CN107475415A - A kind of SNP primer pairs of the method for screening the high long oyster parent shellfish of glycogen content and its correlation - Google Patents
A kind of SNP primer pairs of the method for screening the high long oyster parent shellfish of glycogen content and its correlation Download PDFInfo
- Publication number
- CN107475415A CN107475415A CN201710855508.3A CN201710855508A CN107475415A CN 107475415 A CN107475415 A CN 107475415A CN 201710855508 A CN201710855508 A CN 201710855508A CN 107475415 A CN107475415 A CN 107475415A
- Authority
- CN
- China
- Prior art keywords
- snp
- glycogen content
- genotype
- oyster
- long oyster
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of method for screening the high long oyster parent shellfish of glycogen content and its SNP primer pairs of correlation.By 486 individual whole-genome associations, 67 SNP signals significantly correlated with glycogen content on long No. 6 chromosomes of oyster are identified.1 SNP site at the scaffold1243_53489 bases of the region, develops its corresponding detection method, the results showed that can simply detect the SNP site rapidly using this method.Site CC genotype individuals are compared to TT genotype individuals simultaneously.The close shellfish of CC genotype is screened, instructs oyster breeding.Long oyster site upstream and downstream 500kb nucleotide sequence is as shown in SEQ ID No.1.Beneficial effect of the present invention carries out genotype identification, raising filial generation glycogen content to close shellfish before being seed breeding.This result of study acquisition SNP marker confidence level is higher, and effect is more stable.
Description
Technical field
The invention belongs to genetic engineering and genetic breeding field, is related to a kind of long oyster glycogen content correlation of screening
The primer pair of SNP marker and its application.
Background technology
Oyster is a kind of important marine living resources, and one of most important sea-farming shellfish in the world.China
Oyster culture scale and yield be all sure to occupy first place in the world for many years, but the average price of oyster outlet is only other countries' oyster production
The 1/3 of product.This explanation China oyster can only market one's own products mostly, it is difficult into high-end market.Improve the warp of China's oyster culture
Ji benefit, realizes industry from the poorly efficient transition and upgrade to high yield and high efficiency of high yield, the product quality for improving oyster is to need solution badly
Certainly the problem of.And the content height of the nutriment such as glycogen is one of most important characteristic of oyster.The content of glycogen not only influences male
Oyster coefficient of condition and yield, while the main taste compound of delicate flavour is used as, oyster consumption mouthfeel is affected, directly determines oyster product
Quality.The genetic improvement for carrying out the Nutrient Quality Traits such as glycogen is the important way for solving the poorly efficient present situation of China's oyster industry high yield
Footpath.
In aquatic livestock breeding research starting evening, the research to growth traits is focused primarily upon at present, method is mostly using biography
The selection of system, hybridization, cycle length, slowly effect.Quality trait research to long oyster is also rare.In the last few years, genomics
Development, the breeding technique such as molecular marking supplementary breeding and full-length genome selection have also obtained fast development, substantially increased male
The genetic breeding of oyster is horizontal, not only makes it possible the breeding of the complicated quality trait such as glycogen, while also will being obviously improved property
The Breeding Efficiency and precision of shape.Blindness can be reduced using molecular marker assisted selection simultaneously, shortens the breeding time limit, raising is educated
The efficiency of kind.And the method that molecular labeling is obtained currently with genome sequencing mainly includes QTL positioning and full-length genome pass
Join the method for analysis.Although QTL localization methods can the fast positioning chromosome segment associated with character, in character parsing side
Face has the characteristics of degree of accuracy is high.But its linkage analysis based on limited meiosis, the region of the genome large fragment of positioning
All it is chained together, it is difficult to be accurately positioned.And whole-genome association method can then overcome this shortcoming, in full-length genome
In the range of to hereditary variation gene carry out population interconnection analysis, by associated bit point location in the section of very little, significantly improve
The degree of accuracy of positioning and precision, the heredity parsing for the complex character that is particularly suitable for use in.In recent years, with non-mode biology full-length genome
The completion of sequencing, positioned using GWAS technique study complexity Quantitative Trait Genes into fashion trend.
Although GWAS has played important function in the agro-ecology of crop and livestock and poultry is studied, in aquatic livestock also only
There is a small amount of report.Such as in Atlantic salmon quality research, fillet fat content is associated using 5,650 SNP markers
Analysis.And in terms of the research of the aquatic livestock reported at present, especially bivalve shellfish association analysis is concentrated mainly on candidate gene.
But this method is to carry out the exploitation of pleomorphism site on known functional gene according to prior information, marks relative number
Mesh is few, differs and surely obtains main effect site, and can not have a comprehensive understanding to the genetic regulation mechanism of phenotype.With length
The completion of oyster genome sequencing and the acquisition of high density genetic linkage mapses so that carry out GWAS analyses and be possibly realized.
The present invention is based on long oyster genome, and carrying out full-length genome by two generation sequencing technologies resurveys sequence, and is carried out for glycogen content
Whole-genome association, obtain the main effect pleomorphism site and key gene of control glycogen content.The present invention is in full-length genome
On the basis of resurveying sequence, magnanimity SNP marker is developed, parsing determines the hereditary basis of oyster glycogen content, filtered out and glycogen content
Extremely significantly correlated cluster SNP marker, the screening for glycogen phenotype.Compared with the SNP site developed in the past, what GWAS was obtained
SNP signal confidence level is higher, while has simplicity, portable strong feature.
The content of the invention：
It is an object of the invention to provide a kind of SNP marker related to long oyster glycogen content, for the molecule mark of long oyster
Remember that assisted Selection provides reference.
Specific acquisition SNP methods are as follows：(1) experiment material collection and homogeneity raise and train：It is wild to collect 486 long oyster
Raw individual, carries out homogeneous cultivation.(2) measure of phenotypic data：Sugar is carried out to different long oyster individuals using anthrone colorimetric hair
Former assay.(3) Genotyping：Using two generation sequencing technologies platforms, full-length genome is carried out to 486 oysters and resurveys sequence, is sieved
Look into SNPs sites and carry out individual parting, obtain effective SNPs sites for association analysis, build the haplotype collection of illustrative plates of oyster.
(4) association analysis：Whole-genome association is carried out using mixed linear model, obtains 67 SNP significantly associated with character
Site (P-value<10-6), in the range of long oyster genome scaffold 1,243 16,015-67,096kb.Pass through LD
Block is analyzed, 67 SNP site close linkages (LD ＞ 0.7).Whole-genome association Manhattan figure is shown in accompanying drawing 2.Then choosing
In the base on scaffold1243_53,489kb, P-value is 2.67 × 10 for fetch bit-7, as this project candidate SNP locus.
Two base forms of T and C be present in the site.Other 66 in the range of scaffold 1243 16,015-67,096kb
SNP site all applies identical authentication method.
The present invention is achieved by the following technical programs：
A kind of SNP marker related to long oyster glycogen content：The mark is located at long oyster genome scaffold1243_
At 53,489kb base, there are two base forms of T and C in this base.The sequence such as SEQ of the site upstream and downstream 500kb
Shown in ID No.1.It is as follows to predominantly detect step：
1) long oyster genomic DNA is extracted, 10-20ng/uL is diluted to using aqua sterilisa or TE buffer solutions；
2) it is template to take long oyster genomic DNA described in step 1), and reaction system is prepared using primers F and R：Genome
DNA 1uL, universal PC R mix 5uL, primers F and each 0.2uL of R, distilled water 3.6uL is (if genomic DNA concentration≤5ng/ for sterilizing
UL, 4.6uL genomic DNAs can be added and be not added with the distilled water that sterilizes.Another reaction system can amplify on year-on-year basis)；
3) response procedures of PCR amplifications are：
It is for the above-mentioned PCR forward and reverse primer sequences expanded：
F：5’-TAGTATTAAGGCACATGCCG-3’；
R：5’-ATGATGTTTACTTGTTTGCTTG-3’.
4) after the PCR reactions described in step 3) terminate, add saturated fluorescence dyestuff Lcgreen and internal standard (mixed in equal amounts
High temperature internal standard and low temperature internal standard, i.e., two double chain oligonucleotides with different G/C contents, high and low temperature internal standard final concentration are respectively
2.5uM) each 1uL, by 95 DEG C of annealing 5-10min；
5) room temperature is naturally cooling to after the annealing described in step 4), carries out high-resolution melting curve analysis, identification is treated
The genotype of long oyster SNP marker, specific method are described in test sample sheet：
A) melting curve of all samples to be tested is corrected using interior target melting curve；
B) a point group is carried out to all sample to be tested melting curves after correction, if melting curve derivation figure is unimodal and peak value
More than 77.5 DEG C, then SNP genotype is CC to corresponding abscissa temperature, if melting curve is asked, figure is unimodal and peak value corresponds to abscissa
Temperature be less than 77.5 DEG C then SNP genotype be TT, be after the melting curve derivation it is bimodal if SNP genotype be TC；
C) long oyster SNP marker genotype described in each sample to be tested is judged.
Required high and low interior label sequence during SNP genotype identifications, wherein, high temperature interior label sequence is：
Low temperature interior label sequence is：
Target specific method is in acquisition：
1) it is single-stranded to synthesize four oligonucleotides for authorized company：
GWNB+：5’-GCGGTCAGTCGGCCTAGCGGTAGCCAGCTGCGGCACTGCGTGACGCTCAG-3’
GWNB-：5’-CGCCAGTCAGCCGGATCGCCATCGGTCGACGCCGTGACGCACTGCGAGTC-3’
DWNB+：5’-ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT-3’
DWNB-：5’-TAGCACTAAAGATATCAATAGATTCATCAACCGTAATTATTAAAGTAAAA-3’
2) dissolving four single-stranded nucleotides with sterilizing distilled water makes final concentration of 10uM；
3) four single-stranded nucleotides are mixed in equal volume, obtain the internal standard that high and low temperature internal standard final concentration is respectively 2.5uM.
The potential application of the SNP marker related to long oyster glycogen content：Up to the present, in addition to this patent, in oyster
In, there has been no the report based on whole-genome association exploitation SNP marker.This result of study is marked relative to single SNP in the past
The exploitation of note, confidence level is higher, and the scope of suited-community is wider, and effect is more stable.Before seed breeding, taken by non-lethality
Sample extracts oyster genomic DNA, judges close shellfish genotype using SNP marker and its authentication method as described above, passes through sieve
CC genotype parent shellfishes are selected to effectively improve the long oyster glycogen content of offspring.The present invention provides judges SNP according to PCR primer melting curve
The method of genotype, as shown in figure 1, when be unimodal after melting curve derivation and peak value correspond to abscissa temperature more than 77.5 DEG C when
SNP genotype is CC, when be unimodal after melting curve derivation and peak value correspond to abscissa temperature less than 77.5 DEG C when SNP genotype
For TT, SNP genotype is TC when being bimodal after melting curve derivation.
Brief description of the drawings
1. Fig. 1 is the PCR primer melting curve derivation figure in the above-mentioned scaffold1243_53,489 sites included；2. Fig. 2
It is the Manhattan figure of above-mentioned long oyster glycogen content whole-genome association.
Embodiment：
Further explain the present invention with reference to embodiments, but embodiment does not do any type of limit to the present invention
It is fixed.
Embodiment 1：
A) collection of sample：288 individuals of wild population of seedling are incubated in collection Jiangnan simultaneously, and it is dissected, takes closed shell
Flesh and remaining tissue, are saved backup with liquid nitrogen flash freezer after -80 DEG C.
B) DNA extraction：Extract the genomic DNA of 288 samples and use Uv-spectrophotometric Determination concentration, according to
Genomic DNA is diluted to 10ng/uL by measure concentration using aqua sterilisa；
C) SNP site genotype detection：The genomic DNA of dilution in step 1) is taken to enter as template using primers F and R
Performing PCR expands, and reaction system is as follows：Genomic DNA 1uL, primers F and R each 0.2uL, PCR mix 5uL, sterilize distilled water
3.6uL；
PCR amplification response procedures be：
After described PCR reactions terminate, saturated fluorescence dyestuff Lcgreen and each 1uL of internal standard is added, by 95 DEG C of DEG C of annealing
8min；
Forward primer is F：5’-TAGTATTAAGGCACATGCCG-3’；
Reverse primer is R：5’-ATGATGTTTACTTGTTTGCTTG-3’；
Reaction adds 1 μ l internal standards (internal standard is same as above) and 1 μ l LC-green dyestuffs after terminating, 95 DEG C are denatured after brief centrifugation
10min, it is cooled to room temperature.
Room temperature is naturally cooling to after annealing, carries out high-resolution melting curve analysis, test sample is treated in identification
A) melting curve of all samples to be tested is corrected using interior target melting curve；
B) a point group is carried out to all sample to be tested melting curves after correction, after melting curve derivation is unimodal and peak value
SNP genotype is CC when corresponding abscissa temperature is more than 77.5 DEG C, and after melting curve derivation be unimodal and peak value corresponds to horizontal seat
It is TT to mark SNP genotype when temperature is less than 77.5 DEG C, and SNP genotype is TC when being bimodal after melting curve derivation.
C) long oyster SNP marker genotype described in each sample to be tested is judged.
Required high and low interior label sequence during SNP genotype identifications, wherein,
High temperature interior label sequence is：
Low temperature interior label sequence is：
Target specific method is in acquisition：
1) it is single-stranded to synthesize four oligonucleotides for authorized company：
GWNB+：5’-GCGGTCAGTCGGCCTAGCGGTAGCCAGCTGCGGCACTGCGTGACGCTCAG-3’
GWNB-：5’-CGCCAGTCAGCCGGATCGCCATCGGTCGACGCCGTGACGCACTGCGAGTC-3’
DWNB+：5’-ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT-3’
DWNB-：5’-TAGCACTAAAGATATCAATAGATTCATCAACCGTAATTATTAAAGTAAAA-3’
2) dissolving four single-stranded nucleotides with sterilizing distilled water makes final concentration of 10uM；
3) four single-stranded nucleotides are mixed in equal volume, obtain the internal standard that high and low temperature internal standard final concentration is respectively 2.5uM.
D) HRM partings:Take out 96 hole PCR reaction plates and be put into the progress HRM detections of the machines of LightScanner 96, collect 55
Fluorescence signal between DEG C -95 DEG C, operation finishes carries out interpretation of result according to melting curve, counts the genotype of each individual.
E) interpretation of result:After detection, only the 102nd idiotype is C/C, and 136 idiotypes are T/C, 49
Individual idiotype is T/T, and 1 idiotype is NN.
F) detection and association analysis of glycogen content：288 wild individual glycogen contents are detected using anthrone colorimetry.
Data are shown in figure, and the order of different genotype glycogen content is CC>TC>TT.CC genotype glycogen content is compared to TT types, sugar
Former content significantly improves 8.6%.So the parting in the site significantly associates with glycogen content.By screening CC in breeding
Type individual, can significantly improve offspring's glycogen content.
Table 1：288 individual glycogen contents and Genotyping analysis.
Sequence table (1) SEQ ID NO.1 information sequence characteristic length：1001bp
Type：Nucleic acid
Chain：It is single-stranded
Topological structure：It is linear
Molecule type：DNA
Source：Long oyster
Sequence description：
AATATTCAAATACATGTATATGATGCAAGTTTTCTTCTTTATGCTACATCTTACATA
CAACACATGAACATACACTGCAGATAAATGCAGAATGAGTGATTTTCCCTGTTTTGTGAATTCTTTGACATGCAGAA
ATATTAGAGTTATTTCCCTTTTAACACAAGATATTCTTGTACAAAAGAGGACTCCGAATGTCTCCTTTGTGGTCTCT
TTTTTGTGCATTCAAATTCTCTTTTTGATGGTATGGTCATATTATAAGTATAGATACCACTTAGGAAATGCATCAAA
ACATGATAAAGATATGGCAAAATTAAAATATTTCAAGACAAGATTAATTTATGACATGGAAAACATCTGTTCAGTTA
AATAATATTTTAATTTGGTTTTTGATGCAACGTTCAAGTCTGAGATATTTATTAACAGGTATGGAACCACAATGGAA
ACACACATGAAGAATTTAGTATTAAGGCACATGCCGCCCAATTTACAAACTATGGACTTCAAGCAAACAAGTAAACA
TCATATCCTTAACCAGTTACTTTCAACTAAATGTTATCATTTGACTTTTATCCCAATTTTAAAGAGTCAGTTTGAAA
ATGAAAATTTTCAGTAATCTGCTTCTCTTCGTCAACAGCAATCCGCCCTAACTTGGACAGTTACGTGTTCCTGCGTG
TGAACGAGGACACTGACGGAGTTCTAGTGGAGGAGGAAACGTTAGACACGGGGTGAGTTATCCTGATGACACACGTG
TGTATGTAGCCGACTTACTGTACAGGAAATGTACACGTCAAGGATTTAATTTCCTGAAGTTTGTGTAGAGAAGTCTG
ATGAATACCGGTACATGATGAAGTCTGTTTCGTGGGAATTATATTTCATTGCCTGCACATTTATACAATTTGATTCT
CTTGATTTATTCTGTTTTTTAAAATGGGGCCAATGTCATATAAATTATATGTATAACCCAACAATAACTTTAATATC
ATTGTTGTAAAATATTAACA。
By 486 individual whole-genome associations, 67 on long No. 6 chromosomes of oyster and sugar are identified
The significantly correlated SNP signal of former content.1 SNP site at the scaffold1243_53489 bases of the region, is developed
Its corresponding detection method, the results showed that can simply detect the SNP site rapidly using this method.Site CC genes simultaneously
Type individual is compared to TT genotype individuals, and glycogen content significantly improves 8.6%.Subsequently can be with it, screening CC bases
Because of the close shellfish of type, oyster breeding is instructed.Long oyster site upstream and downstream 500kb nucleotide sequence such as SEQ ID No.1
It is shown.The invention provides a SNP marker and its potential application significantly correlated with long oyster glycogen content, its advantage
It is that genotype identification can be carried out to close shellfish before seed breeding, improves filial generation glycogen content.
Sequence table
<110>The Institute of Oceanology of the Chinese Academy of Sciences
<120>A kind of SNP primer pairs of the method for screening the high long oyster parent shellfish of glycogen content and its correlation
<141> 2017-09-20
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1001
<212> DNA
<213> gene
<220>
<221> gene
<222> (1)..(1001)
<400> 1
aatattcaaa tacatgtata tgatgcaagt tttcttcttt atgctacatc ttacatacaa 60
cacatgaaca tacactgcag ataaatgcag aatgagtgat tttccctgtt ttgtgaattc 120
tttgacatgc agaaatatta gagttatttc ccttttaaca caagatattc ttgtacaaaa 180
gaggactccg aatgtctcct ttgtggtctc ttttttgtgc attcaaattc tctttttgat 240
ggtatggtca tattataagt atagatacca cttaggaaat gcatcaaaac atgataaaga 300
tatggcaaaa ttaaaatatt tcaagacaag attaatttat gacatggaaa acatctgttc 360
agttaaataa tattttaatt tggtttttga tgcaacgttc aagtctgaga tatttattaa 420
caggtatgga accacaatgg aaacacacat gaagaattta gtattaaggc acatgccgcc 480
caatttacaa actatggact tcaagcaaac aagtaaacat catatcctta accagttact 540
ttcaactaaa tgttatcatt tgacttttat cccaatttta aagagtcagt ttgaaaatga 600
aaattttcag taatctgctt ctcttcgtca acagcaatcc gccctaactt ggacagttac 660
gtgttcctgc gtgtgaacga ggacactgac ggagttctag tggaggagga aacgttagac 720
acggggtgag ttatcctgat gacacacgtg tgtatgtagc cgacttactg tacaggaaat 780
gtacacgtca aggatttaat ttcctgaagt ttgtgtagag aagtctgatg aataccggta 840
catgatgaag tctgtttcgt gggaattata tttcattgcc tgcacattta tacaatttga 900
ttctcttgat ttattctgtt ttttaaaatg gggccaatgt catataaatt atatgtataa 960
cccaacaata actttaatat cattgttgta aaatattaac a 1001
Claims (5)
1. a kind of screen the related SNP primer pairs of the long oyster parent shellfish of high glycogen content, it is characterised in that：
Forward primer is F：5’-TAGTATTAAGGCACATGCCG-3’；
Reverse primer is R：5’-ATGATGTTTACTTGTTTGCTTG-3’.
A kind of 2. method for screening the long oyster parent shellfish of high glycogen content as claimed in claim 1, it is characterised in that：
One SNP marker is obtained by whole-genome association, it is located at long oyster genome scaffold1243_53,
At 489kb bases；There are two base forms of T and C in the site, carry out the SNP marker site base to close shellfish before seed breeding
Because type identifies that the order of different genotype glycogen content is CC>TC>TT, by screening the close shellfish of site CC genotype, improve
The glycogen content of progeny population,
It is as follows including step：
(1) extraction of the long oyster genome, specially extracts long oyster genomic DNA, uses aqua sterilisa or TE buffer solutions
It is diluted to 10-20ng/uL；
(2) the long oyster genomic DNA is template, prepares reaction system：Genomic DNA 1uL, universal PC R mix 5uL, draws
Each 0.2uL of thing F and R, sterilizing distilled water 3.6uL；The reaction system can amplify on year-on-year basis；
(3) response procedures of PCR amplifications are：
(4) after the PCR reactions described in terminate, saturated fluorescence dyestuff Lcgreen and each 1uL of internal standard is added, is moved back by 95 DEG C -98 DEG C
Fiery 5-10min；
(5) room temperature is naturally cooling to after annealing, carries out high-resolution melting curve analysis, test sample is treated in identification
A) melting curve of all samples to be tested is corrected using interior target melting curve；
B) a point group is carried out to all sample to be tested melting curves after correction, after melting curve derivation be unimodal and peak value is corresponding
SNP genotype is CC when abscissa temperature is more than 77.5 DEG C, and after melting curve derivation be unimodal and peak value corresponds to abscissa temperature
SNP genotype is TT when degree is less than 77.5 DEG C, and SNP genotype is TC when being bimodal after melting curve derivation.
C) long oyster SNP marker genotype described in each sample to be tested is judged.
3. the method for the high long oyster parent shellfish of glycogen content of screening according to claim 2, it is characterised in that：
In the step (5), the high temperature internal standard and low temperature internal standard of mixed in equal amounts are inside designated as, i.e., two have the double of different G/C contents
Chain oligonucleotides, high and low temperature internal standard final concentration are respectively 2.5 μM.
4. the method for the high long oyster parent shellfish of glycogen content of screening according to claim 3, it is characterised in that：
Required high and low interior label sequence during SNP genotype identifications, wherein,
High temperature interior label sequence is：
Low temperature interior label sequence is：
5. the method for the high long oyster parent shellfish of glycogen content of screening according to claim 3, it is characterised in that：
Target specific method is in acquisition：
1) it is single-stranded to synthesize four oligonucleotides for authorized company：
GWNB+：5’-GCGGTCAGTCGGCCTAGCGGTAGCCAGCTGCGGCACTGCGTGACGCTCAG-3’GWNB-：5’-
CGCCAGTCAGCCGGATCGCCATCGGTCGACGCCGTGACGCACTGCGAGTC-3’DWNB+：5’-
ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT-3’DWNB-：5’-
TAGCACTAAAGATATCAATAGATTCATCAACCGTAATTATTAAAGTAAAA-3 ' 2) dissolves four lists with sterilizing distilled water
Chain nucleotides makes final concentration of 10uM；
3) four single-stranded nucleotides are mixed in equal volume, obtain the internal standard that high and low temperature internal standard final concentration is respectively 2.5uM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710855508.3A CN107475415A (en) | 2017-09-20 | 2017-09-20 | A kind of SNP primer pairs of the method for screening the high long oyster parent shellfish of glycogen content and its correlation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710855508.3A CN107475415A (en) | 2017-09-20 | 2017-09-20 | A kind of SNP primer pairs of the method for screening the high long oyster parent shellfish of glycogen content and its correlation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107475415A true CN107475415A (en) | 2017-12-15 |
Family
ID=60586151
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710855508.3A Pending CN107475415A (en) | 2017-09-20 | 2017-09-20 | A kind of SNP primer pairs of the method for screening the high long oyster parent shellfish of glycogen content and its correlation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107475415A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355400A (en) * | 2018-11-30 | 2019-02-19 | 中国科学院海洋研究所 | Long oyster glycogen content related gene and SNP marker identification and high glycogen individual screening technique |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103740702A (en) * | 2014-01-07 | 2014-04-23 | 中国科学院海洋研究所 | SNP (Single Nucleotide Polymorphism) marker relevant to heat tolerance of argopectehs irradias and identification method and potential application thereof |
| CN104152444A (en) * | 2014-07-24 | 2014-11-19 | 中国科学院海洋研究所 | SNP (single-nucleotide polymorphism) marker related to Crassostrea gigas glycogen content character and application thereof |
| CN104450697A (en) * | 2014-12-02 | 2015-03-25 | 中国科学院海洋研究所 | SNP marker associated with oyster antiviral properties and application thereof |
| CN105506162A (en) * | 2016-01-31 | 2016-04-20 | 中国海洋大学 | SNP marker related to rapid growth of pacific oysters and identification method as well as application thereof |
-
2017
- 2017-09-20 CN CN201710855508.3A patent/CN107475415A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103740702A (en) * | 2014-01-07 | 2014-04-23 | 中国科学院海洋研究所 | SNP (Single Nucleotide Polymorphism) marker relevant to heat tolerance of argopectehs irradias and identification method and potential application thereof |
| CN104152444A (en) * | 2014-07-24 | 2014-11-19 | 中国科学院海洋研究所 | SNP (single-nucleotide polymorphism) marker related to Crassostrea gigas glycogen content character and application thereof |
| CN104450697A (en) * | 2014-12-02 | 2015-03-25 | 中国科学院海洋研究所 | SNP marker associated with oyster antiviral properties and application thereof |
| CN105506162A (en) * | 2016-01-31 | 2016-04-20 | 中国海洋大学 | SNP marker related to rapid growth of pacific oysters and identification method as well as application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 刘思玮: "长牡蛎糖原磷酸化酶基因SNPs与生长性状和糖原含量的相关性分析", 《中国水产科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355400A (en) * | 2018-11-30 | 2019-02-19 | 中国科学院海洋研究所 | Long oyster glycogen content related gene and SNP marker identification and high glycogen individual screening technique |
| CN109355400B (en) * | 2018-11-30 | 2022-02-22 | 中国科学院海洋研究所 | Method for identifying genes related to content of glycogen of crassostrea gigas and SNP (Single nucleotide polymorphism) marker and screening high glycogen individuals |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105803071B (en) | SNP marker relevant to melon powdery mildew resistance and its application | |
| CN105886642B (en) | SNP marker relevant to Chinese Sheep tail type character and its application | |
| CN106434955B (en) | SNP marker relevant to Chinese Goat milk production trait and its application | |
| CN109880890B (en) | Detection method of goat HIAT1 gene insertion/deletion polymorphism and application thereof | |
| CN106048042B (en) | For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits color traits | |
| CN105274094B (en) | SNP marker and its application | |
| CN112080582A (en) | KASP molecular marker closely linked with spike length major QTL locus and application thereof | |
| CN107475414B (en) | Method for screening parent oysters with high glycogen content | |
| CN109706231B (en) | High-throughput SNP (single nucleotide polymorphism) typing method for molecular breeding of litopenaeus vannamei | |
| CN108179220B (en) | KASP marker tightly linked with wheat dwarf gene Rht12 and application thereof | |
| CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
| CN114606332A (en) | SNP (Single nucleotide polymorphism) site and Hf-KASP1 marker for judging pulp hardness of watermelon and application thereof | |
| CN110541041B (en) | SNP marker related to Chinese domestic horse dwarf trait and application thereof | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| US20210332433A1 (en) | Method for identifying genetic sex of Portunus trituberculatus | |
| CN117144017B (en) | Molecular marker related to chicken growth traits and application thereof | |
| CN112375827A (en) | SNP marker related to growth of macrobrachium rosenbergii as well as typing method and application thereof | |
| CN103605913B (en) | Method applied to identification of pacific oyster family | |
| CN107475415A (en) | A kind of SNP primer pairs of the method for screening the high long oyster parent shellfish of glycogen content and its correlation | |
| CN107354234B (en) | Method for screening parent oysters with high glycogen content and related primer pair thereof | |
| CN113355449B (en) | Elytrigia elongata 3E chromosome specific codominant KASP molecular marker and application thereof | |
| CN116083592A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN107365873A (en) | Molecular labeling and its application with the millet leaf sheath color linkage of characters | |
| CN110305974B (en) | PCR analysis primer for distinguishing common mouse inbred lines based on detection of five SNP loci and analysis method thereof | |
| KR101854896B1 (en) | Single nucleotide polymorphism markers for identifying korean traditional dog breeds and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |