CN107541567A - For detecting the LAMP primer composition and its application of 8 kinds of environment pathogens of mastitis for milk cows - Google Patents
For detecting the LAMP primer composition and its application of 8 kinds of environment pathogens of mastitis for milk cows Download PDFInfo
- Publication number
- CN107541567A CN107541567A CN201610499852.9A CN201610499852A CN107541567A CN 107541567 A CN107541567 A CN 107541567A CN 201610499852 A CN201610499852 A CN 201610499852A CN 107541567 A CN107541567 A CN 107541567A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- following
- missing
- substitution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of LAMP primer composition and its application for being used to detect 8 kinds of environment pathogens of mastitis for milk cows.Primer combination provided by the invention, is made up of 48 primers shown in sequence 1 to sequence 48.Primer combination provided by the invention can be applied to detect whether bacterium to be measured is Escherichia coli, Friedlander's bacillus, pseudomonas aeruginosa, streptococcus dysgalactiae, streptococcus uberis, salmonella typhimurium, proteus mirabilis or candida albicans, can be applied to detect in sample to be tested whether contain Escherichia coli and/or Friedlander's bacillus and/or pseudomonas aeruginosa and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and/or candida albicans.Primer combination identification provided by the invention is used to detect 8 kinds of environment pathogens of mastitis for milk cows, has high specific and high sensitivity, it is possible to achieve easy, quick, accurate detection.The present invention has great promotional value.
Description
Technical field
The present invention relates to a kind of LAMP primer composition and its application for being used to detect 8 kinds of environment pathogens of mastitis for milk cows.
Background technology
Mastitis for milk cows is the inflammation of newborn area's lactation tissue, is generally caused by bacterium infection, is fallen ill in one or more newborn areas,
Cause the output of milk to reduce, stop milk production, milk quality changes.Mastitis for milk cows influences 25-50% milk cow every year, is
The maximum disease of milk cattle cultivating loss.
Mastitis for milk cows is caused by a variety of unspecific pathogenic microorganisms, and what is had now been found that there are about (the bag of kind more than 150
Include coccus, bacillus, mycoplasma, fungi or saccharomycete, virus etc.), wherein relatively conventional is divided into infectiousness cause of disease
Body and non-infectious pathogen.It is reported that the whole world is lost caused by mastitis for milk cows every year, the U.S. dollar of the U.S. 2,000,000,000,
Britain 2.67 hundred million, 500,000,000 dollars of Japan, 3,000,000,000 yuan of China.Average each case loses about 200 dollars or so
(being roughly equal to 1200 yuan), lose and decline essentially from the output of milk and using milk is discarded caused by antibiotic, account for total losses
70%.
Inspection and quarantine at present work in be used for detect and identify bacterial method mainly have traditional isolated culture, PCR,
The simple molecular biology such as Southern Blot hybridization, enzyme linked immunosorbent assay (ELISA) and immunological method.
It is traditional be separately cultured, sensitivity be present in morphologic observation, Physiology and biochemistry, the method for the detection pathogen such as Selective agar medium
The distinguishing features such as low, poor specificity, workload are big, time-consuming, flux is low.Culture of microorganism, time-consuming needs
3-4d goes out examining report, it is impossible to meets timely for the purpose of pathogen treatment garget.Immunological technique is (such as
ELISA, often there is false positive in) high sensitivity, but easily pollution.A kind of species specificity of pathogen one of generally use is drawn
The primer specificity round pcr of the special pathogen inspection of thing, although can reach to the quick, correct of single bacterium and
Convenient diagnostic purpose, but in the non-name of pathogen, it is necessary to which a variety of different primers are tested, this is for pathogen
It is obviously not ideal enough for the diversity of complexity and PCR programs.Detection time length, easily pollution, false sun be present in PCR
Property rate it is high the shortcomings that, make its application be restricted.The above is used for the technology of the pathogenic microorganism examination and method is all present
Many technical problems, and in practice because pathogenic microorganism species is various, the above method is difficult while to a variety of disease
Pathogenic microorganism is efficiently detected.
The content of the invention
It is an object of the invention to provide a kind of LAMP primer composition for being used to detect 8 kinds of environment pathogens of mastitis for milk cows
And its application.
Present invention firstly provides a kind of combination of primer, for following (a1) or (a2) or (a3)：
(a1) by primer sets I, primer sets II, primer sets III, primer sets IV, primer sets V, primer sets VI, draw
Thing group VII and primer sets VIII form；
(a2) by the primer sets I, the primer sets II, the primer sets III, the primer sets IV, described draw
Thing group V, the primer sets VI, the primer sets VII and any two in the primer sets VIII, any three, times
Meaning four, it is any five, it is any six or it is any seven composition；
(a3) primer sets I, the primer sets II, the primer sets III, the primer sets IV, the primer
Group V, the primer sets VI, the primer sets VII or the primer sets VIII.
The primer sets I are by-the F3 of the primer I ,-B3 of the primer I ,-FIP of the primer I ,-BIP of the primer I ,-LF of primer I
Formed with-the LB of primer I；
- the F3 of primer I is following (b1) or (b2)；
(b1) single strand dna shown in the sequence 1 of sequence table；
(b2) sequence 1 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 1
There is the DNA molecular of identical function；
- the B3 of primer I is following (b3) or (b4)；
(b3) single strand dna shown in the sequence 2 of sequence table；
(b4) sequence 2 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 2
There is the DNA molecular of identical function；
- the FIP of primer I is following (b5) or (b6)；
(b5) single strand dna shown in the sequence 3 of sequence table；
(b6) sequence 3 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 3
There is the DNA molecular of identical function；
- the BIP of primer I is following (b7) or (b8)；
(b7) single strand dna shown in the sequence 4 of sequence table；
(b8) sequence 4 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 4
There is the DNA molecular of identical function；
- the LF of primer I is following (b9) or (b10)；
(b9) single strand dna shown in the sequence 5 of sequence table；
(b10) by sequence 5 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 5
DNA molecular with identical function；
- the LB of primer I is following (b11) or (b12)；
(b11) single strand dna shown in the sequence 6 of sequence table；
(b12) by sequence 6 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 6
DNA molecular with identical function.
The primer sets II are by-the F3 of the primer II ,-B3 of the primer II ,-FIP of the primer II ,-BIP of the primer II ,-LF of primer II
Formed with-the LB of primer II；
- the F3 of primer II is following (c1) or (c2)；
(c1) single strand dna shown in the sequence 7 of sequence table；
(c2) sequence 7 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 7
There is the DNA molecular of identical function；
- the B3 of primer II is following (c3) or (c4)；
(c3) single strand dna shown in the sequence 8 of sequence table；
(c4) sequence 8 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 8
There is the DNA molecular of identical function；
- the FIP of primer II is following (c5) or (c6)；
(c5) single strand dna shown in the sequence 9 of sequence table；
(c6) sequence 9 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 9
There is the DNA molecular of identical function；
- the BIP of primer II is following (c7) or (c8)；
(c7) single strand dna shown in the sequence 10 of sequence table；
(c8) by sequence 10 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 10
DNA molecular with identical function；
- the LF of primer II is following (c9) or (c 10)；
(c9) single strand dna shown in the sequence 11 of sequence table；
(c10) by sequence 11 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 11
DNA molecular with identical function；
- the LB of primer II is following (c11) or (c12)；
(c11) single strand dna shown in the sequence 12 of sequence table；
(c12) by sequence 12 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 12
DNA molecular with identical function.
The primer sets III are by-the F3 of the primer III ,-B3 of the primer III ,-FIP of the primer III ,-BIP of the primer III ,-LF of primer III
Formed with-the LB of primer III；
- the F3 of primer III is following (d1) or (d2)；
(d1) single strand dna shown in the sequence 13 of sequence table；
(d2) by sequence 13 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 13
DNA molecular with identical function；
- the B3 of primer III is following (d3) or (d4)；
(d3) single strand dna shown in the sequence 14 of sequence table；
(d4) by sequence 14 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 14
DNA molecular with identical function；
- the FIP of primer III is following (d5) or (d6)；
(d5) single strand dna shown in the sequence 15 of sequence table；
(d6) by sequence 15 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 15
DNA molecular with identical function；
- the BIP of primer III is following (d7) or (d8)；
(d7) single strand dna shown in the sequence 16 of sequence table；
(d8) by sequence 16 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 16
DNA molecular with identical function；
- the LF of primer III is following (d9) or (d10)；
(d9) single strand dna shown in the sequence 17 of sequence table；
(d10) by sequence 17 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 17
DNA molecular with identical function；
- the LB of primer III is following (d11) or (d12)；
(d11) single strand dna shown in the sequence 18 of sequence table；
(d12) by sequence 18 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 18
DNA molecular with identical function.
The primer sets IV are by-the F3 of the primer IV ,-B3 of the primer IV ,-FIP of the primer IV ,-BIP of the primer IV ,-LF of primer IV
Formed with-the LB of primer IV；
- the F3 of primer IV is following (e1) or (e2)；
(e1) single strand dna shown in the sequence 19 of sequence table；
(e2) by sequence 19 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 19
DNA molecular with identical function；
- the B3 of primer IV is following (e3) or (e4)；
(e3) single strand dna shown in the sequence 20 of sequence table；
(e4) by sequence 20 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 20
DNA molecular with identical function；
- the FIP of primer IV is following (e5) or (e6)；
(e5) single strand dna shown in the sequence 21 of sequence table；
(e6) by sequence 21 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 21
DNA molecular with identical function；
- the BIP of primer IV is following (e7) or (e8)；
(e7) single strand dna shown in the sequence 22 of sequence table；
(e8) by sequence 22 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 22
DNA molecular with identical function；
- the LF of primer IV is following (e9) or (e10)；
(e9) single strand dna shown in the sequence 23 of sequence table；
(e10) by sequence 23 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 23
DNA molecular with identical function；
- the LB of primer IV is following (e11) or (e12)；
(e11) single strand dna shown in the sequence 24 of sequence table；
(e12) by substitution of the sequence 24 by one or several nucleotides and/or missing and/or addition and and sequence 24
DNA molecular with identical function.
The primer sets V are by-the F3 of the primer V ,-B3 of the primer V ,-FIP of the primer V ,-BIP of the primer V ,-LF of primer V
Formed with-the LB of primer V；
- the F3 of primer V is following (f1) or (f2)；
(f1) single strand dna shown in the sequence 25 of sequence table；
(f2) by sequence 25 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 25
DNA molecular with identical function；
- the B3 of primer V is following (f3) or (f4)；
(f3) single strand dna shown in the sequence 26 of sequence table；
(f4) by sequence 26 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 26
DNA molecular with identical function；
- the FIP of primer V is following (f5) or (f6)；
(f5) single strand dna shown in the sequence 27 of sequence table；
(f6) by sequence 27 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 27
DNA molecular with identical function；
- the BIP of primer V is following (f7) or (f8)；
(f7) single strand dna shown in the sequence 28 of sequence table；
(f8) by sequence 28 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 28
DNA molecular with identical function；
- the LF of primer V is following (f9) or (f10)；
(f9) single strand dna shown in the sequence 29 of sequence table；
(f10) by sequence 29 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 29
DNA molecular with identical function；
- the LB of primer V is following (f11) or (f12)；
(f11) single strand dna shown in the sequence 30 of sequence table；
(f12) by sequence 30 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 30
DNA molecular with identical function.
The primer sets VI are by-the F3 of the primer VI ,-B3 of the primer VI ,-FIP of the primer VI ,-BIP of the primer VI ,-LF of primer VI
Formed with-the LB of primer VI；
- the F3 of primer VI is following (g1) or (g2)；
(g1) single strand dna shown in the sequence 31 of sequence table；
(g2) by sequence 31 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 31
DNA molecular with identical function；
- the B3 of primer VI is following (g3) or (g4)；
(g3) single strand dna shown in the sequence 32 of sequence table；
(g4) by sequence 32 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 32
DNA molecular with identical function；
- the FIP of primer VI is following (g5) or (g6)；
(g5) single strand dna shown in the sequence 33 of sequence table；
(g6) by sequence 33 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 33
DNA molecular with identical function；
- the BIP of primer VI is following (g7) or (g8)；
(g7) single strand dna shown in the sequence 34 of sequence table；
(g8) by sequence 34 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 34
DNA molecular with identical function；
- the LF of primer VI is following (g9) or (g10)；
(g9) single strand dna shown in the sequence 35 of sequence table；
(g10) by sequence 35 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 35
DNA molecular with identical function；
- the LB of primer VI is following (g11) or (g12)；
(g11) single strand dna shown in the sequence 36 of sequence table；
(g12) by sequence 36 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 36
DNA molecular with identical function.
The primer sets VII are by-the F3 of the primer VII ,-B3 of the primer VII ,-FIP of the primer VII ,-BIP of the primer VII ,-LF of primer VII
Formed with-the LB of primer VII；
- the F3 of primer VII is following (h1) or (h2)；
(h1) single strand dna shown in the sequence 37 of sequence table；
(h2) by sequence 37 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 37
DNA molecular with identical function；
- the B3 of primer VII is following (h3) or (h4)；
(h3) single strand dna shown in the sequence 38 of sequence table；
(h4) by sequence 38 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 38
DNA molecular with identical function；
- the FIP of primer VII is following (h5) or (h6)；
(h5) single strand dna shown in the sequence 39 of sequence table；
(h6) by sequence 39 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 39
DNA molecular with identical function；
- the BIP of primer VII is following (h7) or (h8)；
(h7) single strand dna shown in the sequence 40 of sequence table；
(h8) by sequence 40 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 40
DNA molecular with identical function；
- the LF of primer VII is following (h9) or (h10)；
(h9) single strand dna shown in the sequence 41 of sequence table；
(h10) by sequence 41 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 41
DNA molecular with identical function；
- the LB of primer VII is following (h11) or (h12)；
(h11) single strand dna shown in the sequence 42 of sequence table；
(h12) by sequence 42 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 42
DNA molecular with identical function.
The primer sets VIII are by-the F3 of the primer VIII ,-B3 of the primer VIII ,-FIP of the primer VIII ,-BIP of the primer VIII ,-LF of primer VIII
Formed with-the LB of primer VIII；
- the F3 of primer VIII is following (i1) or (i2)；
(i1) single strand dna shown in the sequence 43 of sequence table；
(i2) by sequence 43 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 43
DNA molecular with identical function；
- the B3 of primer VIII is following (i3) or (i4)；
(i3) single strand dna shown in the sequence 44 of sequence table；
(i4) by sequence 44 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 44
DNA molecular with identical function；
- the FIP of primer VIII is following (i5) or (i6)；
(i5) single strand dna shown in the sequence 45 of sequence table；
(i6) by sequence 45 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 45
DNA molecular with identical function；
- the BIP of primer VIII is following (i7) or (i8)；
(i7) single strand dna shown in the sequence 46 of sequence table；
(i8) by sequence 46 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 46
DNA molecular with identical function；
- the LF of primer VIII is following (i9) or (i10)；
(i9) single strand dna shown in the sequence 47 of sequence table；
(i10) by sequence 47 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 47
DNA molecular with identical function；
- the LB of primer VIII is following (i11) or (i12)；
(i11) single strand dna shown in the sequence 48 of sequence table；
(i12) by sequence 48 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 48
DNA molecular with identical function.
In the primer sets I ,-the F3 of the primer I ,-B3 of the primer I ,-FIP of the primer I ,-BIP of the primer I ,-LF of primer I
With-the LB of primer I mol ratio concretely 0.5：0.5：2：2：1：1.
In the primer sets II ,-the F3 of the primer II ,-B3 of the primer II ,-FIP of the primer II ,-BIP of the primer II ,-LF of primer II
With-the LB of primer II mol ratio concretely 0.5：0.5：2：2：1：1.
In the primer sets III ,-the F3 of the primer III ,-B3 of the primer III ,-FIP of the primer III ,-BIP of the primer III ,-LF of primer III
With-the LB of primer III mol ratio concretely 0.5：0.5：2：2：1：1.
In the primer sets IV ,-the F3 of the primer IV ,-B3 of the primer IV ,-FIP of the primer IV ,-BIP of the primer IV ,-LF of primer IV
With-the LB of primer IV mol ratio concretely 0.5：0.5：2：2：1：1.
In the primer sets V ,-the F3 of the primer V ,-B3 of the primer V ,-FIP of the primer V ,-BIP of the primer V ,-LF of primer V
With-the LB of primer V mol ratio concretely 0.5：0.5：2：2：1：1.
In the primer sets VI ,-the F3 of the primer VI ,-B3 of the primer VI ,-FIP of the primer VI ,-BIP of the primer VI ,-LF of primer VI
With-the LB of primer VI mol ratio concretely 0.5：0.5：2：2：1：1.
In the primer sets VII ,-the F3 of the primer VII ,-B3 of the primer VII ,-FIP of the primer VII ,-BIP of the primer VII ,-LF of primer VII
With-the LB of primer VII mol ratio concretely 0.5：0.5：2：2：1：1.
In the primer sets VIII ,-the F3 of the primer VIII ,-B3 of the primer VIII ,-FIP of the primer VIII ,-BIP of the primer VIII ,-LF of primer VIII
With-the LB of primer VIII mol ratio concretely 0.5：0.5：2：2：1：1.
The present invention also protects the primer to combine the application in reagent preparation box；The purposes of the kit is following (j1)
Or (j2)：
(j1) identify Escherichia coli and/or Friedlander's bacillus and/or pseudomonas aeruginosa and/or streptococcus dysgalactiae and
/ or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and/or candida albicans；
(j2) it is used to detect whether false containing Escherichia coli and/or Friedlander's bacillus and/or verdigris in sample to be tested
Monad and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and
/ or candida albicans.
Kit containing primer combination falls within protection scope of the present invention；The purposes of the kit is as follows
Or (j2) (j1)：
(j1) identify Escherichia coli and/or Friedlander's bacillus and/or pseudomonas aeruginosa and/or streptococcus dysgalactiae and
/ or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and/or candida albicans；
(j2) it is used to detect whether false containing Escherichia coli and/or Friedlander's bacillus and/or verdigris in sample to be tested
Monad and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and
/ or candida albicans.
The present invention also protects the preparation method of the kit, including the step of each bar primer is individually packed.
The present invention also protection is a kind of detect bacterium to be measured whether be Escherichia coli, Friedlander's bacillus, pseudomonas aeruginosa,
Streptococcus dysgalactiae, streptococcus uberis, salmonella typhimurium, the method for proteus mirabilis or candida albicans, bag
Include following steps：
(1) genomic DNA of bacterium to be measured is extracted；
(2) using the genomic DNA of step (1) extraction as template, each drawing in the primer combination is respectively adopted
Thing group carries out ring mediated isothermal amplification, then makes the following judgment：
If the primer sets I are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be Escherichia coli；
If the primer sets II are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be Friedlander's bacillus；
If the primer sets III are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be pseudomonas aeruginosa；
If the primer sets IV are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be streptococcus dysgalactiae；
If the primer sets V are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be streptococcus uberis；
If the primer sets VI are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be salmonella typhimurium；
If the primer sets VII are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be proteus mirabilis；
If the primer sets VIII are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be candida albicans.
In a kind of detection sample to be tested of the present invention also protection whether containing Escherichia coli and/or Friedlander's bacillus and/or
Pseudomonas aeruginosa and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and/or unusual deformation
Bacillus and/or the method for candida albicans, comprise the following steps：
(1) STb gene of sample to be tested is extracted；
(2) using the STb gene of step (1) extraction as template, each primer sets in the primer combination are respectively adopted
Ring mediated isothermal amplification is carried out, is then made the following judgment：
If the specific amplification using the STb gene as template can be realized by using the primer sets I, in sample to be tested
Contain or doubtful containing Escherichia coli；
If the specific amplification using the STb gene as template can be realized by using the primer sets II, in sample to be tested
Contain or doubtful containing Friedlander's bacillus；
If the specific amplification using the STb gene as template can be realized by using the primer sets III, in sample to be tested
Contain or doubtful containing pseudomonas aeruginosa；
If the specific amplification using the STb gene as template can be realized by using the primer sets IV, in sample to be tested
Contain or doubtful containing streptococcus dysgalactiae；
If the specific amplification using the STb gene as template can be realized by using the primer sets V, in sample to be tested
Contain or doubtful containing streptococcus uberis；
If the specific amplification using the STb gene as template can be realized by using the primer sets VI, in sample to be tested
Contain or doubtful containing salmonella typhimurium；
If the specific amplification using the STb gene as template can be realized by using the primer sets VII, in sample to be tested
Contain or doubtful containing proteus mirabilis；
If the specific amplification using the STb gene as template can be realized by using the primer sets VIII, in sample to be tested
Contain or doubtful containing candida albicans.
In any of the above methods described, during using the primer sets I, in the reaction system of the ring mediated isothermal amplification
- the F3 of primer I ,-the B3 of primer I ,-the FIP of primer I ,-the BIP of primer I ,-the LF of primer I and the-LB of primer I it is mole dense
Degree is followed successively by 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, during using the primer sets II, in the reaction system of the ring mediated isothermal amplification
- the F3 of primer II ,-the B3 of primer II ,-the FIP of primer II ,-the BIP of primer II ,-the LF of primer II and the-LB of primer II it is mole dense
Degree is followed successively by 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, during using the primer sets III, in the reaction system of the ring mediated isothermal amplification
- the F3 of primer III ,-the B3 of primer III ,-the FIP of primer III ,-the BIP of primer III ,-the LF of primer III and the-LB of primer III it is mole dense
Degree is followed successively by 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, during using the primer sets IV, in the reaction system of the ring mediated isothermal amplification
- the F3 of primer IV ,-the B3 of primer IV ,-the FIP of primer IV ,-the BIP of primer IV ,-the LF of primer IV and the-LB of primer IV it is mole dense
Degree is followed successively by 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, during using the primer sets V, in the reaction system of the ring mediated isothermal amplification
- the F3 of primer V ,-the B3 of primer V ,-the FIP of primer V ,-the BIP of primer V ,-the LF of primer V and the-LB of primer V it is mole dense
Degree is followed successively by 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, during using the primer sets VI, in the reaction system of the ring mediated isothermal amplification
- the F3 of primer VI ,-the B3 of primer VI ,-the FIP of primer VI ,-the BIP of primer VI ,-the LF of primer VI and the-LB of primer VI it is mole dense
Degree is followed successively by 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, during using the primer sets VII, in the reaction system of the ring mediated isothermal amplification
- the F3 of primer VII ,-the B3 of primer VII ,-the FIP of primer VII ,-the BIP of primer VII ,-the LF of primer VII and the-LB of primer VII it is mole dense
Degree is followed successively by 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, during using the primer sets VIII, in the reaction system of the ring mediated isothermal amplification
- the F3 of primer VIII ,-the B3 of primer VIII ,-the FIP of primer VIII ,-the BIP of primer VIII ,-the LF of primer VIII and the-LB of primer VIII it is mole dense
Degree is followed successively by 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any of the above methods described, loop-mediated isothermal amplification condition is：65 DEG C of constant temperature 50min.
Whether it is Escherichia coli, Friedlander's bacillus, copper that the present invention also protects the primer to combine detecting bacterium to be measured
Green pseudomonad, streptococcus dysgalactiae, streptococcus uberis, salmonella typhimurium, proteus mirabilis or white false silk ferment
Application in mother.
The present invention also protects whether the primer combination contains Escherichia coli and/or kerekou pneumonia in sample to be tested is detected
Primary Salmonella and/or pseudomonas aeruginosa and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and
/ or proteus mirabilis and/or candida albicans in application.
The bacterial strain that concretely ATCC numberings are 8739 of Escherichia coli described in any of the above.Kerekou pneumonia described in any of the above
The primary Salmonella bacterial strain that concretely ATCC numberings are 13883.The concretely CVCC of pseudomonas aeruginosa described in any of the above
The bacterial strain that numbering is 3359.The bacterial strain that concretely ATCC numberings are 12388 of streptococcus dysgalactiae described in any of the above.With
Upper any streptococcus uberis bacterial strain that concretely ATCC numberings are 700407.Mouse typhus sramana described in any of the above
The Salmonella bacterial strain that concretely ATCC numberings are 14028.Concretely CVCC is compiled proteus mirabilis described in any of the above
Number be 1969 bacterial strain.The bacterial strain that concretely CGMCC numberings are 2.2086 of candida albicans described in any of the above.
Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years
A kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed, its principle are that have strand displacement in one kind
Activity archaeal dna polymerase in the presence of, identify 6-8 region 4-6 bar primers, under isothermal conditions quickly,
Specifically amplifying target genes, it can be applied to and fast and accurately detect common mastitis for milk cows pathogen.LAMP
Method has sensitivity height, specificity is good, the reaction time is short, result of determination is convenient, does not need the advantages such as expensive instrument.
Primer combination identification provided by the invention is used to detect 8 kinds of environment pathogens of mastitis for milk cows, has high special
Property and high sensitivity, it is possible to achieve easy, quick, accurate detection.The present invention has great promotional value.
Brief description of the drawings
Fig. 1 is the result that primer sets I are used in embodiment 2.
Fig. 2 is the result that primer sets II are used in embodiment 2.
Fig. 3 is the result that primer sets III are used in embodiment 2.
Fig. 4 is the result that primer sets IV are used in embodiment 2.
Fig. 5 is the result that primer sets V are used in embodiment 2.
Fig. 6 is the result that primer sets VI are used in embodiment 2.
Fig. 7 is the result that primer sets VII are used in embodiment 2.
Fig. 8 is the result that primer sets VIII are used in embodiment 2.
Fig. 9 is the result of sample one in embodiment 4.
Figure 10 is the result of sample two in embodiment 4.
Figure 11 is the result of sample three in embodiment 4.
Embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, it is conventional method unless otherwise specified.Test material used in following embodiments, unless otherwise specified,
It is to be commercially available from routine biochemistry reagent shop.Quantitative test in following examples, is respectively provided with and repeats reality three times
Test, results averaged.
CVCC full name are Chinese veterinary microorganism culture presevation administrative center, and network address is
http://www.cvcc.org.cn/.CGMCC full name are China General Microbiological culture presevation administrative center, and network address is
http://www.cgmcc.net/.ATCC full name are American Type Culture Collection center, and network address is
http://www.atcc.org/。
The computational methods of DNA copy number are as follows：
The μ g/ml of 1A260 absorbances=ds DNA 50；
Nucleic acid concentration=(OD260) × (extension rate) × (50)=x ng/ μ l；
Mean molecule quantity (MW) representative gram/mol, unit dalton (dolton), i.e. 1dolton=1g/mol；
Mole=6.02 × 1023；
Mean molecule quantity (MW):DsDNA=(base number) × (660 dalton/base)；
Copy number calculation formula:
(6.02×1023Copies/ moles) × (x ng/ μ l × 10-9)/(DNA length × 660)=copies/ μ l.
The genomic DNA length of Escherichia coli is 5.5Mb.The genomic DNA length of Friedlander's bacillus is 5.33
Mb.The genomic DNA length of pseudomonas aeruginosa is 6.26Mb.The genomic DNA length of streptococcus dysgalactiae is 2.18
Mb.The genomic DNA length of streptococcus uberis is 1.85Mb.The genomic DNA length of salmonella typhimurium is
4.86Mb.The genomic DNA length of proteus mirabilis is 4.06Mb.The genomic DNA length of candida albicans
Spend for 27.56Mb.
The preparation of embodiment 1, kit
Kit is made up of eight LAMP primer groups, and each primer sets are used to detect a kind of Environmental cause of disease of mastitis for milk cows
Body.
It is following (5 ' → 3 ') for detecting Escherichia coli primer sets：
Outer primer F3 (sequence 1)：TGTGGAATTGATCAGCGTT；
Outer primer B3 (sequence 2)：TGATTATTGACCCACACTTTG；
Inner primer FIP (sequence 3)：TCTGCATCGGCGAACTGATCGGGTGGGAAAGCGCGTTAC；
Inner primer BIP (sequence 4)：TCTGGTATCAGCGCGAAGTCTAATGAGTGACCGCATCGA；
Ring primer LF (sequence 5)：GCAATTGCCCGGCTTTCTT；
Ring primer LB (sequence 6)：GCAGGCCAGCGTATCGT.
It is following (5 ' → 3 ') for detecting Friedlander's bacillus primer sets：
Outer primer F3 (sequence 7)：ATACAAAAACACCAGTGTAGG；
Outer primer B3 (sequence 8)：GCCGCCAGTTTGTTTCAG；
Inner primer FIP (sequence 9)：CGTTGAGATTTGCGAAGTACCAAGAATCAAATATGCTGCAAATGTG；
Inner primer BIP (sequence 10)：CAAACGCATAATAAGCAGGTGATTTCGGAGGTGATGTTTTCGGTC；
Ring primer LF (sequence 11)：TGCCCGGCCATC；
Ring primer LB (sequence 12)：ATCATATCGTTCGGCT.
It is following (5 ' → 3 ') for detecting pseudomonas aeruginosa primer sets：
Outer primer F3 (sequence 13)：CAAGGTGTTCATCCACGA；
Outer primer B3 (sequence 14)：CGCTCCAGCGCTTTTCC；
Inner primer FIP (sequence 15)：ACTCGTCGCCCATCTCGATGGACTGAACGCCGGTAACCA；
Inner primer BIP (sequence 16)：GCACGAGAGCAACGAGATGCGTCTGGGCCATGACCAC；
Ring primer LF (sequence 17)：TGTAGATCGGCGACATGTG；
Ring primer LB (sequence 18)：CATCAGCCATGCCGGGGTC.
It is following (5 ' → 3 ') for detecting streptococcus dysgalactiae primer sets：
Outer primer F3 (sequence 19)：GACTGCGCGTGATTCGA；
Outer primer B3 (sequence 20)：AGACCAAATCACGGTAAATCC；
Inner primer FIP (sequence 21)：CAATAGCAAATGGCTTCACAATGTTATGGATGTGGTTGCGGGA；
Inner primer BIP (sequence 22)：TATTGGCTCGTATCCGTGCCACTAGGGGTTTTCTTCTCAGAT；
Ring primer LF (sequence 23)：CATCCGCTCCACGGTCTAA；
Ring primer LB (sequence 24)：ATTTTCCGTCGCCAAGATATCG.
It is following (5 ' → 3 ') for detecting streptococcus uberis primer sets：
Outer primer F3 (sequence 25)：GCATGTTATTCTCAGAAAACGG；
Outer primer B3 (sequence 26)：GCAAAAGCTTTTCTTCTGCA；
Inner primer FIP (sequence 27)：AGTCGCGAATTGAACTTTATACTCATGAAGAACCTATCACTCATCCT；
Inner primer BIP (sequence 28)：TCCACCCACTACCTATTTTTGTAGATTTTTCGAAACTCGTCAGAGG；
Ring primer LF (sequence 29)：ATATTAGCAGTCTCAGT；
Ring primer LB (sequence 30)：CTACGGAGAAAAACATATT.
It is following (5 ' → 3 ') for detecting salmonella typhimurium primer sets：
Outer primer F3 (sequence 31)：ATTTCATGCTTGTAGGCAATA；
Outer primer B3 (sequence 32)：AGCCACATGAAGTGGATTC；
Inner primer FIP (sequence 33)：GCCATACCCTCTTCACTCTTTTATCGGTCATACTACGTAACGCC；
Inner primer BIP (sequence 34)：ATCTGCAAAAAGGATGCATGTTCGCTGTTAGCCGATATTATAGGTT；
Ring primer LF (sequence 35)：GAAGAATATTGGCAGGAAGAATTGT；
Ring primer LB (sequence 36)：ATGACTAAGCAATAACGCATTCA.
It is following (5 ' → 3 ') for detecting proteus mirabilis primer sets：
Outer primer F3 (sequence 37)：CCACAGCGATGACTAATTTGAAAC；
Outer primer B3 (row 38)：GCCAAAAAACCAGGCGAT；
Inner primer FIP (sequence 39)：CGTCGTCATTTAAGTAAAGAGGGCGAATGCGATCCCCATTCTGA；
Inner primer BIP (sequence 40)：TAATGTTGATGGCGTAGTATAGAGCCTCATCTAATAACACAAGATCCGC；
Ring primer LF (sequence 41)：TCGTTTTGTCAATTACTGTTGGA；
Ring primer LB (sequence 42)：CTACATCCTCTAAATGCCATTTACG.
It is following (5 ' → 3 ') for detecting candida albicans primer sets：
Outer primer F3 (sequence 43)：CGATACGTAATATGAATTGCAGAT；
Outer primer B3 (sequence 44)：CCATTGTCAAAGCGATCC；
Inner primer FIP (sequence 45)：AGGCATGCCCTCCGGAATACTCGTGAATCATCGAATCTTTGAAC；
Inner primer BIP (sequence 46)：GAGCGTCGTTTCTCCCTCAAACCGCCTTACCACTACCGTCTT；
Ring primer LF (sequence 47)：AGAGGGCGCAATGTGC；
Ring primer LB (sequence 48)：TGTTGAGCAATACGACTTGGGTTTG.
Primer sets for detecting Escherichia coli are named as primer sets I.For detecting the primer sets of Friedlander's bacillus
It is named as primer sets II.Primer sets for detecting pseudomonas aeruginosa are named as primer sets III.Stop newborn chain for detecting
The primer sets of coccus are named as primer sets IV.Primer sets for detecting streptococcus uberis are named as primer sets V.For
The primer sets of detection salmonella typhimurium are named as primer sets VI.Primer sets for detecting proteus mirabilis are named
For primer sets VII.Primer sets for detecting candida albicans are named as primer sets VIII.
Embodiment 2, specificity
Sample to be tested 1：Escherichia coli (8739TM)。
Sample to be tested 2：Friedlander's bacillus (13883TM)。
Sample to be tested 3：Pseudomonas aeruginosa (CVCC 3359).
Sample to be tested 4：Streptococcus dysgalactiae (12388TM)。
Sample to be tested 5：Streptococcus uberis (700407TM)。
Sample to be tested 6：Salmonella typhimurium (14028TM)。
Sample to be tested 7：Proteus mirabilis (CVCC 1969).
Sample to be tested 8：Candida albicans (CGMCC 2.2086).
Each sample to be tested carries out following steps respectively：
1st, the genomic DNA of sample to be tested is extracted.
2nd, as template, each primer sets that the preparation of embodiment 1 is respectively adopted are carried out the genomic DNA extracted using step 1
Ring mediated isothermal amplification.
Reaction system (10 μ L)：7.0 μ L reaction solutions (Capitalbio Corporation Co., Ltd.'s product, its catalog number
For CP.440020), 1 μ L primer mixtures, 1 μ L template DNAs (5pg-50pg), moisturizing to 10 μ L.Primer
Mixture is the mixture of each bar primer composition in primer sets.In reaction system, outer primer F3 and outer primer B3's
Final concentration is 0.5 μM, and inner primer FIP and inner primer BIP final concentration are 2 μM, and ring primer LF and ring draw
Thing LB final concentration is 1 μM.
Reaction condition：65 DEG C of constant temperature 50min.
In course of reaction, fluorescence signal is detected using fluorescent PCR instrument.
Result using primer sets I is shown in Fig. 1.Positive amplification song is only shown when sample to be tested is Escherichia coli
Line.Positive amplification curve is not shown when sample to be tested is sample to be tested 2,3,4,5,6,7,8.
Result using primer sets II is shown in Fig. 2.Only the positive is shown when sample to be tested is Friedlander's bacillus
Amplification curve.Positive amplification song is not shown when sample to be tested is sample to be tested 1,3,4,5,6,7,8
Line.
Result using primer sets III is shown in Fig. 3.Positive expansion is only shown when sample to be tested is pseudomonas aeruginosa
Increase curve.Positive amplification curve is not shown when sample to be tested is sample to be tested 1,2,4,5,6,7,8.
Result using primer sets IV is shown in Fig. 4.Only positive amplification is shown when sample to be tested is streptococcus dysgalactiae
Curve.Positive amplification curve is not shown when sample to be tested is sample to be tested 1,2,3,5,6,7,8.
Result using primer sets V is shown in Fig. 5.Only positive amplification is shown when sample to be tested is streptococcus uberis
Curve.Positive amplification curve is not shown when sample to be tested is sample to be tested 1,2,3,4,6,7,8.
Result using primer sets VI is shown in Fig. 6.Only the positive is shown when sample to be tested is salmonella typhimurium
Amplification curve.Positive amplification song is not shown when sample to be tested is sample to be tested 1,2,3,4,5,7,8
Line.
Result using primer sets VII is shown in Fig. 7.Positive expansion is only shown when sample to be tested is proteus mirabilis
Increase curve.Positive amplification curve is not shown when sample to be tested is sample to be tested 1,2,3,4,5,6,8.
Result using primer sets VIII is shown in Fig. 8.Only positive amplification is shown when sample to be tested is candida albicans
Curve.Positive amplification curve is not shown when sample to be tested is sample to be tested 1,2,3,4,5,6,7.
Result above shows that eight primer sets provided by the invention have very high specificity to its target bacterium respectively.
Embodiment 3, sensitivity results
Sample to be tested 1：Escherichia coli (8739TM)。
Sample to be tested 2：Friedlander's bacillus (13883TM)。
Sample to be tested 3：Pseudomonas aeruginosa (CVCC 3359).
Sample to be tested 4：Streptococcus dysgalactiae (12388TM)。
Sample to be tested 5：Streptococcus uberis (700407TM)。
Sample to be tested 6：Salmonella typhimurium (14028TM)。
Sample to be tested 7：Proteus mirabilis (CVCC 1969).
Sample to be tested 8：Candida albicans (CGMCC 2.2086).
1st, the genomic DNA of sample to be tested is extracted, gradient dilution is carried out with sterilized water, obtains each dilution.
2nd, using the dilution that step 1 obtains as template, the primer sets that the preparation of embodiment 1 is respectively adopted carry out ring mediation etc.
Temperature amplification.
When sample to be tested is sample to be tested 1, ring mediated isothermal amplification is carried out using primer sets I.Sample to be tested is to be measured
During sample 2, ring mediated isothermal amplification is carried out using primer sets II.When sample to be tested is sample to be tested 3, using primer
Group III carries out ring mediated isothermal amplification.When sample to be tested is sample to be tested 4, ring mediated isothermal is carried out using primer sets IV
Amplification.When sample to be tested is sample to be tested 5, ring mediated isothermal amplification is carried out using primer sets V.Sample to be tested is to treat
During test sample sheet 6, ring mediated isothermal amplification is carried out using primer sets VI.When sample to be tested is sample to be tested 7, using drawing
Thing group VII carries out ring mediated isothermal amplification.When sample to be tested is sample to be tested 8, ring mediation etc. is carried out using primer sets VIII
Temperature amplification.
Reaction system (10 μ L)：7.0 μ L reaction solutions (Capitalbio Corporation Co., Ltd.'s product, its catalog number
For CP.440020), 1 μ L primer mixtures, the 1 μ L dilutions (genome copy numbers contained in 1 μ L dilutions
Respectively 103、102Or 101), moisturizing to 10 μ L.Primer mixture is the mixed of each bar primer composition in primer sets
Compound.In reaction system, outer primer F3 and outer primer B3 final concentration are 0.5 μM, inner primer FIP and interior are drawn
Thing BIP final concentration is 2 μM, and ring primer LF and ring primer LB final concentration are 1 μM.
Reaction condition：65 DEG C of constant temperature 50min.
In course of reaction, fluorescence signal is detected using fluorescent PCR instrument.
If occurring positive amplification curve in 50min, show that the corresponding gene group content in reaction system can be detected
Measure and.If not occurring positive amplification curve in 50min, show the corresponding gene group content in reaction system
It can not be detected.
The sensitivity that primer sets I detect target bacterium is 102Individual copy number/reaction system, primer sets II detect target bacterium
Sensitivity is 103Individual copy number/reaction system, the sensitivity that primer sets III detect target bacterium are 103Individual copy number/reaction
System, the sensitivity that primer sets IV detect target bacterium are 102Individual copy number/reaction system, primer sets V detect target bacterium
Sensitivity be 102Individual copy number/reaction system, the sensitivity that primer sets VI detect target bacterium are 103Individual copy number/anti-
System is answered, the sensitivity that primer sets VII detect target bacterium is 103Individual copy number/reaction system, primer sets VIII detect target
The sensitivity of bacterium is 101Individual copy number/reaction system.
Embodiment 4, application
Sample to be tested is following sample one, sample two or sample three：
Sample one：Identified by Bacteria Culture and confirm the milk containing Escherichia coli；
Sample two：Identified by Bacteria Culture and confirm the milk containing Friedlander's bacillus；
Sample three：Identified by Bacteria Culture and confirm the milk containing streptococcus uberis.
1st, the STb gene of sample to be tested is extracted.
2nd, for the STb gene extracted using step 1 as template, each primer sets that the preparation of embodiment 1 is respectively adopted carry out ring Jie
Lead isothermal duplication.
Reaction system is with reaction condition with embodiment 2.
In course of reaction, fluorescence signal is detected using fluorescent PCR instrument.
1st, the STb gene of sample to be tested is extracted.
The result of sample one is shown in Fig. 9.Positive amplification curve is shown when only using primer sets I.When using primer
Positive amplification curve is not shown when organizing other seven primer sets beyond I.
The result of sample two is shown in Figure 10.Positive amplification curve is shown when only using primer sets II.When using primer
Positive amplification curve is not shown when organizing other seven primer sets beyond II.
The result of sample three is shown in Figure 11.Positive amplification curve is shown when only using primer sets V.When using primer
Positive amplification curve is not shown when organizing other seven primer sets beyond V.
Result above shows, the inspection for carrying out 8 kinds of mastitis for milk cows environment pathogens is combined using primer provided by the invention
Survey, as a result accurately and reliably.
Claims (8)
1. primer combines, for following (a1) or (a2) or (a3)：
(a1) by primer sets I, primer sets II, primer sets III, primer sets IV, primer sets V, primer sets VI, draw
Thing group VII and primer sets VIII form；
(a2) by the primer sets I, the primer sets II, the primer sets III, the primer sets IV, described draw
Thing group V, the primer sets VI, the primer sets VII and any two in the primer sets VIII, any three, times
Meaning four, it is any five, it is any six or it is any seven composition；
(a3) primer sets I, the primer sets II, the primer sets III, the primer sets IV, the primer
Group V, the primer sets VI, the primer sets VII or the primer sets VIII；
The primer sets I are by-the F3 of the primer I ,-B3 of the primer I ,-FIP of the primer I ,-BIP of the primer I ,-LF of primer I
Formed with-the LB of primer I；
- the F3 of primer I is following (b1) or (b2)；
(b1) single strand dna shown in the sequence 1 of sequence table；
(b2) sequence 1 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 1
There is the DNA molecular of identical function；
- the B3 of primer I is following (b3) or (b4)；
(b3) single strand dna shown in the sequence 2 of sequence table；
(b4) sequence 2 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 2
There is the DNA molecular of identical function；
- the FIP of primer I is following (b5) or (b6)；
(b5) single strand dna shown in the sequence 3 of sequence table；
(b6) sequence 3 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 3
There is the DNA molecular of identical function；
- the BIP of primer I is following (b7) or (b8)；
(b7) single strand dna shown in the sequence 4 of sequence table；
(b8) sequence 4 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 4
There is the DNA molecular of identical function；
- the LF of primer I is following (b9) or (b10)；
(b9) single strand dna shown in the sequence 5 of sequence table；
(b10) by sequence 5 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 5
DNA molecular with identical function；
- the LB of primer I is following (b11) or (b12)；
(b11) single strand dna shown in the sequence 6 of sequence table；
(b12) by sequence 6 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 6
DNA molecular with identical function；
The primer sets II are by-the F3 of the primer II ,-B3 of the primer II ,-FIP of the primer II ,-BIP of the primer II ,-LF of primer II
Formed with-the LB of primer II；
- the F3 of primer II is following (c1) or (c2)；
(c1) single strand dna shown in the sequence 7 of sequence table；
(c2) sequence 7 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 7
There is the DNA molecular of identical function；
- the B3 of primer II is following (c3) or (c4)；
(c3) single strand dna shown in the sequence 8 of sequence table；
(c4) sequence 8 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 8
There is the DNA molecular of identical function；
- the FIP of primer II is following (c5) or (c6)；
(c5) single strand dna shown in the sequence 9 of sequence table；
(c6) sequence 9 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 9
There is the DNA molecular of identical function；
- the BIP of primer II is following (c7) or (c8)；
(c7) single strand dna shown in the sequence 10 of sequence table；
(c8) by sequence 10 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 10
DNA molecular with identical function；
- the LF of primer II is following (c9) or (c 10)；
(c9) single strand dna shown in the sequence 11 of sequence table；
(c10) by sequence 11 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 11
DNA molecular with identical function；
- the LB of primer II is following (c11) or (c12)；
(c11) single strand dna shown in the sequence 12 of sequence table；
(c12) by sequence 12 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 12
DNA molecular with identical function；
The primer sets III are by-the F3 of the primer III ,-B3 of the primer III ,-FIP of the primer III ,-BIP of the primer III ,-LF of primer III
Formed with-the LB of primer III；
- the F3 of primer III is following (d1) or (d2)；
(d1) single strand dna shown in the sequence 13 of sequence table；
(d2) by sequence 13 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 13
DNA molecular with identical function；
- the B3 of primer III is following (d3) or (d4)；
(d3) single strand dna shown in the sequence 14 of sequence table；
(d4) by sequence 14 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 14
DNA molecular with identical function；
- the FIP of primer III is following (d5) or (d6)；
(d5) single strand dna shown in the sequence 15 of sequence table；
(d6) by sequence 15 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 15
DNA molecular with identical function；
- the BIP of primer III is following (d7) or (d8)；
(d7) single strand dna shown in the sequence 16 of sequence table；
(d8) by sequence 16 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 16
DNA molecular with identical function；
- the LF of primer III is following (d9) or (d10)；
(d9) single strand dna shown in the sequence 17 of sequence table；
(d10) by sequence 17 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 17
DNA molecular with identical function；
- the LB of primer III is following (d11) or (d12)；
(d11) single strand dna shown in the sequence 18 of sequence table；
(d12) by sequence 18 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 18
DNA molecular with identical function；
The primer sets IV are by-the F3 of the primer IV ,-B3 of the primer IV ,-FIP of the primer IV ,-BIP of the primer IV ,-LF of primer IV
Formed with-the LB of primer IV；
- the F3 of primer IV is following (e1) or (e2)；
(e1) single strand dna shown in the sequence 19 of sequence table；
(e2) by sequence 19 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 19
DNA molecular with identical function；
- the B3 of primer IV is following (e3) or (e4)；
(e3) single strand dna shown in the sequence 20 of sequence table；
(e4) by sequence 20 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 20
DNA molecular with identical function；
- the FIP of primer IV is following (e5) or (e6)；
(e5) single strand dna shown in the sequence 21 of sequence table；
(e6) by sequence 21 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 21
DNA molecular with identical function；
- the BIP of primer IV is following (e7) or (e8)；
(e7) single strand dna shown in the sequence 22 of sequence table；
(e8) by sequence 22 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 22
DNA molecular with identical function；
- the LF of primer IV is following (e9) or (e10)；
(e9) single strand dna shown in the sequence 23 of sequence table；
(e10) by sequence 23 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 23
DNA molecular with identical function；
- the LB of primer IV is following (e11) or (e12)；
(e11) single strand dna shown in the sequence 24 of sequence table；
(e12) by substitution of the sequence 24 by one or several nucleotides and/or missing and/or addition and and sequence 24
DNA molecular with identical function；
The primer sets V are by-the F3 of the primer V ,-B3 of the primer V ,-FIP of the primer V ,-BIP of the primer V ,-LF of primer V
Formed with-the LB of primer V；
- the F3 of primer V is following (f1) or (f2)；
(f1) single strand dna shown in the sequence 25 of sequence table；
(f2) by sequence 25 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 25
DNA molecular with identical function；
- the B3 of primer V is following (f3) or (f4)；
(f3) single strand dna shown in the sequence 26 of sequence table；
(f4) by sequence 26 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 26
DNA molecular with identical function；
- the FIP of primer V is following (f5) or (f6)；
(f5) single strand dna shown in the sequence 27 of sequence table；
(f6) by sequence 27 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 27
DNA molecular with identical function；
- the BIP of primer V is following (f7) or (f8)；
(f7) single strand dna shown in the sequence 28 of sequence table；
(f8) by sequence 28 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 28
DNA molecular with identical function；
- the LF of primer V is following (f9) or (f10)；
(f9) single strand dna shown in the sequence 29 of sequence table；
(f10) by sequence 29 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 29
DNA molecular with identical function；
- the LB of primer V is following (f11) or (f12)；
(f11) single strand dna shown in the sequence 30 of sequence table；
(f12) by sequence 30 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 30
DNA molecular with identical function；
The primer sets VI are by-the F3 of the primer VI ,-B3 of the primer VI ,-FIP of the primer VI ,-BIP of the primer VI ,-LF of primer VI
Formed with-the LB of primer VI；
- the F3 of primer VI is following (g1) or (g2)；
(g1) single strand dna shown in the sequence 31 of sequence table；
(g2) by sequence 31 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 31
DNA molecular with identical function；
- the B3 of primer VI is following (g3) or (g4)；
(g3) single strand dna shown in the sequence 32 of sequence table；
(g4) by sequence 32 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 32
DNA molecular with identical function；
- the FIP of primer VI is following (g5) or (g6)；
(g5) single strand dna shown in the sequence 33 of sequence table；
(g6) by sequence 33 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 33
DNA molecular with identical function；
- the BIP of primer VI is following (g7) or (g8)；
(g7) single strand dna shown in the sequence 34 of sequence table；
(g8) by sequence 34 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 34
DNA molecular with identical function；
- the LF of primer VI is following (g9) or (g10)；
(g9) single strand dna shown in the sequence 35 of sequence table；
(g10) by sequence 35 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 35
DNA molecular with identical function；
- the LB of primer VI is following (g11) or (g12)；
(g11) single strand dna shown in the sequence 36 of sequence table；
(g12) by sequence 36 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 36
DNA molecular with identical function；
The primer sets VII are by-the F3 of the primer VII ,-B3 of the primer VII ,-FIP of the primer VII ,-BIP of the primer VII ,-LF of primer VII
Formed with-the LB of primer VII；
- the F3 of primer VII is following (h1) or (h2)；
(h1) single strand dna shown in the sequence 37 of sequence table；
(h2) by sequence 37 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 37
DNA molecular with identical function；
- the B3 of primer VII is following (h3) or (h4)；
(h3) single strand dna shown in the sequence 38 of sequence table；
(h4) by sequence 38 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 38
DNA molecular with identical function；
- the FIP of primer VII is following (h5) or (h6)；
(h5) single strand dna shown in the sequence 39 of sequence table；
(h6) by sequence 39 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 39
DNA molecular with identical function；
- the BIP of primer VII is following (h7) or (h8)；
(h7) single strand dna shown in the sequence 40 of sequence table；
(h8) by sequence 40 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 40
DNA molecular with identical function；
- the LF of primer VII is following (h9) or (h10)；
(h9) single strand dna shown in the sequence 41 of sequence table；
(h10) by sequence 41 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 41
DNA molecular with identical function；
- the LB of primer VII is following (h11) or (h12)；
(h11) single strand dna shown in the sequence 42 of sequence table；
(h12) by sequence 42 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 42
DNA molecular with identical function；
The primer sets VIII are by-the F3 of the primer VIII ,-B3 of the primer VIII ,-FIP of the primer VIII ,-BIP of the primer VIII ,-LF of primer VIII
Formed with-the LB of primer VIII；
- the F3 of primer VIII is following (i1) or (i2)；
(i1) single strand dna shown in the sequence 43 of sequence table；
(i2) by sequence 43 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 43
DNA molecular with identical function；
- the B3 of primer VIII is following (i3) or (i4)；
(i3) single strand dna shown in the sequence 44 of sequence table；
(i4) by sequence 44 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 44
DNA molecular with identical function；
- the FIP of primer VIII is following (i5) or (i6)；
(i5) single strand dna shown in the sequence 45 of sequence table；
(i6) by sequence 45 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 45
DNA molecular with identical function；
- the BIP of primer VIII is following (i7) or (i8)；
(i7) single strand dna shown in the sequence 46 of sequence table；
(i8) by sequence 46 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 46
DNA molecular with identical function；
- the LF of primer VIII is following (i9) or (i10)；
(i9) single strand dna shown in the sequence 47 of sequence table；
(i10) by sequence 47 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 47
DNA molecular with identical function；
- the LB of primer VIII is following (i11) or (i12)；
(i11) single strand dna shown in the sequence 48 of sequence table；
(i12) by sequence 48 by the substitution and/or missing and/or addition of one or several nucleotides and with sequence 48
DNA molecular with identical function.
2. primer described in claim 1 combines the application in reagent preparation box；The purposes of the kit is following (j1)
Or (j2)：
(j1) identify Escherichia coli and/or Friedlander's bacillus and/or pseudomonas aeruginosa and/or streptococcus dysgalactiae and
/ or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and/or candida albicans；
(j2) it is used to detect whether false containing Escherichia coli and/or Friedlander's bacillus and/or verdigris in sample to be tested
Monad and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and
/ or candida albicans.
3. the kit combined containing primer described in claim 1；The purposes of the kit is following (j1) or (j2)：
(j1) identify Escherichia coli and/or Friedlander's bacillus and/or pseudomonas aeruginosa and/or streptococcus dysgalactiae and
/ or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and/or candida albicans；
(j2) it is used to detect whether false containing Escherichia coli and/or Friedlander's bacillus and/or verdigris in sample to be tested
Monad and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and
/ or candida albicans.
4. the preparation method of kit described in claim 3, including the step of each bar primer is individually packed.
5. one kind detects whether bacterium to be measured is Escherichia coli, Friedlander's bacillus, pseudomonas aeruginosa, stops newborn hammer
Bacterium, streptococcus uberis, salmonella typhimurium, the method for proteus mirabilis or candida albicans, including following step
Suddenly：
(1) genomic DNA of bacterium to be measured is extracted；
(2) using the genomic DNA of step (1) extraction as template, primer described in claim 1 is respectively adopted and combines
In each primer sets carry out ring mediated isothermal amplification, then make the following judgment：
If the primer sets I are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be Escherichia coli；
If the primer sets II are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be Friedlander's bacillus；
If the primer sets III are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be pseudomonas aeruginosa；
If the primer sets IV are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be streptococcus dysgalactiae；
If the primer sets V are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be streptococcus uberis；
If the primer sets VI are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be salmonella typhimurium；
If the primer sets VII are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be proteus mirabilis；
If the primer sets VIII are used to realize the specific amplification using the genomic DNA as template, bacterium to be measured
For or candidate be candida albicans.
6. whether contain Escherichia coli and/or Friedlander's bacillus and/or P. aeruginosa in one kind detection sample to be tested
Bacterium and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and/or proteus mirabilis and/or
The method of candida albicans, comprises the following steps：
(1) STb gene of sample to be tested is extracted；
(2) using the STb gene of step (1) extraction as template, it is respectively adopted in primer combination described in claim 1
Each primer sets carry out ring mediated isothermal amplification, then make the following judgment：
If the specific amplification using the STb gene as template can be realized by using the primer sets I, in sample to be tested
Contain or doubtful containing Escherichia coli；
If the specific amplification using the STb gene as template can be realized by using the primer sets II, in sample to be tested
Contain or doubtful containing Friedlander's bacillus；
If the specific amplification using the STb gene as template can be realized by using the primer sets III, in sample to be tested
Contain or doubtful containing pseudomonas aeruginosa；
If the specific amplification using the STb gene as template can be realized by using the primer sets IV, in sample to be tested
Contain or doubtful containing streptococcus dysgalactiae；
If the specific amplification using the STb gene as template can be realized by using the primer sets V, in sample to be tested
Contain or doubtful containing streptococcus uberis；
If the specific amplification using the STb gene as template can be realized by using the primer sets VI, in sample to be tested
Contain or doubtful containing salmonella typhimurium；
If the specific amplification using the STb gene as template can be realized by using the primer sets VII, in sample to be tested
Contain or doubtful containing proteus mirabilis；
If the specific amplification using the STb gene as template can be realized by using the primer sets VIII, in sample to be tested
Contain or doubtful containing candida albicans.
7. whether primer combination is Escherichia coli, Friedlander's bacillus, copper detecting bacterium to be measured described in claim 1
Green pseudomonad, streptococcus dysgalactiae, streptococcus uberis, salmonella typhimurium, proteus mirabilis or white false silk ferment
Application in mother.
8. whether primer combination contains Escherichia coli and/or kerekou pneumonia in sample to be tested is detected described in claim 1
Primary Salmonella and/or pseudomonas aeruginosa and/or streptococcus dysgalactiae and/or streptococcus uberis and/or salmonella typhimurium and
/ or proteus mirabilis and/or candida albicans in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610499852.9A CN107541567B (en) | 2016-06-29 | 2016-06-29 | LAMP primer combination for detecting 8 environmental pathogens of cow mastitis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610499852.9A CN107541567B (en) | 2016-06-29 | 2016-06-29 | LAMP primer combination for detecting 8 environmental pathogens of cow mastitis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107541567A true CN107541567A (en) | 2018-01-05 |
| CN107541567B CN107541567B (en) | 2021-02-02 |
Family
ID=60966138
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610499852.9A Active CN107541567B (en) | 2016-06-29 | 2016-06-29 | LAMP primer combination for detecting 8 environmental pathogens of cow mastitis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107541567B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825567A (en) * | 2018-12-27 | 2019-05-31 | 博奥生物集团有限公司 | Pneumonia diagnosis circRNA biomarker and application, primer and reagent |
| CN110129316A (en) * | 2018-02-05 | 2019-08-16 | 北京智德医学检验所有限公司 | It is a kind of for detecting the LAMP primer composition and application of 4 kinds of gramnegative bacteriums in intraocular liquid |
| CN111378772A (en) * | 2020-03-27 | 2020-07-07 | 宁夏大学 | Specific LAMP primer, kit and method for detecting streptococcus uberis |
| CN114277169A (en) * | 2022-01-13 | 2022-04-05 | 上海市动物疫病预防控制中心(上海市兽药饲料检测所、上海市畜牧技术推广中心) | Kit and method for detecting cow mastitis pathogenic bacteria |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789410A (en) * | 2013-12-11 | 2014-05-14 | 广西大学 | Visual LAMP detection kit for streptococcic mastitis pathogenic bacteria |
| CN104328167A (en) * | 2014-09-17 | 2015-02-04 | 宁夏大学 | Gene chip capable of parallel detection of ten main pathogenic bacteria of cow mastitis and detection method thereof |
| JP2015100282A (en) * | 2013-11-21 | 2015-06-04 | 国立研究開発法人農業・食品産業技術総合研究機構 | Method for detecting bovine mastitis causal microorganism, and primer set and assay kit used for the same |
-
2016
- 2016-06-29 CN CN201610499852.9A patent/CN107541567B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2015100282A (en) * | 2013-11-21 | 2015-06-04 | 国立研究開発法人農業・食品産業技術総合研究機構 | Method for detecting bovine mastitis causal microorganism, and primer set and assay kit used for the same |
| CN103789410A (en) * | 2013-12-11 | 2014-05-14 | 广西大学 | Visual LAMP detection kit for streptococcic mastitis pathogenic bacteria |
| CN104328167A (en) * | 2014-09-17 | 2015-02-04 | 宁夏大学 | Gene chip capable of parallel detection of ten main pathogenic bacteria of cow mastitis and detection method thereof |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110129316A (en) * | 2018-02-05 | 2019-08-16 | 北京智德医学检验所有限公司 | It is a kind of for detecting the LAMP primer composition and application of 4 kinds of gramnegative bacteriums in intraocular liquid |
| CN109825567A (en) * | 2018-12-27 | 2019-05-31 | 博奥生物集团有限公司 | Pneumonia diagnosis circRNA biomarker and application, primer and reagent |
| CN109825567B (en) * | 2018-12-27 | 2022-06-10 | 博奥生物集团有限公司 | CircRNA biomarker for pneumonia diagnosis, application, primer and reagent |
| CN111378772A (en) * | 2020-03-27 | 2020-07-07 | 宁夏大学 | Specific LAMP primer, kit and method for detecting streptococcus uberis |
| CN114277169A (en) * | 2022-01-13 | 2022-04-05 | 上海市动物疫病预防控制中心(上海市兽药饲料检测所、上海市畜牧技术推广中心) | Kit and method for detecting cow mastitis pathogenic bacteria |
| CN114277169B (en) * | 2022-01-13 | 2023-07-07 | 上海市动物疫病预防控制中心(上海市兽药饲料检测所、上海市畜牧技术推广中心) | Kit for detecting cow mastitis pathogenic bacteria and method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107541567B (en) | 2021-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107541509A (en) | For detecting the LAMP primer composition and its application of 6 kinds of infectious agents of mastitis for milk cows | |
| CN107541567A (en) | For detecting the LAMP primer composition and its application of 8 kinds of environment pathogens of mastitis for milk cows | |
| US5849488A (en) | DNA-sequence-based diagnosis of mastitis from a milk sample | |
| Lim et al. | Detection and differentiation of non-emetic and emetic Bacillus cereus strains in food by real-time PCR | |
| CN102094080B (en) | Quick molecular detection method for simultaneously detecting three kinds of fusarium toxins and application thereof | |
| CN101492739B (en) | Detection gene chip and method for main pathogen of bovine mastitis | |
| CN111154900B (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| KR101329114B1 (en) | Primer for the detection of Mycoplasma hyopneumoniae, and kit and method for the detection of Mycoplasma hyopneumoniae by using the primer, and kit and method for the diagnosis of porcine pneumonia by using the primer | |
| CN107312849B (en) | CPA detection method for detecting mycoplasma bovis, kit and application thereof | |
| Terletsky et al. | An efficient method for genetic certification of Bacillus subtilis strains, prospective producers of biopreparations | |
| CN108384782B (en) | Kit and kit for detecting pathogens causing bloodstream infections | |
| AU2020103778A4 (en) | Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method | |
| CN107988400A (en) | Detect the reagent set of staphylococcus haemolyticus | |
| CN115198026A (en) | Burkholderia gladioli and coconut toxin pathogenic variety specific new molecular target and rapid detection method thereof | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN109988855A (en) | For detecting the LAMP primer composition and its application of six kinds of aspergillus | |
| KR100984785B1 (en) | Primer set and probe for detecting Salmonella typhimurium | |
| CN102653792B (en) | Method for detecting staphylococcus aureus and enterotoxin genotypes thereof through multiple PCR (polymerase chain reaction) | |
| CN106636428B (en) | PCR method for rapidly detecting and identifying Serratia | |
| Xu et al. | Randomly amplified polymorphic deoxyribonucleic acid (DNA) analysis of Candida albicans isolates from clinical sources of hospital in south China | |
| CN110129459A (en) | It is a kind of for detecting the LAMP primer composition and application of 5 kinds of gram-positive bacteriums in intraocular liquid | |
| Almanseekanaa et al. | MOLECULAR STUDY OF PSEUDOMONAS AERUGINOSA ISOLATED FROM DIFFERENT CLINICAL CASES. | |
| CN109355412A (en) | It is a kind of artificial synthesized exogenous referring to molecule compared with fungal species and abundance for measuring bacterium | |
| CN113355440B (en) | Multiple PCR (polymerase chain reaction) primer for detecting pathogenic bacteria of pasteurized milk and robustness detection method thereof | |
| CN110129316A (en) | It is a kind of for detecting the LAMP primer composition and application of 4 kinds of gramnegative bacteriums in intraocular liquid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |