CN115947774A - Compound spiroruchostatin E and preparation method and application thereof - Google Patents

Compound spiroruchostatin E and preparation method and application thereof Download PDF

Info

Publication number
CN115947774A
CN115947774A CN202211121904.0A CN202211121904A CN115947774A CN 115947774 A CN115947774 A CN 115947774A CN 202211121904 A CN202211121904 A CN 202211121904A CN 115947774 A CN115947774 A CN 115947774A
Authority
CN
China
Prior art keywords
tdp
kan
m4spi
burkholderia
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211121904.0A
Other languages
Chinese (zh)
Inventor
李瑞娟
宋超逸
王茂芹
宫恺
张友明
符军
李爱英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202211121904.0A priority Critical patent/CN115947774A/en
Publication of CN115947774A publication Critical patent/CN115947774A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Saccharide Compounds (AREA)

Abstract

The invention discloses a spirouchostatin derivative which is a polyketone-non-ribosomal polypeptide hybrid compound and is a compound 1 with a chemical structure shown in a formula (I), and the derivative is named as spirouchostatin E. The compound is obtained by culturing and liquid fermenting Burkholderia mutant strain Burkholderia ailandensis E264 delta tdp, R-tdp-M4spi and separating from the fermentation liquor. The invention also discloses application of the Spiruchostatin derivative or pharmaceutically acceptable salt thereof in preparation of antitumor drugs. The experiment proves that: the yield of the compound 1 produced by the Burkholderia mutant strain reaches 270mg/L; and the compound 1 can obviously inhibit the growth of tumor cells, and the inhibition activity of the compound is obviously higher than that of FK228. The compound provided by the invention is expected to gain the application value of the compound in antitumor treatment, provides a new alternative compound for the development and application of novel antitumor drugs, and has obvious economic value and social benefit.

Description

Compound spirouchostatin E as well as preparation method and application thereof
Technical Field
The invention relates to a novel derivative compound 1 of histone deacetylase inhibitor Spiruchostatin, a producing strain of the compound, a preparation method and application in preparing antitumor drugs. Belongs to the field of microbial technology, products and application technology.
Background
Histone deacetylase inhibitors (HDACi) can inhibit the proliferation of tumor cells, induce the differentiation and apoptosis of tumor cells by increasing the acetylation degree of intracellular histones.
HDACi has become a new focus of research for tumor targeted therapy. Romidepsin (FK 228), a natural histone deacetylase inhibitor, was approved by the U.S. FDA in 2009 for marketing for the treatment of peripheral and cutaneous T-cell lymphomas. The structural analogs of the derivative, namely Thailandepsins A-F from Burkholderia and Spiruchostatin sA-D from pseudomonas have remarkable histone deacetylase inhibitory activity so as to show good antitumor activity. Biosynthetic gene clusters of the three compounds also have certain homology, so that a chance is provided for people to obtain new derivatives by modifying the biosynthetic gene clusters by using a combined biosynthesis means.
At the early stage, the applicant filed a patent application with the application number of "201710813845.6" an engineered strain for heterologous expression of histone deacetylase inhibitor and application thereof ", which is currently granted. This patent performed direct cloning of Thailandepsins on Burkholderia thailandrensis E264 genome and achieved heterologous expression in DSM 7029. Subsequently, the applicant also submits a patent application with the application number of 2022101093154, namely an engineering strain with high yield of FK228 and construction and application thereof. In the patent, the applicant constructs an Chassis bacterium Burkholderia thailandris E264 delta tdp which can be used for high yield of FK228 compounds, and the yield of FK228 reaches 350mg/L. However, no patent or literature report is found for generating novel derivatives of Spiruchostatin by performing module replacement on the basis of a Thailandepsin biosynthesis gene cluster by using a combined biosynthesis technical means and expressing the gene in an Chassis bacterium Burkholderia thailandensis E264 delta tdp.
Disclosure of Invention
Aiming at the current situation that a novel derivative of the Spiruchostatin is not obtained by using a combined biosynthesis technical means, the invention aims to provide a novel derivative compound 1 of the Spiruchostatin, a production strain of the compound, a preparation method and application of the compound in preparing antitumor drugs.
The invention relates to a Spiruchostatin derivative, which is characterized in that: the spiroruchostatin derivative is a polyketone-nonribosomal polypeptide hybrid compound, is a compound 1 with a chemical structure shown in a formula (I), and is named as spiroruchostatin E;
Figure BDA0003847482540000021
the invention also provides pharmaceutically acceptable salts, tautomers and stereoisomers of the Spiruchostatin derivatives.
The preparation method of the Spiruchostatin derivative comprises the following steps:
(1) The gene cluster of thailandepsin is knocked out, a chassis bacterium Burkholderia thailandesises E264 delta tdp constructed by adding attB sites at corresponding positions is used as an initial strain, the gene cluster R-tdp-M4spi is integrated on a genome of a position where the chassis bacterium Burkholderia thailandesises E264 delta tdp originally expresses thailandepsin through site-specific recombination, and the obtained engineering strain is named as Burkholderia mutant strain Burkholderia thailandesises E264 delta tdp:: R-tdp-M4spi;
(2) Inoculating the Burkholderia t-hialanensis E264 delta tdp mutant strain R-tdp-M4spi secondary seed with the inoculation amount of 1-5% by volume ratio into a 250mL shaking bottle containing 65mL fermentation medium, and inoculating at 28 + -1 deg.C and 180 + -20R-min -1 Culturing for 56 plus or minus 2 hours under the condition of (1); obtaining fermentation liquor containing Spiruchostatin derivatives;
wherein, burkholderia mutant strain Burkholderia thailandrensis E264 delta tdp, the R-tdp-M4spi primary seed culture method comprises the following steps: R-tdp-M4spi seeds are selected by an inoculating loop and are subjected to ring-making plate on a solid LB culture medium, and are cultured in a constant-temperature incubator at 37 +/-1 ℃ for 12 +/-2 h; the secondary seed culture method comprises the following steps: the cultured first-stage seeds are picked by an inoculating loop, inoculated into a 250mL shaking bottle with the liquid loading capacity of 50mL liquid LB culture medium, and are cultured at 37 +/-1 ℃ and 180 +/-20 r.min -1 Culturing for 18 +/-2 h under the condition;
(3) Extracting the fermentation liquor by using ethyl acetate with the same volume, repeating for 3 +/-1 times, combining the extraction liquid, concentrating and drying at low pressure to obtain a crude extract of the spirouchostatin derivative;
(4) Separation and purification of the crude extract by HPLC: using ultrapure water as a mobile phase A, using chromatographically pure acetonitrile as a mobile phase B, carrying out gradient elution under the conditions of 0-5min 5% B,5-60min 40% B,3mL/min, collecting fractions, concentrating and drying at low pressure to obtain a pure product of the Spiruchostatin derivative, namely, the compound 1 (named as Spiruchostatin E) with the chemical structure shown in the formula (I).
In the preparation method of the Spiruchostatin derivative, the Burkholderia thalandenis E264 delta tdp mutant strain construction method of R-tdp-M4spi specifically comprises the following steps:
(1) Inserting kan-ccdB into the plasmid p15A-cm-tdp by utilizing Red/ET homologous recombination technology for knocking out a tetracycline promoter to obtain the plasmid p15A-cm-tdp-kan-ccdB;
(2) Carrying out enzyme digestion on the plasmid p15A-cm-tdp-kan-ccdB by using a restriction enzyme BstZ17I to release a vector p15A-cm-tdp-kan-ccdB linear fragment; the p15A-cm-tdp-kan-ccdB linear fragment and tdpR are treated in vitro by T4 DNA polymerase, and then are electrically transferred into E.coli GB05-dir to obtain a plasmid p15A-cm-R-tdp;
(3) Chemically synthesizing spiDE1 (Block 4) gene with a sequence shown in GenBank No. JQ045344.1;
(4) Using pR6K-kan-ccdB plasmid as a template, and obtaining a kan-ccdB gene fragment by using a PCR technology;
(5) Performing tandem PCR on kan-ccdB and spiDE1 (module 4) gene to obtain a kan-ccdB-M4spi fragment;
(6) Integrating a kan-ccdB-M4spi fragment into a p15A-cm-R-tdp plasmid in a linear loop recombination manner by utilizing an engineering strain E.coli GBred-gyrA462 to construct a plasmid p15A-cm-R-tdp-kan-ccdB-M4spi;
(7) Cutting p15A-cm-R-tdp-kan-ccdB-M4spi by PacI endonuclease, carrying out T4 DNA polymerase incubation in vitro, and then transferring to E.coli GB2005 to obtain a plasmid p15A-cm-R-tdp-M4spi;
(8) Replacing the cm resistance gene in the plasmid p15A-cm-R-tdp-M4spi by a site-specific recombination element kan-oriT-phiC31 in a linear loop recombination mode by utilizing an engineering strain E.coli GB08-red to obtain the plasmid
p15A-kan-oriT-phiC31-R-tdp-M4spi；
(9) The Burkholderia mutant strain Burkholderia thailandisis E264. DELTA. Tdp is obtained by integrating the plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi into the genome of the Bacillus bifidus E264. DELTA. Tdp by site-specific recombination, R-tdp-M4spi.
In the preparation method of the Spiruchostatin derivative, the formula of the fermentation medium is as follows: glucose 10 g.L -1 Tryptone 1.67 g. L -1 ，K 2 HPO 4 ·3H 2 O 9.17g·L -1 ，KH 2 PO 4 2 g·L -1 Sodium citrate 0.5 g.L -1 ，MgSO 4 ·7H 2 O 0.1g·L -1 ，pH 7.0。
The invention provides an engineering strain for preparing the spirouchostatin derivative, which is characterized by comprising the following components in percentage by weight: the engineering strain is named Burkholderia thailandensis E264 delta tdp, R-tdp-M4spi, and the genotype thereof is as follows: burkholderia thailandiensis E264. Delta. Tdp, kanamycin resistance gene, tdpR, tdpA, tdpB, dpC1, tdp-spiDE (M4 spi), tdpF, tdpG, tdpH, tdpI and tdpJ are obtained by integrating gene cluster R-tdp-M4spi to the genome of the position where the thailandisin is originally expressed by using an Chassis Burkholderiia thailandis E264. Delta. Tdp constructed by knocking out the complete gene cluster of the thailandisin and adding attB sites at corresponding positions as an original strain through site-specific recombination.
The invention relates to application of Spiruchostatin derivatives or pharmaceutically acceptable salts thereof in preparing antitumor drugs.
Experiments prove that the Spiruchostatin derivative compound 1 (named as Spiruchostatin E) has obvious inhibitory activity on four tumor cell strains, the inhibitory activity of the Spiruchostatin derivative compound is equivalent to that of doxorubicin, and the inhibitory activity of the Spiruchostatin derivative compound is stronger than that of FK228. Has the potential of preparing antitumor drugs.
The invention further discloses an anti-tumor medicinal preparation containing the Spiruchostatin derivative, which is characterized by comprising the following components in part by weight: the pharmaceutical preparation contains a therapeutically effective amount of the Spiruchostatin derivative and one or more pharmaceutically acceptable carrier substances and/or auxiliary agents.
The invention further discloses an antitumor medicinal preparation containing pharmaceutically acceptable salts, tautomers or stereoisomers of the Spiruchostatin derivatives, which is characterized in that: the pharmaceutical preparation contains a therapeutically effective amount of pharmaceutically acceptable salts, tautomers or stereoisomers of the Spiruchostatin derivatives and one or more pharmaceutically acceptable carrier substances and/or auxiliary agents.
The pharmaceutically acceptable carrier refers to a conventional pharmaceutical carrier in the pharmaceutical field, such as: diluents, excipients such as water and the like, fillers such as starch, sucrose and the like, binders such as cellulose derivatives, alginates, gelatin and polyvinylpyrrolidone; humectants such as glycerol; disintegrating agents such as agar, calcium carbonate and sodium bicarbonate; absorption enhancers such as quaternary ammonium compounds; surfactants such as cetyl alcohol; adsorption carriers such as kaolin and bentonite; lubricants such as talc, calcium and magnesium stearate, and polyethylene glycol, and the like.
The invention has the beneficial effects that: for the first time, a novel derivative compound 1 (named as spirouchostatin E) of a histone deacetylase inhibitor, a production strain of the compound, a preparation method and application of the compound in preparing antitumor drugs are disclosed. The experiment proves that: the Burkholderia thailandrensis E264 delta tdp mutant strain provided by the invention has the advantages that the yield of the compound 1 produced by R-tdp-M4spi reaches 270mg/L; the compound 1 can obviously inhibit the growth of tumor cells, and the inhibition activity of the compound is higher than that of FK228, so that the compound is expected to gain the application value of the compound in antitumor treatment, and a new alternative compound is provided for the development and application of novel antitumor drugs. According to the technical scheme, the novel derivatives of Spiruchostatin are successfully obtained by a combined biosynthesis means, so that a foundation is laid for modifying Thailandepsins to develop high-value histone deacetylase inhibitor medicines, and important research and application values are provided for developing novel antitumor medicines.
Drawings
FIG. 1: the plasmid p15A-cm-tdp-kan-ccdB and the plasmid p15A-cm-R-tdp.
FIG. 2 is a schematic diagram: the process for constructing plasmid p15A-cm-R-tdp-M4spi and plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi.
FIG. 3: LC-MS graph of R-tdp-M4spi fermentation crude extract.
FIG. 4: of Spiruchostatin E 1 H NMR (600 MHz) spectrum in CDCl as solvent 3 。
FIG. 5 is a schematic view of: method for producing Spiruchostatin E 13 C NMR (150 MHz) spectrum in CDCl as solvent 3 。
Detailed Description
The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for explaining the present invention and not for limiting the present invention in any form, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.
General description:
the recombinase-expressing strains E.coli GBred-gyrA462, E.coli GB08-red, E.coli GB2005 and E.coli GB05-dir, which are referred to in the following examples, are all purchased from Gene Bridges, germany; coli WM3064 and Burkholderia thailandensis E264 were purchased from the German center for the preservation of strains DMSZ. The construction of the engineering bacterium Burkholderia thailandrensis E264 delta tdp is shown in a patent of '2022101093154' previously filed by the applicant 'an engineering strain with high FK228 yield and construction and application thereof'.
Plasmids pR6K-kan-oriT-phiC31 and pR6K-kan-ccdB were purchased from Gene Bridges, germany. The construction of the plasmid p15A-cm-tdp is shown in a patent 'an engineering strain for heterologous expression of histone deacetylase inhibitor and application thereof' previously filed by the applicant (patent application number: 201710813845.6). The spiDE1 (Block 4) gene was synthesized by Kinzhi Inc.
LB culture medium: 10 g.L of Tryptone -1 ，Yeast extract 5g·L -1 ，NaCl 10g·L -1 In the solid medium, 12 g/L of agar is added -1 (ii) a Fermentation medium: glucose 10 g.L -1 Tryptone 1.67 g.L -1 ，K 2 HPO 4 ·3H 2 O 9.17g·L -1 ，KH 2 PO 4 2 g·L -1 Sodium citrate 0.5 g.L -1 ，MgSO 4 ·7H 2 O 0.1g·L -1 ，pH 7.0。
The spiDE1 (Module 4) gene sequence is described in NCBI (GenBank No. JQ045344.1).
Gene sequencing in plasmid construction was performed by Producer organism (Shanghai) GmbH. The plasmids are all conventional plasmids which are sold on the market, and the method for electrotransformation into recipient bacteria is a conventional method.
In the following examples, other reagents and consumables are all made in China. Unless otherwise specified, the experimental methods and reagents in the examples are conventional in the art and commercially available, and are commercially available.
Example 1: construction of plasmid p15A-cm-tdp-kan-ccdB and plasmid p15A-cm-R-tdp
(1) The specific steps for constructing the plasmid p15A-cm-tdp-kan-ccdB comprise:
first, pR6K-kan-ccdB is taken as a template, tdp-kan-1 and tdp-kan-2 are taken as primers to amplify a fragment kan-ccdB, homology arms at two ends of a tetracycline promoter sequence are arranged on the fragment kan-ccdB, and the amplified fragment is recovered and purified by glue. The purified fragment kan-ccdB was transferred electrically to e.coli GBred-gyrA462 containing plasmid p15A-cm-tdp and induced by 10% l-arabinose, after cell recovery for 1h, spread evenly on LB plates of 15 μ g/ml kanamycin, placed in a 37 ℃ incubator, and cultured overnight. Single colonies were picked, double digested with restriction enzymes BstZ17I and PstI, and the correct recombinant plasmid p15A-cm-tdp-kan-ccdB was selected. The recombinant plasmid with the correct restriction enzyme analysis was sequenced with primers neo-5out-seq and neo-3out-seq, respectively, to ensure that the sequences in the homologous arm regions were not altered.
tdp-kan-1:cttaagacccactttcacatttaagttgtttttctaatccgcatatgatcaattGTATACGGATCCTATCAACAGGTTGAACTTTT
tdp-kan-2.
The sequences of the primers used to sequence the regions of homology arms were as follows:
neo-5out-seq:AATCCATCTTGTTCAATCAT
neo-3out-seq:TGGCGGCGAATGGGCTGACC
(2) The specific steps of the construction of the plasmid p15A-cm-R-tdp are as follows:
the Burkholderia thailandrensis E264 genome is taken as a template, tdpR-1 and tdpR-2 are taken as primers, a target fragment tdpR is amplified, both ends of the target fragment tdpR are provided with homologous arms of sequences at both ends of a tetracycline promoter sequence, and the amplified fragment is recovered and purified by glue.
And (3) carrying out enzyme digestion on the plasmid p15A-cm-tdp-kan-ccdB by using a restriction enzyme BstZ17I to release a linear fragment of the vector p15A-cm-tdp, and recovering an enzyme digestion product through alcohol precipitation. Then, the recovered p15A-cm-tdp linear fragment and tdpR fragment were treated with T4 DNA polymerase in vitro, then transferred electrically to E.coli GB05-dir, and after the cells were revived for 1 hour, they were spread uniformly on LB plates of 30. Mu.g/ml chloramphenicol, placed in a 37 ℃ incubator, and cultured overnight. Single colonies were picked, double digested with restriction enzymes PstI and NcoI, and the correct recombinant plasmid p15A-cm-R-tdp was selected. The recombinant plasmid with correct restriction enzyme analysis is sequenced by using primers R1-3in-seq, R1-3out-seq, R2-seq, R3-seq and R4-seq respectively to ensure that the sequence of a PCR product is not changed.
tdpR-1:cttaagacccactttcacatttaagttgtttttctaatccgcatatgatcaattTCAGCTGAATTGTGACGACT
tdpR-2.
The primer sequences used for sequencing the PCR products were as follows:
R1-3in-seq:GCGCTGGAGAATCTCTTGCC
R1-3out-seq:GGCAAGAGATTCTCCAGCGC
R2-seq:CGGAATGCATGGGTGGCCTC
R3-seq:AATGCGGCGCGGATGTCATG
R4-seq:GTTTTAAATGAATCGATATG
the construction process of the above plasmid p15A-cm-tdp-kan-ccdB and plasmid p15A-cm-R-tdp is schematically shown in FIG. 1.
Example 2: construction of plasmid p15A-cm-R-tdp-M4spi and plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi (1) construction of plasmid p15A-cm-R-tdp-M4spi comprises the following specific steps:
first, pR6K-kan-ccdB plasmid is used as a template, pkan-ccdB-M4spiF and pkan-ccdB-M4spiR are used as primers, kanamycin resistance gene and ccdB gene are reversely screened through a PCR technology, purified fragment kan-ccdB and synthesized spiDE1 (module 4) gene are subjected to tandem PCR by using pkan-ccdB-M4spiF and pspidD-M4 spiR as primers to obtain kan-ccb-spiDE 1 fragment, the kan-ccdB-spiDE1 fragment is electrically transferred to E.coli GBred-gyrA462 containing plasmid p15A-cm-R-tdp and induced by 10L-arabinose, after the cells are recovered for 1h, the kan-ccdB fragment and the synthetic spiD-M4spiR are uniformly coated on an LB plate containing 15 mu g/ml kanamycin and are placed in an incubator at 37 ℃ for overnight culture. And (3) selecting a single colony, carrying out enzyme digestion by using a restriction enzyme PacI, carrying out in-vitro incubation by using T4 DNA polymerase, transforming the single colony into E.coli GB2005, selecting a single colony, carrying out enzyme digestion by using a restriction enzyme PstI, identifying a clone with correct enzyme digestion, obtaining a plasmid, and carrying out sequencing by using primers ck-M4spi-1 and ck-M4spi-2 to obtain a plasmid p15A-cm-R-tdp-M4spi.
The primer sequences used for PCR on kan-ccdB were as follows:
pkan-ccdB-M4spiF:gcgttgttgcgcgcggcgctcgcggcgccggaggcgaacgttaattaaTATCAACAGGTTGAAC
pkan-ccdB-M4spiR:atgcctgctccaggcctgcaattgtgcatattcgacgtccTTAATTAAGCTTGCAGTGGGCTTACATG
pspiD-M4spiR: gtgccgctcttatatgctcgcctaccgaAATCTCACCGATCCTGGA (lower case is homology arm, and upper case is PacI cleavage site).
The sequences of the primers used to sequence the regions of the homology arms were as follows:
ck-M4spi-1:GACCTCTATCTGTCGATC
ck-M4spi-2:CGGTCGAGCCGGACGTG
(2) The plasmid p15-kan-oriT-phiC31-R-tdp-M4spi comprises the following specific steps:
firstly, pR6K-kan-oriT-phiC31 is used as a template, oriT-phiC31-kan-F and oriT-phiC31-kan-R are used as primers to amplify a fragment kan-oriT-phiC31, the fragment is provided with homologous arms at two ends of a chloramphenicol gene sequence on a p15A-cm-R-tdp-M4spi plasmid, and the amplified fragment is recovered and purified by glue.
The purified fragment kan-oriT-phiC31 was electrotransferred to E.coli GB08-red containing plasmid p15A-cm-R-tdp-M4spi and induced by 10% L-arabinose, after cell recovery for 1h, it was spread evenly on LB plates containing 15. Mu.g/ml kanamycin, placed in an incubator at 37 ℃ and cultured overnight. Single colonies were picked, digested with the restriction enzyme PstI, and the correct recombinant plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi was selected.
oriT-phiC31-kan-F:cagatcgcaaaaaacagtacatacagaaggagacatgaacCTTACATGGCGATAGCTAG
oriT-phiC31-kan-R GCATGCTACGTATGCCGG (lower case for homology arm)
The construction process of the above plasmid p15A-cm-R-tdp-M4spi and plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi are schematically shown in FIG. 2.
Example 3: construction of Burkholderia thailandis E264. Delta. Tdp mutant Strain R-tdp-M4spi
The plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi is electrically transferred to E.coli WM3064, and then is combined with Burkholderia thailandrosis E264. Tdp for transfer, and finally the gene cluster R-tdp-M4spi is integrated into a host chromosome, so that Burkholderia mutant strain Burkholderia thailandrosis E264. Tdp:R-tdp-M4 spi is obtained.
Wherein the bonding transfer step is: firstly, electrically transferring a plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi to E.coli WM3064, and selecting a single clone to carry out enzyme digestion, identification and screening on the correct clone; e.coli WM3064 containing plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi streaked on LB plate with kanamycin at 15. Mu.g/ml and DAP at 1mM, and cultured in inversion at 37 ℃ overnight; the Burkholderia thailandrensis E264 delta tdp is streaked on an LB plate, and the culture is carried out in an inverted way at 37 ℃ for overnight; overnight cultured Burkholderia thailandrensis E264. DELTA. Tdp was selected and streaked onto LB plate containing 1mM DAP, and overnight cultured E.coli WM3064 containing plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi was streaked thereon; after 6h incubation, the lawn was washed out with LB, 100ul pipetted and streaked onto LB plates containing 300. Mu.g/ml kanamycin. Selecting a single clone, carrying out colony PCR, and identifying the correct clone, namely Burkholderia thailandiensis E264 delta tdp, R-tdp-M4spi.
Example 4: preparation of Spiruchostatin derivatives
First-order seed culture: R-tdp-M4spi seed is selected from a ring-making plate on a solid LB culture medium by an inoculating ring, and cultured in a constant temperature incubator at 37 +/-1 ℃ for 12 +/-2 h;
secondary seed culture: the cultured first-stage seeds are picked by an inoculating loop, inoculated into a 250mL shaking bottle with the liquid loading capacity of 50mL liquid LB culture medium, and are cultured at 37 +/-1 ℃ and 180 +/-20 r.min -1 Culturing for 18 +/-2 h under the condition；
Fermentation culture: inoculating the second-stage seeds into a 250mL shake flask containing 65mL fermentation medium according to the inoculation amount of 1% of the volume ratio, and performing inoculation at 28 +/-1 ℃ and 180 +/-20 r.min -1 Culturing for 56 plus or minus 2 hours under the condition of (1); obtaining the fermentation liquor containing the Spiruchostatin derivatives.
Extracting the fermentation liquor by using ethyl acetate with the same volume, repeating the extraction for 3 +/-1 times, combining the extraction liquid, concentrating and drying at low pressure to obtain a crude extract of the spirouchostatin derivative;
separation and purification by HPLC: using ultrapure water as a mobile phase A, using chromatographically pure acetonitrile as a mobile phase B, carrying out gradient elution under the conditions of 0-5min 5% B,5-60min 40% B,3mL/min, collecting fractions, concentrating and drying at low pressure to obtain a pure product of the Spiruchostatin derivative, namely, the compound 1 (named as Spiruchostatin E) with the chemical structure shown in the formula (I).
Figure BDA0003847482540000081
Example 5: structural characterization of Compound 1 of formula (I)
The structure of the compound 1 is analyzed through data such as nuclear magnetic resonance, high-resolution mass spectrometry, infrared, marfey's analysis and the like, and the following physicochemical property data are obtained, wherein the nuclear magnetic data of the compound 1 is shown in table 1:
compound 1: a white amorphous powder;
Figure BDA0003847482540000082
-6.2(c 2.92,MeOH)；UV(MeOH)λ max (logε)195(4.15)nm；ECD(MeOH)λ max (Δε)203(-12.46)nm；IR v max 3344,2869,1735,1659,1544cm -1 ；(+)-HRESIMS m/z 516.2187[M+H] + (calcd for C 23 H 38 N 3 O 6 S 2 ,516.2197)。
TABLE 1 Compound 1 in CDCl 3 In 1 H NMR (600 MHz) and 13 c NMR (150 MHz) data
Figure BDA0003847482540000091
Example 6: antitumor activity of compound 1 (named as spirouchostatin E) shown as formula (I)
Adopting an international universal tumor cell strain, namely: human lung cancer cell H1299, human breast cancer cell MDA-MB-231, human pancreatic cancer cell mia-paca-2 and human leukemia cell K562. Meanwhile, the cytotoxic activity of the compound on human normal hepatocyte QSG-7701 is also detected. The test method is the CCK-8 method.
A compound: 10mM stock solution, subpackaged, and stored at-20 ℃ for later use.
Inoculating cells in 96-well plate at cell density of 3-4 × 10 3 A hole. Put into 5% of CO 2 Culturing in a 37 ℃ cell culture box, adding a sample to be detected with specified concentration after cells adhere to the wall, wherein a negative control group is DMSO with the same concentration, a positive control group is doxorubicin (Adr), and three parallel holes are arranged for drugs with the same concentration. Adding medicine for culturing for 48h, adding 10 μ L CCK8 into each well, culturing for 4h, detecting OD value of each well at 450nm with enzyme labeling instrument, and using IC 50 Software (Prism 8.0) computing IC 50 The value is obtained. The experiment was repeated three times. IC with 3 times of independent calculation 50 Statistics were performed and expressed as mean ± standard deviation (s.d).
Three parallel experiments were performed for each cell line and the results are shown in Table 2.
TABLE 2 inhibition of tumor cell lines and Normal cell lines by Compound 1 (IC) 50 ,μM)
Figure BDA0003847482540000101
The experimental result shows that the compound 1 (named as spirouchostatin E) has strong inhibition effect on four tumor cells H1299, MDA-MB-231, mia-paca-2 and K562, and has better inhibition effect than doxorubicin or FK228. However, compound 1 also has a relatively strong inhibitory effect on normal cells. Therefore, the compound 1 can be combined with a targeting strategy to prepare an antitumor drug, provides an alternative compound for developing a new antitumor drug, and has great development value for tumor treatment.

Claims (9)

1. A Spiruchostatin derivative, characterized in that: the spirouchostatin derivative is a polyketide-nonribosomal polypeptide hybrid compound, is a compound 1 with a chemical structure shown in a formula (I), and is named as spirouchostatin E;
Figure FDA0003847482530000011
2. a pharmaceutically acceptable salt, tautomer, stereoisomer of a Spiruchostatin derivative of claim 1.
3. A process for preparing a spirorhostatin derivative according to claim 1, comprising the steps of:
(1) The gene cluster of thailandepsin is knocked out, and Chassis bacteria Burkholderia thailandissis E264 delta tdp constructed by attB sites is added at corresponding positions is used as an initial strain, the gene cluster R-tdp-M4spi is integrated on a genome of a position where the Chassis bacteria Burkholderia thailandissis E264 delta tdp originally express thailandipsin through site-specific recombination, and the obtained engineering strain is named as Burkholderia mutant strain Burkholderia thailandissis E264 delta tdp, R-tdp-M4spi;
(2) Inoculating the Burkholderia t-hialanensis E264 delta tdp mutant strain R-tdp-M4spi secondary seed with the inoculation amount of 1-5% by volume ratio into a 250mL shaking bottle containing 65mL fermentation medium, and inoculating at 28 + -1 deg.C and 180 + -20R-min -1 Culturing for 56 plus or minus 2 hours under the condition of (1); obtaining fermentation liquor containing Spiruchostatin derivatives;
(3) Extracting the fermentation liquor by using ethyl acetate with the same volume, repeating the extraction for 3 +/-1 times, combining the extraction liquid, concentrating and drying at low pressure to obtain a crude extract of the spirouchostatin derivative;
(4) Separation and purification of the crude extract by HPLC: using ultrapure water as a mobile phase A, using chromatographic pure acetonitrile as a mobile phase B, carrying out gradient elution under the conditions of 0-5min 5% B,5-60min 40% B,3mL/min, collecting fractions, concentrating and drying at low pressure to obtain a pure product of the Spiruchostatin derivative, namely the compound 1 with the chemical structure shown in the formula (I).
4. The method for preparing spirorhostatin derivative according to claim 3, wherein the Burkholderia mutant strain Burkholderia thailandis E264. Delta. Tdp is constructed by the following steps:
(1) Inserting kan-ccdB into the plasmid p15A-cm-tdp by utilizing Red/ET homologous recombination technology for knocking out a tetracycline promoter to obtain the plasmid p15A-cm-tdp-kan-ccdB;
(2) Carrying out enzyme digestion on the plasmid p15A-cm-tdp-kan-ccdB by using a restriction enzyme BstZ17I to release a vector p15A-cm-tdp-kan-ccdB linear fragment; the p15A-cm-tdp-kan-ccdB linear fragment and tdpR are processed in vitro by T4 DNA polymerase, and then are electrically transferred into E.coli GB05-dir to obtain a plasmid p15A-cm-R-tdp;
(3) Chemically synthesizing spiDE1 gene with the sequence shown in GenBank No. JQ045344.1;
(4) Using pR6K-kan-ccdB plasmid as a template, and obtaining a kan-ccdB gene fragment by using a PCR technology;
(5) Performing tandem PCR on kan-ccdB and spiDE1 gene to obtain a kan-ccdB-M4spi fragment;
(6) Integrating a kan-ccdB-M4spi fragment into a p15A-cm-R-tdp plasmid in a wire loop recombination mode by using an engineering strain E.coli GBred-gyrA462 to construct a plasmid p15A-cm-R-tdp-kan-ccdB-M4spi;
(7) Cutting p15A-cm-R-tdp-kan-ccdB-M4spi by PacI endonuclease, carrying out T4 DNA polymerase incubation in vitro, and then transferring to E.coli GB2005 to obtain a plasmid p15A-cm-R-tdp-M4spi;
(8) Replacing the cm resistance gene in the plasmid p15A-cm-R-tdp-M4spi by a site-specific recombination element kan-oriT-phiC31 in a linear loop recombination mode by utilizing an engineering strain E.coli GB08-red to obtain a plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi;
(9) The Burkholderia mutant strain Burkholderia thailandisis E264. DELTA. Tdp is obtained by integrating the plasmid p15A-kan-oriT-phiC31-R-tdp-M4spi into the genome of the Bacillus bifidus E264. DELTA. Tdp by site-specific recombination, R-tdp-M4spi.
5. The method for preparing Spiruchostatin derivatives according to claim 3, wherein the fermentation medium is formulated as: glucose 10 g.L -1 Tryptone 1.67 g.L -1 ，K 2 HPO 4 ·3H 2 O 9.17g·L -1 ，KH 2 PO 4 2g·L -1 Sodium citrate 0.5 g.L -1 ，MgSO 4 ·7H 2 O 0.1g·L -1 ，pH 7.0。
6. An engineered strain for the preparation of Spiruchostatin derivatives of claim 1, characterized in that: the engineering strain is named Burkholderia thailandis E264 delta tdp, R-tdp-M4spi, and the genotype thereof is as follows: burkholderia thailandiensis E264. Delta. Tdp, kanamycin resistance gene, tdpR, tdpA, tdpB, dpC1, tdp-spiDE1 (M4 spi), tdpF, tdpG, tdpH, tdpI and tdpJ are obtained by integrating gene cluster R-tdp-M4spi to the genome of the position where the thailandisin is originally expressed by the Burkholderia thailandiensis E264. Delta. Tdp by site-specific recombination by using an Chassis Burkholderia thailandiensis E264. Delta. Tdp constructed by knocking out the complete gene cluster of the thailandisin and adding attB sites at corresponding positions as an original strain.
7. Use of the Spiruchostatin derivative or a pharmaceutically acceptable salt thereof according to claim 1 in the preparation of an antitumor drug.
8. An antitumor pharmaceutical preparation comprising the Spiruchostatin derivative of claim 1, characterized in that: the pharmaceutical formulation comprises a therapeutically effective amount of the Spiruchostatin derivative of claim 1 and one or more pharmaceutically acceptable carrier substances and/or auxiliary agents.
9. An antitumor pharmaceutical preparation comprising a pharmaceutically acceptable salt, tautomer or stereoisomer of a Spiruchostatin derivative of claim 2, characterized in that: the pharmaceutical formulation comprises a therapeutically effective amount of a pharmaceutically acceptable salt, tautomer or stereoisomer of a Spiruchostatin derivative according to claim 2 and one or more pharmaceutically acceptable carrier substances and/or auxiliary agents.
CN202211121904.0A 2022-09-15 2022-09-15 Compound spiroruchostatin E and preparation method and application thereof Pending CN115947774A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211121904.0A CN115947774A (en) 2022-09-15 2022-09-15 Compound spiroruchostatin E and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211121904.0A CN115947774A (en) 2022-09-15 2022-09-15 Compound spiroruchostatin E and preparation method and application thereof

Publications (1)

Publication Number Publication Date
CN115947774A true CN115947774A (en) 2023-04-11

Family

ID=87281461

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211121904.0A Pending CN115947774A (en) 2022-09-15 2022-09-15 Compound spiroruchostatin E and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN115947774A (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090209494A1 (en) * 2005-12-24 2009-08-20 Christine Janet Martin 21-deoxymacbecin analogues useful as antitumor agents
US20110060021A1 (en) * 2009-08-19 2011-03-10 Yiqiang Cheng Histone deacetylase inhibitors and uses thereof
CN107603934A (en) * 2017-09-11 2018-01-19 山东大学 The engineered strain of one plant of heterogenous expression histon deacetylase (HDAC) inhibitor and its application
CN113699089A (en) * 2021-09-06 2021-11-26 山东大学 Engineering strain for heterologous expression of histone deacetylase inhibitor FK228 and construction and application thereof
CN114410560A (en) * 2022-01-28 2022-04-29 山东大学 Engineering strain for high yield of FK228 and construction and application thereof
WO2022094865A1 (en) * 2020-11-05 2022-05-12 中国科学院深圳先进技术研究院 "autolytic" salmonella strain, preparation method therefor and application thereof in tumor treatment

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090209494A1 (en) * 2005-12-24 2009-08-20 Christine Janet Martin 21-deoxymacbecin analogues useful as antitumor agents
US20110060021A1 (en) * 2009-08-19 2011-03-10 Yiqiang Cheng Histone deacetylase inhibitors and uses thereof
CN107603934A (en) * 2017-09-11 2018-01-19 山东大学 The engineered strain of one plant of heterogenous expression histon deacetylase (HDAC) inhibitor and its application
WO2022094865A1 (en) * 2020-11-05 2022-05-12 中国科学院深圳先进技术研究院 "autolytic" salmonella strain, preparation method therefor and application thereof in tumor treatment
CN113699089A (en) * 2021-09-06 2021-11-26 山东大学 Engineering strain for heterologous expression of histone deacetylase inhibitor FK228 and construction and application thereof
CN114410560A (en) * 2022-01-28 2022-04-29 山东大学 Engineering strain for high yield of FK228 and construction and application thereof

Similar Documents

Publication Publication Date Title
CN110157654B (en) Bacillus natto recombinant strain and construction method and application thereof
CN109897862B (en) Gentamicin B producing strain and preparation method and application thereof
JPH0622780A (en) Novel fungus strain and method for preparing antibiotics using same
CN114796254A (en) Spinosad derivative serving as arginine succinate synthetase activator and application thereof
WO2019120132A1 (en) Engineered strain for efficient heterologous expression of disorazole z, gene cluster for constructing the strain and applications thereof
CN115368439A (en) FK228 derivatives and preparation method and application thereof
CN113699089A (en) Engineering strain for heterologous expression of histone deacetylase inhibitor FK228 and construction and application thereof
CN108138126A (en) A kind of Mycobacterium tuberculosis genes engineering bacteria and its application in steroidal compounds are prepared
KR102269637B1 (en) Mutant strain with enhanced L-citrulline or L-Arginine productivity and method for preparing L-citrulline or L-Arginine using the same
CN102703495A (en) Method for improving yield of streptomycete antibiotic and plasmid thereof
JP6263133B2 (en) UK-2 biosynthetic gene and method for improving UK-2 productivity using the same
CN115947774A (en) Compound spiroruchostatin E and preparation method and application thereof
CN107603934B (en) Engineering strain for heterologous expression of histone deacetylase inhibitor and application thereof
CN112409372B (en) Yuxithromycin analogue, preparation method and application thereof
US10590159B2 (en) Lincomycin biosynthetic intermediates, method for preparation, and use thereof
CN116121163A (en) Method for changing biosynthesis of thaxtomin A through transcription factor gene bldD in streptomyces scab
CN107541503B (en) Methyltransferase GenL, coding gene genL thereof and application
CN109836433B (en) Novel LL-D49194 alpha 1 analogue, and preparation method and application thereof
WO2022071638A1 (en) Corynebacterium glutamicum variant having enhanced l-citrulline production capacity, and method for producing l-citrulline using same
JPH05199867A (en) New microorganism and production of d-biotin using the same
CN110551739A (en) Pyrazolomycin biosynthesis gene cluster, recombinant bacterium and application thereof
CN112029700B (en) Method for producing HIP-IPA (HIP-isopropyl alcohol) by microbial fermentation, genetically engineered bacteria and application
CN111349647B (en) CRISPR/Cas 9-mediated microbial secondary metabolite enhanced initiation system for additional endogenous RBS
CN114806992B (en) RSH over-expression genetic engineering amylase streptomyces chromogenes and method for improving fermentation yield of toyocamycin
CN108864221B (en) Aclacinomycin analogue and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination