CN1075335A - Viral Oryza of anti-Oryza leaf stripe and manufacture method thereof that proterties changes - Google Patents
Viral Oryza of anti-Oryza leaf stripe and manufacture method thereof that proterties changes Download PDFInfo
- Publication number
- CN1075335A CN1075335A CN92115177A CN92115177A CN1075335A CN 1075335 A CN1075335 A CN 1075335A CN 92115177 A CN92115177 A CN 92115177A CN 92115177 A CN92115177 A CN 92115177A CN 1075335 A CN1075335 A CN 1075335A
- Authority
- CN
- China
- Prior art keywords
- oryza
- leaf stripe
- sequence
- gene
- stripe virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Be used in the gene and the terminal carrier of the dirty introducing coding of the promoter that works in grass Oryza leaf stripe virus infection specific protein, the Oryza proterties is changed, has the viral Oryza of anti-Oryza leaf stripe by expressing such group, cultivating.Make in this way, utilize known Oryza leaf stripe virus capsid protein matter nonstructural proteins in addition in the past, can cultivate anti-this viral Oryza.
Description
The present invention relates to encode Oryza leaf stripe virus infection specific protein gene and introduce this gene to Oryza leaf stripe virus infection have resistivity Oryza and manufacture method thereof.
As plant virus, the past is known to be had with the many viruses headed by tobacco mosaic virus and the CMV.These plant viruses become makes farm crop be subjected to disease and the factor of a large amount of reduction of income.In these viruses, Oryza leaf stripe virus is distributed in ground such as Japan, China, the Soviet Union, Korea S, and these national Oryza crops are injured in a large number.On average there is 10% Oryza to be subjected to the harm of Oryza leaf stripe virus approximately in that Japan is annual.
But because practical antiviral agent is few, it is prevented and kill off is to rely on to remove source of infection plant and drive away the media worm mostly.Except such physics or chemical preventing and kill off the means, cultivate means as biology, can enumerate the utilization of weak viral disease poison and resistant varieties.The anti-division that utilizes weak viral disease poison is that utilization is if the virus inoculate illness in advance in plant a little less than even then infect the virulent strain with strong illness backward, also can suppress its breeding and this fact of not falling ill.This method is for the just progressively practicality (Ann.Rev.Phytopathol.14(1976) of tobacco mosaic virus a part of viruses such as (TMV); Phytopathol.57,1347(1976); Plant Disease Report64,538(1980)).Such phenomenon is known very early, is called cross-protection.
On the other hand, also cultivate by the antiviral property kind that cross-breeding produces with Oryza, Glycine, Cucumis, Rhaphanus, tobacco, tomato genus etc., for example, the known method (China's farming examination is reported A16,39) of anti-Oryza leaf stripe virulent gene being introduced the Oryza cultivar.
In recent years, reported in the gene introduced plant of the virus capsid protein matter of will encoding, made it, cultivated antiviral property plant (Ann.Rev.Phytopathol.28,451(1990)) at plant interior expression.In addition, reported that utilization with the satellite RNA introduced plant of CMV and obtain antiviral property plant (Nature328,799(1985)), has again, utilize the anti-division (Proc.Natr.Acad.Sci USA 86,6949(1989)) of virus of anti-meaning RNA.In Oryza, to the encode coat protein plasmagene of Oryza leaf stripe virus of geneome RNA 3 of Oryza leaf stripe virus such as the inventor is introduced Oryza, and (putting down into 3 years Japanese plant's pathology can conference lecture main idea collection p193 successfully to cultivate the viral Oryza of anti-Oryza leaf stripe; Proc.Natl.Acad.Sci USA 89, (1992)).
Recently, the gene of the nonstructural proteins (54kD protein) of encoding nicotiana mosaic virus is introduced tobacco, cultivate and have the viral plant of strong resisting tobacco mosaic disease.About its antitoxin reason many not clear parts are arranged, in addition, about other virus, report is not cultivated the antiviral property plant with such nonstructural proteins.The problem to be solved in the present invention is that the unknown so far nonstructural proteins of its effect of expression is given the Oryza antiviral property in Oryza.
Oryza leaf stripe virus has the merogenesis particle structure, belongs to the thin thin virus type of plant.In virus particle, comprise 4 kinds of 2 chain RNA and 4 kinds of 1 chain RNA(are called 2 chains or 1 chain RNA1, RNA2, RNA3 and RNA4 respectively).Article 2, chain RNA1-4 is corresponding to separately 1 chain RNA1-4 replica (J.gen.Virol.70,505(1989)).Single coat protein and RNA polymerase in virus particle, have been seen.On the other hand, in Oryza leaf stripe virus infection Oryza, except that coat protein matter and RNA polymerase, also detect the infection specific protein (Microbiological Sciences3,347(1986)) that comes by viral genome.Infect the due to illness malicious strain isolated of molecular weight of specific protein and different (Proc.Assoc.P1.Pro.Kyushu 56,423(1990)) are not clear about this proteinic physiological action.Reported that Oryza leaf stripe virus infection specific protein encoded by RNA4, coat protein is by RNA3 coding (Virology 177,371(1990)).
The inventor finds, with the carrier DNA that enrolls the cRNA that contains Oryza leaf stripe virus infection differential protein plasmagene, change the Oryza proterties, by expressing such gene, can cultivate Oryza, thereby finish the present invention with anti-Oryza leaf stripe virus.
That is to say that main points of the present invention are the gene and the terminal Oryza and the manufacture method thereof that changes proterties for the carrier of feature, with this carrier of the dirty introducing coding of the promotor that works Oryza leaf stripe virus infection specific protein in grass.
Though can finish the present invention like that according to following,, just be not limited to the following stated as long as be no more than its scope.
Also have, though be described with regard to Oryza as an example of the present invention below, but as grass of the present invention, except that Oryza, can list Secale, Hordeum, Triticum, oat/Avena, Herba Setariae Viridis/setaria, Echinochloa, lady's-grass, Zoysia, Herba Setariae Viridis/awns genus, saccharum, Zea and Coix etc.
The extraction of virus and viral RNA, refining
For example, to infect Oryza leaf stripe virus isolated strain T(J.gen.Virol, 70,505-511(1989), the Oryza leaf (10mM diethyldithiocarbamate, 0.1M Sodium phosphate dibasic after pulverizing in PH7.2), add the trifluoro three chloro ethane clarifications of 1/5 amount at phosphoric acid buffer, then in 20% sucrose snubber middle layer, with 123000 * g centrifugation 1.5 hours.The precipitation that obtains is dissolved in the 10mmol phosphoric acid buffer (PH7.5), with 4000 * g centrifugation 10 minutes.Then add ammonium sulfate and stir that supernatant liquor is become is 35% saturated, then with 4000xg centrifugation 5 minutes.After supernatant liquor is diluted to 4 times, adds polyoxyethylene glycol and also stir more than 1 hour, so that ultimate density is 8%.With its centrifugation after 30 minutes,, can make with extra care virus particle with 30000 * g by adding that sucrose density gradient centrifugation separates (10-40%, 100000 * g, 2.5 hours) throw out.Be separated in this way B, M, nB(from the upper strata to lower floor) three kinds of compositions and obtain virus particle.The RNA4 that uses among the present invention contains full composition.
Extracting full composition viral RNA by purified virus for example extracts with the SDS-phynol method.Promptly in the purified viral suspension, add SDS(2%), wilkinite (12.5mg/ml) and EDTA(2.5mM), equivalent adds phenol and removes deproteinize again, carries out ethanol sedimentation repeatedly according to ordinary method then, just can emanate and make with extra care RNA.Separate the mixed solution that can extract RNA1-4 from the nB part of gained with sucrose density gradient.Can extract the mixed solution of RNA2-4 from B and M part.
By the synthetic cDNA of purified RNA
Use the synthetic cDNA of mixed solution of the RNA2-4 that partly obtains by B or M.At first, synthesize the primer (5'GGGCATATCTTTTGAGATTA3' that in RNA4, has special order by 3 ' the terminal bases order (J.gen.Virol.71,2817(1990)) of RNA4; Sequence list sequence number (SN): 3).Use such primer, as template, synthesize cDNA according to the method (Gene 25,263(1983)) of Gubler-Hoffman with full RNA.Resulting cDNA is 1 chain, thus with it as 2 chain cDNA of template resynthesis.
The clone of cDNA and order
Below, with the method shown in the following embodiment, for example use the disappearance element (precious wine is made system) of 1,000 order usefulness, will make clone's shortcoming variant from the clone of RNA4 of selection.Ratio with from 100 to 200 base degree is selected the variant with shortcoming, determines the base sequence of each variant then with people's such as Sanger method (Proc.Natl.Acad.Sci.USA74,5463(1977)).Then, by the base sequence of gained, synthetic primer (5'CCAACTTTCAACATACTTGTT3'; Sequence list sequence number (SN): 4), make the cDNA that covers RNA4 chain total length.Clone by method same as described above and to decide base sequence.So just can determine the full base sequence of RNA4.
Cultivate proterties and change plant
Oryza leaf stripe virus infection specific protein is from the RNA4(2157 base) the 55th base to the 591 bases be encoded (sequence number (SN) 2 of sequence list).CDNA with the RNA4 of gained is a base, for example uses converse primer (precious wine is made system) and synthetic primer (5'TAATGCTAGCACTCGTGG3'; 5), utilize people's such as Saiki PCR method (Nature324 sequence list sequence number (SN):, 126(1986) make and also contain vehicle PUC 19(Gene33, clone cell 103(1985)), and 1-633 base sequence is amplified, the SmaI position of for example inserting pUC19.For example cut out such gene, enroll the promoter and the end of in grass, expressing or enroll cytoplasmic inheritance body carrier as required with intron with restriction enzyme SalI and EcoRI.
Employed mover, can enumerate for example from CaMV35s(pBI221:EMBO.J.6,3901-3907,1987) promoter of etc. cauliflower mosaic virus, rbcs(ribulosel.5-bisphosphate carboxylase), Cab(chlorophyll a/bbinding protein) etc. (Science, 244,174,1989) confirmed the promoter of in plant, expressing.
As end, for example can list from the end of cauliflower mosaic virus, from NOS(safrosin synthetic enzyme) end of gene etc.
In addition, the carrier of configuration intron also can use as the carrier of high expression level between promoter and structure gene, and described intron for example can list corn Adhl(ethanol dehydrogenase) first intron (Genes ﹠amp; Development, 1,1183-1200,1987), castor-oil plant Cat(catalase) first intron (people such as Tanaka, Nucleic Acids Research, 18,6767-6770,1990) etc.
In the present invention, also use the alien gene of from hygromycin phosphotransferase gene, neomycin phosphotransferase gene, chloramphenicol acetyl transferasegene and beta-glucuronidase gene etc., selecting more than 2 kinds, and, wherein a kind of preferably the use when selection effective so-called selectable marker gene during as the bacterium colony of purpose.As such selectable marker gene, hygromix phosphotransferase is an ideal.
In the present invention, the cytogenetics body that selectable marker gene and other alien gene are arranged be can use in same cytoplasmic inheritance body, cytoplasmic inheritance body with selectable marker gene and cytoplasmic inheritance body also can be used in combination with other alien gene.
Carrier can be used for making the grass proterties to change.Just will be suspended in the liquid medium by the protoplastis that grass comes, add after electricimpulse introduces this carrier, with the culture medium culturing that contains the Oryza culturing cell, form cluster, method (Shimamoto et al, Nature, 337 from this cluster aftergrowth, 274-276,1989).Protoplastis can be modulated by the following stated.For example, cultivate suspension cell or the callus of taking from the ripe and last mature seed Japanese fine, that Koshipikali, Sasanishiki etc. cultivate Oryzas, spire, root tissue with normally used liquid nutrient mediums such as R2 substratum, then according to ordinary method, for example in the enzyme liquid of cell wall clastic enzymes such as cellulase and muramidase, carry out enzyme and handled 3-16 hour with 25-30 ℃, the condition of 0-50 strokes per minute number of times.The enzyme processing removes by filter not digest after finishing, and adds KMC liquid (0.118M Repone K, 0.081M magnesium chloride, the 0.085M calcium chloride that 2-5 doubly measures in filtrate, pH6.0) (Theor.Appl.Genet., 53,57-63,1978), centrifugation then can access the purified protoplastis.
To contain above-mentioned adjusted expression carrier (for example 1-100ug/ml) and derive from protoplastis ((2-10) * 10 for example of above-mentioned plant
6Individual/as ml) to be suspended in the liquid mediums such as damping fluid that contain 30-200mM Repone K, 0-50mM magnesium chloride and 0.2-0.6M N.F,USP MANNITOL, it is applied electricimpulse the cytoplasmic inheritance body is introduced in the protoplastis.Suitable electricimpulse is handled the electrical condenser that is to use 100-1000 μ F, is carried out (opening flat 1-181791 communique with reference to the spy) with the DC pulse of the initial stage voltage of the 200-1000V/cm that produced, the condition of pulse duration 1-50ms.
The protoplastis that above-mentioned electricimpulse was handled is suspended in and for example contains R2 substratum (Plant.Cell.Physiol., 14,1113,1973) inorganic components and MS substratum (Murash igeandskoog, 15,473-497, liquid nutrient medium of vitamin mixture 1962) (R2/MS) or MS substratum, preferably contain in the substratum of 0.2-0.5% saltpetre as nitrogenous source, it is mixed repeatedly with R2/MS that contains the agarose about 1.0-3.0% or MS substratum equivalent, then rapidly in culture dish the expansion and solidify thinly.Preferably make this moment the concentration of protoplastis be about (5-50) * 10
5Individual/ml.
The solidified agarose is cut into the 5-20mm size, on the aforesaid liquid substratum, cultivates.At this moment, when the protoplastis that uses from grass, preferably make the Oryza culturing cell in substratum with about 100-300mgFW/ culture dish coexistence, on one side slowly vibrate with the rotation of 20-50rpm, under dark condition, cultivate on one side in 23-27 ℃.With the method for Oryza culturing cell coexistence except that above-mentioned method, the liquid nutrient medium that will contain protoplastis is in addition put into the bottom and is provided with the container of membrane filter, then this container is immersed the culture dish that liquid nutrient medium is housed and the method that coexists with the Oryza culturing cell.Oryza culturing cell described here preferably is made up of the tiny cell lump of vigorous splitted.Such culturing cell is easy to obtain according to following known method, cultivates in the middle of for example being about in the callus liquid medium within that seed, stem, root or medicine by oryza plant obtain, selects the fast cell of split speed.
2-4 week after cultivation, the cluster of formation 0.5-1mm degree.At this moment, for example when introduction also is the hygromycin phosphotransferase gene (hph) of selectable marker gene as alien gene, in the nutrient solution of 10-100 μ g/ml degree, added Totomycin in 7-20 days if cultivate the beginning back, continue again to cultivate, just can carry out the selection that purpose is the proterties transition cell effectively.Then add this cluster on the proliferated culture medium, under illumination (1000-4000 meter-candle), cultivate 2-4 week in 23-27 ℃, obtain the callus of φ 3-6mm.Above-mentioned proliferated culture medium for example is to add plant hormone in the R2 substratum, as add the 2,4 dichlorophenoxyacetic acid that about 2mg/ rises (2,4-D), the nutrient agar of the agarose of 0.1-1.0%.Separate each callus separately, and when introducing the hph gene, put bed and in the same proliferated culture medium that contains Totomycin 20-50 μ g/ liter, cultivate, determine the tolerance of Totomycin as alien gene.
If with this callus with the R2/MS substratum (0.1-1% indolylacetic acid, 0.5-2% zeatin) that for example contains the 0.5-1.5% agarose, cultivate under 23-27 ℃, 2000-4000 meter-candle condition, the result forms adventive embryo or indefinite bud seeing in 2-10 week.Cultivate 2-3 week again with the R2/MS substratum that does not contain hormone, obtain the plant young that to transplant.If the plant young that obtains like this is transplanted at nephew Shi Dengzhong and makes it to grow up, just can access the oryza plant body that proterties changes.
The affirmation of anti-leaf stripe viral infection
Leaf by the regenerated Oryza extracts protein, confirms that with the Western engram analysis proterties of expressing Oryza leaf stripe virus infection specific protein changes Oryza.The incubator that the such proterties transformation Oryza and the Oryza of not expressing Oryza leaf stripe virus infection specific protein of thing use are in contrast put into the viral worm (little brown back rice plant hopper) that a fixed number is housed with normal Oryza makes it to infect.After 3-5 days, remove worm, kill residual worm with sterilant, in Isolation warm house, observe then to morbidity.After this, the do as one likes shape changes the infection rate mensuration resistivity of the virus disease of body and contrast.
Embodiment
Though below enumerate embodiment the present invention be described, only otherwise exceed scope of the present invention, the invention is not restricted to the following examples.
Making with extra care of embodiment 1 virus particle and viral RNA
The little brown back rice plant hopper that will have Oryza leaf stripe poison (J.gen.Virol.70,505(1989)) is seeded on the wheat, and viral proliferation was freezed after one week.With the infection leaf that freezes like this at phosphoric acid buffer (10mM diethyldithiocarbamate, 0.1M Sodium phosphate dibasic, PH7.2) after pulverizing in, the trifluoro three chloro ethane that add 1/5 amount, the clarification back is in 20% sucrose snubber middle layer, with 123000 * g centrifugation 1.5 hours.With resolution of precipitate in 10mM phosphoric acid buffer (PH7.5), with 4000xg centrifugation 10 minutes.Then add ammonium sulfate and stir that supernatant liquor is become is 35% saturated, then with 4000 * g centrifugation 5 minutes.After supernatant liquor diluted about 4 times, add polyoxyethylene glycol and stir that to make ultimate density in 1 hour be 8%.It with the 30000xg centrifugation after 30 minutes, is carried out sucrose density gradient centrifugation to precipitation and separate (10-40%, 100000 * g, 2.5 hours).Virus particle be separated into B, M, nB(from the upper strata to lower floor) three parts.Contain each layer of virus by centrifugation (123000 * g, 3 hours), make with extra care virus particle.The RNA4 that uses among the present invention comprises full composition.
From purified virus, extract totivirus RNA with the SDS-phynol method.Just in the purified viral suspension, add SDS(2%), wilkinite (12.5mg/ml) and EDTA(2.5mM), the phenol that adds equivalent again removes deproteinize, carries out ethanol sedimentation repeatedly according to ordinary method then, segregation is made with extra care out RNA.B that obtains from the sucrose density centrifugation and M part can be extracted the mixed solution of RNA2-4 according to the method.
Synthetic and the clone of embodiment 2 cDNA
With the synthetic cDNA of the mixed solution of RNA2-4.At first, determine 3 ' terminal bases order (J.gen.Virol 71,2871(1990)), the synthetic primer (5'GGGCATATCTTTTGAGATTA3' then of RNA4 by direct order; Sequence list sequence number (SN): 3).Use reversed transcriptive enzyme, synthesize cRNA as template with RNA2-4 according to the method (above-mentioned) of Gubler-Hoffman.Resulting cRNA is a chain, therefore with it as two chain cRNA of template resynthesis.Two cRNA are connected cytogenetics body pUC19(Gene33,103-119, (1985)) the SmaI position on, carry out proterties conversion with bacillus coli DH 5 alpha, realize the clone.In order to investigate among corresponding 3 RNA which, the clone of gained determines base sequence from each clone's two ends in proper order with 200 base degree.These 3 ' terminal bases orders (J.gen.Virol.71,2817(1990)) with certain RNA4 of having put down in writing are compared, according to the homogeny of 3 ' terminal about 50 bases of RNA4, judge the clone who comes by RNA4, select such clone then.(Proc.Natl.Acad.Sci.USA74 after method 5463(1977) is determined such clone's base sequence, synthesizes near the primer (5'CAACTTTCAACATACTTGTT3' that has suitable sequential areas for 5 ' end with people such as Sanger; The sequence list sequence number (SN): 4), with the cRNA in the synthetic whole zone of RNA4 of primer elongation method.
The decision of the order of embodiment 3 cDNA and Oryza leaf stripe virus infection differential protein plasmagene
In the above, the disappearance element that uses precious wine to make 1,000 order usefulness of system will be made into clone's shortcoming variant from the clone of the RNA4 that selects.Ratio with 100 to 200 base degree is selected the variant that keeps shortcoming, determines the base sequence of each variant according to people's such as Sanger method (above-mentioned pair of deoxidation method).As can be seen, RNA4 is made of 2157 bases, with 5 ' end 178 amino acid (sequence number (SN) 1 of sequence list) are arranged at viral RNA, molecular weight is 20541 proteinic coding region, with be that 286 amino acid, molecular weight are arranged is the corresponding RNA(J.gen.Virol. in 32474 protein coding zone for 5 ' end at complementary RNA in viral RNA, 73,1309-1312(1992)).Then, with Computer Analysis (GENETYX, Software Development Co.), obtain deduction amino-acid sequence by RNA4 encoded protein matter.On the other hand, form by the amino acid that infects Oryza purified Oryza leaf stripe virus infection specific protein with PICOTAG method (Waters) analysis.With gained result and the amino acid ratio of components of inferring by coding region Oryza leaf stripe encoding viral, that be considered to Oryza leaf stripe virus infection specific protein, see 98% homogeny.Therefore determined that the protein of molecular weight about 20000 is Oryza leaf stripe virus infection specific proteins, and such zone is the gene of coding Oryza leaf stripe virus infection specific protein.This base sequence is shown in the sequence number (SN) 2 of sequence list.In addition, in the present invention, giving in the scope of antiviral property Oryza, remove a part of amino acid or base, the change of replacing or appending etc. is also included among the present invention.
Embodiment 4 proterties change constructing with the cytoplasmic inheritance body
As proterties transformation carrier, with pIG221(Plant Cell Physiol.31, the coding region of beta-glucuronidase 805(1990)) and hygromix phosphotransferase exchange, the Oryza high expression level Totomycin patience carrier (pIZI) of the ATG at utilization disappearance intron upper reaches.In such pIZI carrier, the end that has 355 promoters of cauliflower mosaic virus and the intron that comes by the catalase of castor-oil plant, comes by the synthase gene of edaphic bacillus.
Make the gene that contains the Oryza leaf stripe virus infection specific protein that comes by the next cDNA of the RNA4 that selects with embodiment 2 and embodiment 3, use converse primer (precious wine is made system) and primer (5'TAATGCTAGCACTCGTGG3'; The sequence number (SN) of sequence list: 5) amplify with the PCR method, be processed into smooth end with T4 polysaccharase (precious wine is made system) after, pUC19(is above-mentioned in insertion) the position of SmaI.After cutting off such clone with limiting enzyme EcoRI, form smooth end, cut off with restriction enzyme SalI again, reclaim the fragment of the gene that contains coding Oryza leaf stripe virus infection specific protein with the T4 polysaccharase.Cut off the pIZI carrier with EcoRI and SalI, remove Totomycin tolerance gene (hph).This moment, the EcoRI position formed smooth end with the T4 polysaccharase.Use DNA ラ ィ ゲ one シ ヨ Application キ ッ ト (precious wine is made system), make the gene ring-typeization of the carrier and the coding Oryza leaf stripe virus infection specific protein of 355 promoters of the cauliflower mosaic virus that obtains like this and end with the catalatic intron of castor-oil plant, ノ パ リ Application シ Application one ゼ.Carry out the proterties conversion with bacillus coli DH 5 alpha, select, obtain proterties conversion cytoplasmic inheritance body pLAN160 with penbritin.
Embodiment 5 utilizes the electrophoresis method that swashs to carry out the conversion of Oryza protoplastis proterties
(1) segregation of Oryza protoplastis
The protoplastis that derives from oryza plant that uses among the present invention is to take from the fine mature seed of cultivation Oryza Japan, and it obtains by the following stated method.After the suspension cell of mature seed cultivated in the R2 substratum, handled 3-4 hour at 30 ℃ with the enzyme liquid (PH5.6) that contains 4% cellulase RS, 1% muramidase R10 and 0.4M N.F,USP MANNITOL.After filtering the enzyme treatment solution, in filtrate, add KMC liquid (KCl 0.118M, the CaCl of 4 times of amounts
20.085M, MgCl
20.081M, PH6.0, above-mentioned), collect settled protoplastis with centrifugation, and then wash 2 times with KMC liquid.
(2) electricimpulse is handled
The protoplastis of adjusting in above-mentioned (1) is suspended in the EP3 damping fluid (contains 70mM Kcl, 5mM MgCl
2, 0.4M N.F,USP MANNITOL, 0.1%MES damping fluid (PH5.8)) in, form 4 * 10
6The suspension of individual/ml.In this suspension, add the cytoplasmic inheritance body pLAN160(60g/ml that obtains in the foregoing description 4) and as selecting mark to have the cytoplasmic inheritance body pIZI(60ug/ml of hygromycin phosphotransferase gene), 4 ℃ the cooling 5 minutes after, move in the plastics cell of bacteria reducing, apply electric pulse with parallel pole.At this moment, add the initial stage voltage of 300V/cm with 800u F electrical condenser, the pulse duration is 10ms.Apply after the pulse 4 ℃ of coolings 10 minutes, mix with the R2/MS protoplastis agarose substratum of equivalent (Mol.Gen.Gent., 206,408(1987)) then, it is thick to solidify to form 0.7mm.The cell density of this moment is about 3 * 10
6Individual/ml.
(3) cultivation of protoplastis
The agarose that will contain the protoplastis of the electricimpulse processing of carrying out above-mentioned (2) is cut into the tetragonal size of 1cm, put into the dish of the φ 6cm that is added with 5mlR2/MS liquid protoplast culture medium then, add the fresh weight of about 100mg(again) as the Oryza cell of culturing cell.
Such Oryza culturing cell is modulated by the following stated.That is, will be from continue cultivating in the callus liquid medium within of mature embryo for 1 week, use to be present in vigorous tiny (φ 1mm the is following) cell lump of the division made in the suspending nutrient solution as culturing cell.
The cultivation of protoplastis is to carry out about 10 days at about 25 ℃, and cultivate on (50rpm) limit of limit vibration in the dark.After this cultivation, wash out culturing cell.Cultivate again after 3-4 days and in substratum, add hygromycin B, make to form 30 μ g/ml, cultivate 2-3 week then.After this, the agar sugar-tablet is placed on the N6 soft agarose, and (2m,g/1 2,4D, 0.5mg/l benzylaminopurine, 6% sucrose, 0.25% agarose, PH5.6) in, take out the cluster that becomes big, (2mg/l 2,4D, 6% sucrose, 0.5% agarose, PH5.6) middle breeding 2-3 week to transfer to the R2 propagating culture medium.The occurrence frequency of patience callus is about 0.5% with respect to the cluster that generates.
(4) regeneration of plant materials
With the callus that obtains in (3) be placed on the R2/MS regeneration culture medium (1mg/l zeatin, 0.5mg/l indolylacetic acid, 3% Sorbitol Powder, 2% sucrose, 1% agarose, pH5.8) in, cultivate 3-10 week at bright place, bud and root appear.When bud grows up to the 2cm degree, move to the pinkish red case that contains same medium, make it to grow up to young plant.Move on to again in nephew's stone case and grow, just obtain proterties and change the body Oryza.
(5) proterties changes the parsing of plant
At first, according to Richards method (Current Protocol in Molecular Biology 2.3.1(1987)) callus that obtains from above-mentioned (3) extracts DNA, use base sequence synthetic primer (5 ' CTCAGAAGACCAAAGGG3 ' by 35S promoter upstream side, the sequence number (SN) of sequence list: 6) with by base sequence synthetic primer (5 ' TAATGCTAGCACTCGTGG3 ', the sequence number (SN) of sequence list: 5) carry out PCR of Oryza leaf stripe virus infection differential protein plasmagene downstream side.Utilize callus that PCR amplifies as proterties conversion body callus the alien gene fragment, move on to N6 regeneration culture medium (1mg/l zeatin, 0.5mg/l indolylacetic acid, 3% Sorbitol Powder, 2% sucrose, pH5.8).The ratio of introducing the callus of alien gene in this stage is about 90% of a Totomycin patience callus.
Then, from the proterties transformation body of the positive callus regeneration of PCR, gather a part of spire, in the Tris damping fluid that contains 1%SDS, 1mM iodoacetic acid, grind, 100 ℃ of thermal treatments 5 minutes.Utilize 10 minutes clarifications of 15000 * g centrifugation, carry out electrophoresis with 10% polyacrylamide gel that contains 1%SDS, nylon membrane (Immobilon is arrived in the protein electromigration, micropore) after in, carry out the Western engram analysis with anti-Oryza leaf stripe virus infection specific protein antibody and alkali Phosphoric acid esterase in conjunction with secondary antibodies, confirmed that the proterties of expressing Oryza leaf stripe virus infection specific protein changes body.In 7 clones of regenerated, the expression that has confirmed Oryza leaf stripe virus infection specific protein among 4 clones is arranged.
Have again, from the leaf of proterties transformation body, extract RNA with the method (Annal.Biochem.162,156(1987)) of Chomczynski and Sacchi.According to the report of Armagh summer order company, the RNA of 10 μ g is carried out electrophoresis with 1% agarose of the formaldehyde that contains 2.2M.Transfer to nylon membrane (Ha ィ ボ Application De N, ア マ シ ヤ system) with vacuum suction apparatus, carry out the Northern engram analysis as probe, confirm to have expressed mRNA with the coding region of Oryza leaf stripe virus infection differential protein plasmagene.At this moment, probe uses multistage calibrating instrument (Armagh summer order), with
32The P-dCTP mark.
Embodiment 6 proterties change the viral confirmation of anti-leaf stripe of body
Use has the insect (little brown back rice plant hopper) of Oryza leaf stripe virus, to confirming that through Northern described in the embodiment 5 and Western engram analysis the proterties of having expressed Oryza leaf stripe virus infection specific protein changes Oryza, 4 clones (22 individuality) carry out infection experiment.Thing has used the proterties of not expressing Oryza leaf stripe virus infection specific protein to change Oryza and non-proterties transformation Oryza in contrast.
Such confession test individuality is put into light raise case, in this case, with the ratio infection Oryza leaf stripe virus of 10 viruliferous little brown back rice plant hoppers to 1 Oryza individuality, after 3-5 days, removing is attached to the worm on the Oryza, kill remaining insect with sterilant again, transfer to then in the Isolation warm house and observe to morbidity.Relatively proterties changes the Oryza leaf stripe virus disease sickness rate of 2 kinds of Oryzas that body and thing in contrast use.It is 9% that the Oryza leaf stripe virus disease that the proterties of expressing the Oryza of Oryza leaf stripe virus infection specific protein changes body is sent out rate, and the Oryza leaf stripe virus sickness rate of 2 kinds of Oryzas using of thing is 83% altogether in contrast.Confirmed that thus it is to have resistivity to Oryza leaf stripe virus that the proterties of expressing Oryza leaf stripe virus infection specific protein changes Oryza.
Embodiment 7 is to the confirmation of the heredity of following generation of Oryza leaf stripe virus infection specific protein
The seed that proterties that gather to express Oryza leaf stripe virus infection specific protein changes body also makes it to germinate, and this protein is shown in the embodiment 6 Oryza leaf stripe virus to be shown resistivity.With carrying out the Western engram analysis with method identical described in the embodiment 5, whether the gene that investigation is used in proterties changes entails of future generation and expresses.The proterties of observing 2 systems changes body, and the ratio of expressing Oryza leaf stripe virus infection specific protein is respectively 22/25(88%), 23/27(85%), can confirm that this gene genetic given the next generation.
According to the present invention, the infection differential protein plasmagene of the Oryza leaf stripe virus of the nonstructural proteins beyond the virus capsid protein matter is introduced in the Oryza, in Oryza, express the mRNA of Oryza leaf stripe virus infection specific protein or this gene, can cultivate anti-Oryza leaf stripe viral infection Oryza.
Sequence list
Sequence number (SN): 1
Order length: 178
Ordinal type: amino acid
Layout: straight chain shape
Order kind: protein
Source: Oryza leaf stripe virus
In proper order
Sequence number (SN): 2
Order length: 537
Ordinal type: nucleic acid
Chain number a: chain
Layout: straight chain shape
Order kind: other nucleic acid
Source: Oryza leaf stripe virus
In proper order
Sequence number (SN): 3
Order length: 20
Ordinal type: nucleic acid
Chain number a: chain
Layout: straight chain shape
Order kind: other nucleic acid
In proper order
GGGCATATCT TTTGAGATTA 20
Sequence number (SN): 4
Order length: 20
Ordinal type: nucleic acid
Chain number a: chain
Layout: straight chain shape
Order kind: other nucleic acid
In proper order
CAACTTTCAA CATACTTGTT 20
Sequence number (SN): 5
Order length: 18
Ordinal type: nucleic acid
Chain number a: chain
Layout: straight chain shape
Order kind: other nucleic acid
In proper order
TAATGCTAGC ACTCGTGG 18
Sequence number (SN): 6
Order length: 537
Ordinal type: nucleic acid
Chain number a: chain
Layout: straight chain shape
Order kind: other nucleic acid
In proper order
CTCAGAAGAC CAAAGGG 17
The simple declaration of accompanying drawing
Fig. 1 is that the proterties that obtains in an embodiment changes the mode chart of using cytoplasmic inheritance body pLAN160.
Claims (8)
1, carrier is characterized in that, it is that the gene and the end of the dirty introducing coding of the promoter that works in grass Oryza leaf stripe virus infection specific protein forms.
2, the described carrier of claim 1 is characterized in that, the gene of coding Oryza leaf stripe virus infection specific protein is the proteinic gene that coding is represented with the amino-acid sequence of record in the sequence number (SN) 1 of sequence list, and described amino-acid sequence is as follows:
3, the described carrier of claim 2 is characterized in that, the gene of coding Oryza leaf stripe virus infection specific protein is to represent that with the base sequence of record in the sequence number (SN) 2 of sequence list described base sequence is as follows:
4, grass, it is a protoplastis of the carrier described in the claim 1-3 being introduced grass, forms behind the cluster by this cluster plant materials of regenerating to obtain.
5, Oryza, it is a protoplastis of the carrier described in the claim 1-3 being introduced Oryza, forms behind the cluster from this cluster plant materials of regenerating to obtain.
6, the manufacture method of grass, it is characterized in that, be suspended in the liquid medium with the carrier described in the claim 1-3 with by the protoplastis that grass is got, apply electricimpulse and introduce this carrier, then with the culture medium culturing that contains the Oryza culturing cell, make the formation cluster, make plant materials regeneration by this cluster.
7, Oryza leaf stripe virus genome RNA 4 genes of the Oryza leaf stripe virus infection specific protein represented of the amino-acid sequence of being put down in writing in the sequence number (SN) 1 of coded sequence table, described amino-acid sequence is as follows:
8, Oryza leaf stripe virus genome RNA 4 genes of representing by the base sequence of record in the sequence number (SN) 2 of sequence list, described base sequence is as follows:
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP318211/91 | 1991-12-02 | ||
| JP3318211A JPH07313173A (en) | 1991-12-02 | 1991-12-02 | Transformed rice resistant to rice stripe virus and its production |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1075335A true CN1075335A (en) | 1993-08-18 |
| CN1044385C CN1044385C (en) | 1999-07-28 |
Family
ID=18096673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN92115177A Expired - Fee Related CN1044385C (en) | 1991-12-02 | 1992-12-02 | Rice genus resisting rice genus leaf stripe virus with transformed behavious and its mfg. method |
Country Status (4)
| Country | Link |
|---|---|
| JP (1) | JPH07313173A (en) |
| KR (1) | KR100255474B1 (en) |
| CN (1) | CN1044385C (en) |
| TW (1) | TW290426B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109169280A (en) * | 2018-09-20 | 2019-01-11 | 四川农业大学 | The preparation method and used medium of coix lacryma-jobi regeneration plant |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100822742B1 (en) * | 2007-03-19 | 2008-04-17 | 대한민국 | Gene clone of recombinant groel originated from small brown planthopper and detection method of immunocapture rt-pcr for rice stripe virus using the groel protein |
| KR101066011B1 (en) | 2008-09-23 | 2011-09-20 | 경상대학교산학협력단 | Embryonic Callus Induction and Plant Regeneration Methods from Mature Seed of Miscanthus sinensis |
| KR101013092B1 (en) * | 2009-03-25 | 2011-02-14 | 대한민국 | Rice Stripe Virus Resistant Rice Transformants and Method of Producing Thereof |
| JP2011067115A (en) * | 2009-09-24 | 2011-04-07 | National Agriculture & Food Research Organization | Viral gene for obtaining plant having resistance to virus belonging to tenuivirus by rna interference |
-
1991
- 1991-12-02 JP JP3318211A patent/JPH07313173A/en active Pending
-
1992
- 1992-11-23 TW TW081109349A patent/TW290426B/zh active
- 1992-12-01 KR KR1019920022980A patent/KR100255474B1/en not_active IP Right Cessation
- 1992-12-02 CN CN92115177A patent/CN1044385C/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109169280A (en) * | 2018-09-20 | 2019-01-11 | 四川农业大学 | The preparation method and used medium of coix lacryma-jobi regeneration plant |
| CN109169280B (en) * | 2018-09-20 | 2022-02-08 | 四川农业大学 | Preparation method of coix seed regenerated plant and culture medium used by preparation method |
Also Published As
| Publication number | Publication date |
|---|---|
| KR930013120A (en) | 1993-07-21 |
| KR100255474B1 (en) | 2000-05-01 |
| CN1044385C (en) | 1999-07-28 |
| TW290426B (en) | 1996-11-11 |
| JPH07313173A (en) | 1995-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102220277B (en) | Method for building high-efficiency regenerating and transforming system of Oryza sativaL. subsp. japonica 11 | |
| CN1452660A (en) | Methods for stable transformation of plants | |
| CN102533782B (en) | Clone and application of OsAGSw1 gene for controlling width and weight of rice grains | |
| CN104046636B (en) | A kind of PMI genes of codon vegetalization transformation and its application | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| CN107338230B (en) | The application of OsMPK11 albumen and its encoding gene in regulation plant drought resistance | |
| CN106011146A (en) | Application of OsMADS47 gene to regulation of rice grain form | |
| CN1876813A (en) | Method for improving cold resistance of zoysia | |
| CN113637060B (en) | Application of soybean GmSPA3a/3b protein and related biological materials thereof in regulating plant flowering and plant height | |
| CN1291021C (en) | Use of boea crassifolia BcBCP1 gene for breeding drought-salt-tolerant plants | |
| CN107142271A (en) | The PL LbCpf1 RR genes with high mutation efficiency and its application in gene targeting | |
| WO2019014917A1 (en) | Gene editing system and method for editing plant genome by using same | |
| CN1044385C (en) | Rice genus resisting rice genus leaf stripe virus with transformed behavious and its mfg. method | |
| CN1375005A (en) | Gene regulating plant branching, vector containing the gene, microorganism transformed by the vector, and method for regulating plant branching by using the microorganism | |
| CN1054160C (en) | Method for cultiating tomato with function of anti virus of mosaic of cucumber by gene engineering | |
| CN106591335A (en) | Codon vegetalization-transformed LbCpf1 gene and application thereof | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers | |
| CN107338231A (en) | The application of OsMPK21-1 albumen and its encoding gene in plant drought resistance is regulated and controled | |
| CN1429904A (en) | Method for gene conversion of corn | |
| CN1656881A (en) | Gentic transforming method of perennial rye grass | |
| CN104805093B (en) | Applications of the paddy gene OsLOL3 in delaying plant leaf blade aging and improving drought resistance in plants | |
| CN110257406B (en) | codon-Plant-modified Plant Nme2Cas9 gene and application thereof | |
| CN114231556B (en) | Application of GmECT2 in regulating plant height | |
| CN1818064A (en) | Cotton metallothionein gene GhMT1 sequence, its clone and use | |
| CN1206354C (en) | Plant gene promotor for quickly inducing defect stimulation and high efficienly expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: APPLICANT; FROM: MITSUBISHI CORP.; MITSUBISHI CHEMICAL CO., LTD.; AGRICULTURE MINISTRY AGRICULTURAL RESEARCH INSTITUTE OF ENVIRONMENTAL TECHNOLOGY TO: AGRICULTURE MINISTRY AGRICULTURAL RESEARCH INSTITUTE OF ENVIRONMENTAL TECHNOLOGY |
|
| CP01 | Change in the name or title of a patent holder |
Address after: Ibaraki Applicant after: Agricultural Environment Tech. Inst., Ministry of Agriculture, Forestry & Aquati Address before: Ibaraki Applicant before: Mitsubishi Corp. Applicant before: Mitsubishi Kasei Corporation Applicant before: Agricultural Environment Tech. Inst., Ministry of Agriculture, Forestry & Aquati |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C15 | Extension of patent right duration from 15 to 20 years for appl. with date before 31.12.1992 and still valid on 11.12.2001 (patent law change 1993) | ||
| OR01 | Other related matters | ||
| C56 | Change in the name or address of the patentee |
Owner name: INDEPENDENT ADMINISTRATIVE INSTITUTION, AGRICULTUR Free format text: FORMER NAME OR ADDRESS: AGRICULTURE MINISTRY AGRICULTURAL RESEARCH INSTITUTE OF ENVIRONMENTAL TECHNOLOGY |
|
| CP01 | Change in the name or title of a patent holder |
Address after: Ibaraki Patentee after: Nat Inst For Agro Enviromental Sciences Address before: Ibaraki Patentee before: Agricultural Environment Tech. Inst., Ministry of Agriculture, Forestry & Aquati |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 19990728 Termination date: 20100104 |