro Val

245 250 255

Leu Asp Ala Ala Val Tyr Ile Leu His Leu Pro Ser Leu Ser Val Ala

260 265 270

Asn Ser Pro Ser Arg Ser Ile Val Val Lys Glu Leu Gln Ala His Met

275 280 285

Asp Val Leu Ser Ser Asn Pro Ser Ala Val Leu Ile Ala Thr Ala Arg

290 295 300

Val Leu Pro Pro Pro Gly Ser Val His Arg Glu Val Glu Ala Met Cys

305 310 315 320

Arg Val Arg Asp Phe Thr Leu Met Gln Leu Thr Asn Glu His Glu Pro

325 330 335

Glu Val Ala Asp Phe Asp Asp Leu Val Asn Ala Val Glu Ala Gly Gly

340 345 350

Ala Gly Arg Leu Val Val Ala Asp Lys Leu Arg Ala Arg Asn Asn Leu

355 360 365

Leu Val Ala Phe Val Leu Lys Tyr Gln Glu Val Ser Ala Pro Gly Ala

370 375 380

Leu Pro Ser Ser Phe

385

<210> 5

<211> 229

<212> PRT

<213> Aspergillus terreus

<400> 5

Met Ser Ala Glu Gly His Lys Leu Arg Gly Ser Cys His Ala Cys Ala

1 5 10 15

Ala Ser Lys Val Arg Cys Ser Lys Glu Lys Pro Thr Cys Ser Arg Cys

20 25 30

Ser Lys Arg Gly Thr Thr Cys Glu Tyr Leu Ile Thr Lys Arg Pro Gly

35 40 45

Arg Lys Gln Leu Asn Asn Arg Ser Thr Ala Lys Glu Ser Ser Asn Thr

50 55 60

Thr Arg Thr Ser Leu Ala Thr Val Pro Gln Gly Leu Leu Glu Pro Asp

65 70 75 80

Pro Met Ser Thr Ala Ile Pro Leu Ala Asp Gln Pro Pro Trp Ser Pro

85 90 95

Pro Gly Thr Thr Pro Ser Ser Leu Asp Val Phe Ser Ser Leu Phe Asp

100 105 110

Ser Ala Glu Gly Ser Trp Ser Leu Pro Leu Ala Asp Trp Asp Asn Glu

115 120 125

Val Asp Glu Tyr Leu Thr His Leu Ala Met Pro Arg Thr Ala Asn Ser

130 135 140

Glu Pro Leu Asp Ala Glu Gly Gly Ile Thr Ser Ser His Asn Thr Ser

145 150 155 160

Ser Asn Ser Pro Ala Arg Pro Pro Thr Leu Gln Pro Val Cys Pro Gln

165 170 175

Leu Thr Cys Val Ala Gln Ser Thr Phe Pro Ala Pro Gly Gln Cys Arg

180 185 190

Gly Thr Ser Pro Thr Leu Val Leu Tyr Leu Ser Gln Gln Cys Ala Gly

195 200 205

Ser Val Glu Ala Ala Asp His Gln Arg Ser Ala Gly Arg Leu His Ile

210 215 220

Arg Arg Pro Ala Arg

225

<210> 6

<211> 486

<212> PRT

<213> Aspergillus terreus

<400> 6

Met Glu Arg Gln Pro Lys Ser Leu Ser Asp Ala Val Gln Leu Leu Gln

1 5 10 15

Thr Thr Glu Ile Ile Ser Lys Cys Thr Gln Thr Ile Ile Ala Glu Trp

20 25 30

Ser Asn Glu Ala Glu Thr Phe Lys Lys Arg Ala Ser Ser Gly Arg Ala

35 40 45

Gly Ala Glu Leu Val Leu Pro Ser His Glu Leu Phe Asn Ala Gln Arg

50 55 60

Thr Ile Thr Ala Ala Ile Gly Lys Leu Ile Glu Leu Val Ser Glu Pro

65 70 75 80

Ser Val Arg Ile Leu Glu Ile Ala Gly Gln Tyr Gln Glu Ser Arg Ala

85 90 95

Leu Tyr Ile Ala Val Glu Arg Arg Ile Pro Asp Ile Leu Ala Ser Gln

100 105 110

Asp Asn Glu Gly Gly Met Pro Val Lys Glu Leu Ser Ser Arg Thr Gly

115 120 125

Ile Glu Tyr Arg Lys Leu Ser Arg Ile Leu Arg Tyr Leu Cys Ser Met

130 135 140

Gly Thr Phe Arg Gln Val Gly Pro Asp Val Phe Ala Asn Asn Thr Ile

145 150 155 160

Ser Ala Cys Leu Val Ala Asn Glu Pro Leu Arg Ala Tyr Val Arg Leu

165 170 175

Thr Gly Ser Glu Ala Phe Thr Ala Ser Asp Arg Leu Pro Lys Thr Leu

180 185 190

Leu Asp Pro Ser Thr Gly Pro Ser Tyr Asp Val Thr Arg Thr Ala Trp

195 200 205

Gln Asp Ala Ile Gly Thr Thr Lys Pro Arg Trp Glu Trp Ile Glu Glu

210 215 220

Arg Val Glu Pro Asp Lys Leu Leu Asp Ser Gly Tyr His Tyr Pro Gly

225 230 235 240

Ile Pro Ser Leu Ile Leu Glu Pro Gln Pro Pro Gly Glu Asp Gly Leu

245 250 255

Val Ala Arg Pro Glu Leu Glu Ile Met Gly Leu Ala Met Val Gly Gly

260 265 270

Gly Arg Val Phe Gly Ala Ala His Val Phe Asp Phe Pro Trp Ala Ser

275 280 285

Leu Asp Asn Ala Leu Val Val Asp Val Gly Gly Gly Val Gly Gly Phe

290 295 300

Ala Leu Gln Leu Ser Lys Val Tyr Pro Asp Leu Arg Phe Val Ile Gln

305 310 315 320

Asp Arg Gly Pro Val Ile Gln Gln Ala Leu Glu Ser Val Trp Pro Asn

325 330 335

Glu Asn Pro Ala Ala Leu Lys Asp Gln Arg Val Gln Phe Met Glu His

340 345 350

Ser Phe Phe Asp Lys Asn Pro Val Glu Gly Ala Asp Val Tyr Tyr Leu

355 360 365

Arg Tyr Val Leu His Asp Trp Ser Asp Asp Tyr Cys Val Asn Ile Leu

370 375 380

Ser His Ile Arg Glu Ser Met Ala Pro His Ser Arg Leu Leu Ile Cys

385 390 395 400

Glu Gln Val Met Asn Thr Thr Ile Gly Asp Pro Asp Leu Thr Ser Ala

405 410 415

Pro Ala Pro Leu Pro Ala Asn Tyr Gly Phe His Ala Arg Phe Ser His

420 425 430

Ser Arg Asp Leu Thr Met Met Ala Ala Ile Asn Gly Ile Glu Arg Thr

435 440 445

Pro Glu Glu Phe Lys Thr Ile Leu Lys Ser Ala Gly Leu Ala Leu Lys

450 455 460

Gln Ile Trp Glu Cys Arg Ser Gln Val Ser Leu Leu Glu Ala Val Arg

465 470 475 480

Ala Asp Ala Arg Thr Ala

485

<210> 7

<211> 148

<212> PRT

<213> Aspergillus terreus

<400> 7

Met Pro Lys Leu Val Leu Leu Ser Ser Ala Thr Leu Asp Glu Gln Leu

1 5 10 15

Ser Arg Ala Thr Pro Ala Leu Ile Arg Trp Ile Leu Leu Arg Ser Ala

20 25 30

Ser His Val Tyr Arg Asp Leu Val Glu Thr Glu Ala Phe Leu Arg Ala

35 40 45

Gln Gly Asp Trp Val Ser Thr Val Phe Ile Lys Pro Gly Gly Leu Ser

50 55 60

Leu Asp Val Gln Arg Gly His Ala Leu Ser Leu Thr Glu Glu Lys Ser

65 70 75 80

Pro Leu Ser Tyr Ala Asp Leu Ala Ala Ala Met Ile Glu Ala Ala Thr

85 90 95

Asp Pro Asp Gly Arg Trp Asp Met Arg Asn Val Gly Val Ile Ser Val

100 105 110

Asn Gly Pro Ala Lys Ser Pro Pro Gly Ala Pro Met Cys Ile Phe Met

115 120 125

Gly Phe Val Arg His Tyr Phe Pro Phe Leu His Pro Tyr Leu Pro Ser

130 135 140

Thr Gly Pro Gly

145

Claims (10)

1.A genetic engineering strain for producing emodin or downstream derivatives thereof is provided, wherein the starting strain of the genetic engineering strain is aspergillus terreus, and the genetic engineering strain is prepared by over-expressing a transcription regulatory factor ATEG _08453 in the aspergillus terreus.

2. The genetically engineered strain of claim 1, wherein the overexpression is achieved by any one of the following means or a combination thereof:

I. Replacing the original promoter of ATEG _08453 in Aspergillus terreus with a strong promoter;

II. At least one additional copy of the ATEG-08453 gene was introduced into A.terreus.

3. The genetically engineered strain of claim 2, wherein the introduction of at least one additional copy of the gene for ATEG 08453 into aspergillus terreus is achieved by any one or a combination of the following:

a. Constructing ATEG _08453 into an expression vector to obtain a recombinant expression vector for expressing ATEG _08453, and transferring the recombinant expression vector into aspergillus terreus; preferably, the recombinant expression vector contains a strong promoter to initiate expression of ATEG _ 08453;

b. Inserting an additional copy of the ATEG _08453 gene into the aspergillus terreus genome; preferably, the additional copy of the ATEG-08453 gene is inserted into the Aspergillus terreus genome by double crossover by homologous recombination.

4. The genetically engineered strain of claim 3, wherein the insertion of the additional copy of the ATEG _08453 gene into the Aspergillus terreus genome further comprises using a strong promoter to drive expression of the additional ATEG _08453 gene.

5. The genetically engineered strain of any one of claims 2 to 4, wherein the strong promoter is one or more of promoters PgpdAt, PcitA, PgpdA, PtrpC, Pgpk and Ppgd; preferably, PgpdAt.

6. The genetically engineered strain of claim 3, wherein the additional copy of the ATEG _08453 gene is inserted into the Aspergillus terreus genome at the ku80 gene site.

7. The genetically engineered strain of claim 1, further comprising a mutated O-methyltransferase gene (gedA).

8. the genetically engineered strain of claim 1, wherein the aspergillus terreus is selected from aspergillus terreus ATCC20542, CICC40205, NIH2624 or NRRL 1960; more preferably, the aspergillus terreus is aspergillus terreus with ku80 gene mutation; preferably, the transcription regulatory factor ATEG _08453 comprises an amino acid sequence as shown in SEQ ID No. 5.

9. A method for constructing the genetically engineered strain of any one of claims 1 to 8, comprising the step of genetic manipulation using Aspergillus terreus as a starting strain.

10. Use of the genetically engineered strain of any one of claims 1 to 8 for the production of emodin or a downstream derivative thereof.