CN107468717A - A kind of blood sugar reducing preparation for human body and preparation method thereof - Google Patents
A kind of blood sugar reducing preparation for human body and preparation method thereof Download PDFInfo
- Publication number
- CN107468717A CN107468717A CN201710902310.6A CN201710902310A CN107468717A CN 107468717 A CN107468717 A CN 107468717A CN 201710902310 A CN201710902310 A CN 201710902310A CN 107468717 A CN107468717 A CN 107468717A
- Authority
- CN
- China
- Prior art keywords
- probiotics
- preparation
- bacterium
- lactobacillus
- blood sugar
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
- A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
- A61K35/745—Bifidobacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/06—Quantitative determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Toxicology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The present invention proposes a kind of blood sugar reducing preparation for human body, and composition includes at least one probiotics, and every kind of probiotics quantity is：107~1013 CFU, every dose of bacterium number altogether：8×107~8 × 1013 CFU.The invention also discloses a kind of preparation method of the blood sugar reducing preparation for human body.Blood sugar reducing preparation for human body of the present invention and preparation method thereof can promote gastrointestinal function, and the immune system of adjustable body corrects enteric microorganism disorder to reach, and have the effect of reducing glycated hemoglobin and treatment diabetes.
Description
Technical field
The present invention relates to formulation art, more particularly to a kind of blood sugar reducing preparation for human body and preparation method thereof.
Background technology
Type ii diabetes are that modern society endangers one of principal disease of health of people.According to relevant report, China has about 1.2 hundred million
Diabetic, and this numeral is also increasing year by year.The glycemic control of most diabetics fails to reach doctor's phase
Hope the level reached, i.e. glycated hemoglobin<7.0 (normal value A1c<5.7), to prevent diabetic complication as much as possible
Occur.The ineffective direct result of glycemic control is exactly that diabetic syndrome includes：Amputation, blindness, renal failure, the heart
The disease of cardiovascular systems such as popular name for.So strict glycemic control is effectively to prevent diabetic syndrome, ensure type-II diabetes disease
The necessary condition of people's normal life.
The medicine for being now widely used in treatment type-II diabetes is broadly divided into two classes from the mechanism of action：One kind is insulin
Or promoting the medicine of insulin secretion class, the medicine of the another kind of sensitiveness for being the insulin for improving cell resists to anti-insulin
The medicine of property.Regrettably, this two classes medicine can not in most cases control the blood glucose of type-II diabetes patient completely.
The pathogenesis of type-II diabetes is commonly considered as body with advancing age to be reduced to the sensitiveness of insulin,
In addition it is fat caused by higher fatty acid high-protein diet custom, and lack appropriate motion and cause pair of the body to insulin
It is anti-.Namely body it is main with sugared organ for example, muscle and adipose tissue reduce to the sensitiveness of insulin, so as to cause to drink
The glucose in food source can not smoothly be utilized into cell and largely residue in blood.And long-term too high blood glucose is finally made
The infringement of paired blood vessel, especially thin vessels and cause the generation of diabetic complication.It is but although a large amount of in the past few decades
Resistance insulin resistance medicine discovery and do not have particularly apparent improvement into Clinical practice, the control of diabetes.
Although there is numerous hypoglycemic drugs including insulin at present, because type-II diabetes are with year
The increase in age and constantly deteriorate, the reason for diet and other habits and customs can not change etc. easily in addition, can really control
The patient of good blood glucose is simultaneously few.So there is an urgent need to effectively control medicine or the measure of blood glucose, to be reduced as far as diabetes
The generation of complication.
The content of the invention
The present invention provides a kind of blood sugar reducing preparation for human body and preparation method thereof, can promote gastrointestinal function, adjustable
The immune system for saving body corrects enteric microorganism disorder to reach, and has the treatment for reducing glycated hemoglobin and treating diabetes
Effect.
What the technical program was realized in：
The invention discloses a kind of blood sugar reducing preparation for human body, composition includes at least one probiotics, every kind of prebiotic
Bacterium number amount is：107~1013CFU, every dose of bacterium number altogether：8×107~8 × 1013CFU。
Further, the probiotics includes：One or more in lactobacillus or Bifidobacterium.
Further, described lactobacillus includes：Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus rhamnosus, cheese breast bar
One or more in bacterium, lactobacillus reuteri.
Further, described Bifidobacterium includes：In bifidobacterium bifidum, long Bifidobacterium Bifidum, animal bifidobacteria
It is one or more.
Further, the blood sugar reducing preparation can be derived from a kind of probiotics and simply connected preparation is made, takes two kinds of probiotics
Duplex preparation is made, takes three kinds of probiotics that three preparations are made, the rest may be inferred.
Further, the probiotics is bacteria preparation or inactivation of bacterial preparation living.
Further, described blood sugar reducing preparation is Formulation, capsule preparations or powderous preparations.
The invention discloses a kind of manufacture method of the blood sugar reducing preparation for human body, including：
The production of probiotics：It is made using the ferment tank of high-precision fermentation；
The identification of probiotics：Extracted to obtain the specific DNA of every kind of probiotics respectively with standard purification methods, with more
Polymerase chain reaction expands to obtain the 16SrRNA genetic fragments of every kind of probiotics, and this amplified fragments is sent into business sequencing mechanism surveys
Sequence, determine whether survey series is specific prebiotic by standard by genetic analysis software with the 16SrRNA genes of every kind of probiotics
Bacterium, polymerase chain reaction,PCR amplification universal primer are as follows：
Lac1:AACAGGATTAGATACCCTGGTAGTC
Lac2:GCGGTGTGTACAAGGCCCGGGAACG
Count of bacteria：Bacterium solution after fermentation is diluted to three different diluted concentrations of every 0.5 milliliter 10,100,500 bacterium, respectively
The bacterium solution bedding after 0.5 milliliter of dilution is taken out into an agarose culture dish, is cultivated 24 hours, the bacterium in count plates
Number, counting × extension rate of the culture dish, each 100 bacteriums of culture dish or so of suitable concn is selected according to three dilution factors
Bacterial concentration in as original bacterium solution；
Bacterium is collected：Probiotics is collected by centrifugation in zymotic fluid containing profitable probliotics and is dissolved in freezing liquid, is freeze-dried, according to cold
Bacterial concentration before jelly is estimated that the concentration of bacterium in probiotics dry powder after freezing, i.e., the number of bacterium in every gram；
Mixing：The probiotics mixing that constant weight is weighed according to the content of probiotics in the probiotics bacterium powder after freeze-drying is equal
It is even, it can be determined with every gram of prebiotic bacterial content, the prebiotic bacterium number of each capsule predetermined design and the predetermined capsule number for needing to pay close attention to
The Freeze-dry Powder of Probioctics of required weighing, you can tank capsule is carried out, it is determined that the sum of probiotics is 10 in each capsule7~
1013CFU/g, wherein planting, the quantity of every kind of probiotics can be equal or unequal；
Capsule polishes：Capsule is polished with capsule polishing separator, and sub-elects unqualified capsule, qualified capsule is mounted in and sterilized
Clean rustless steel container in, it is closed, and be then dispensed into Packaging Bottle, seal bottleneck, put -80 degree refrigerator for cold.
Further, the probiotics includes：One or more in lactobacillus or Bifidobacterium, described lactobacillus bag
Include：Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus casei, lactobacillus reuteri, use commercial lactobacillus
MRS culture mediums；Described Bifidobacterium includes：Bifidobacterium bifidum, long Bifidobacterium Bifidum, animal bifidobacteria, using commercial strong
Change clostridia media.
Implement a kind of blood sugar reducing preparation for human body of the present invention and preparation method thereof, there is technology effect beneficial below
Fruit：
Gastrointestinal function can be promoted, the immune system of adjustable body corrects enteric microorganism disorder to reach, and having reduces blood
The effect of Lactoferrin A1c and treatment diabetes.
Embodiment
The embodiment of the present invention, a kind of blood sugar reducing preparation for human body, composition includes at least one probiotics, every kind of
Probiotics quantity is：107~1013CFU, every dose of bacterium number altogether：8×107~8 × 1013CFU。
Probiotics includes：One or more in lactobacillus or Bifidobacterium.
Lactobacillus includes：Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus casei, lactobacillus reuteri
In one or more.
Bifidobacterium includes：One or more in bifidobacterium bifidum, long Bifidobacterium Bifidum, animal bifidobacteria.
Blood sugar reducing preparation can be derived from a kind of probiotics be made simply connected preparation, take two kinds of probiotics be made duplex preparation,
Take three kinds of probiotics that three preparations are made, the rest may be inferred.
Probiotics is bacteria preparation or inactivation of bacterial preparation living.
Blood sugar reducing preparation is Formulation, capsule preparations or powderous preparations.
Further illustrate, pick (lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus rhamnosus, dry by five kinds of lactobacillus
Lactobacillus paracasei, lactobacillus reuteri) and three kinds of Bifidobacterium (bifidobacterium bifidum, long Bifidobacterium Bifidum, animal bifidobacteria) groups
Into probiotics mixture, as shown in table 1.
The probiotics title of table 1. and preparation bacterium number scope
Every dose of average every kind of probiotics dosage is 107~1013CFU, every dose of bacterium number altogether：8×107~8 × 1013CFU.Practice card
In fact, this probiotics closes eight preparations with obvious drop blood-glucose effect thus to type-II diabetes with therapeutic action.
By eight kinds of probiotic groups that table 1 is listed into eight preparations arbitrarily change into seven preparations, six preparations, 5-linked system
Agent, tetrad preparation, three preparations, bigeminy preparation, even single probiotics, as long as preparation total bacteria count reaches 8 × 107~8 ×
1013CFU, its hypoglycemic treatment type-II diabetes effect are still fairly obvious.
Inactivation of bacterial preparation is made according to corresponding bacterium number amount in the probiotic ingredient that table 1 is listed, i.e., dead bacteria preparation, preparation
Still there is certain effect for reducing blood glucose and treating diabetes.
On a kind of blood sugar reducing preparation preparation method for human body, it is described as follows below：
Preparation method：
1. raw material sources：U.S.'s ATCC Culture Collections.
2. the production of probiotics：It is made using the ferment tank of high-precision fermentation.Wherein five kinds of lactobacillus
(lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus casei, lactobacillus reuteri) uses commercial lactobacillus MRS
Culture medium, and three kinds of Bifidobacteriums (bifidobacterium bifidum, long Bifidobacterium Bifidum, animal bifidobacteria) strengthen clostridium training using commercial
Support base.
3. the identification of probiotics：Extracted to obtain the specific DNA per middle probiotics respectively with standard purification methods
(DNA).Expanded to obtain the 16SrRNA genetic fragments of every kind of probiotics with polymerase chain reaction,PCR.This amplified fragments is sent to business
Mechanism sequencing is sequenced.Determine whether survey series using the 16SrRNA genes of every kind of probiotics by standard by genetic analysis software
For specific probiotics.Polymerase chain reaction,PCR amplification universal primer is as follows：
Lac1:AACAGGATTAGATACCCTGGTAGTC
Lac2:GCGGTGTGTACAAGGCCCGGGAACG
4. count of bacteria：Because the culture concentration of probiotics in the medium is relatively stable, typically in 600 nanometer wave strong points
Optical density between 1~2, the estimated concentration of bacterium is about 1~2 × 109CFU/ml or so.According to this optical density and correspondingly
Concentration, bacterium solution after fermentation can be diluted to three different diluted concentrations of every 0.5 milliliter 10,100,500 bacterium.It is each to take out
Bacterium solution bedding after 0.5 milliliter of dilution is cultivated 24 hours into an agarose culture dish.Bacterial population in count plates.
Selected the counting of the culture dish (each 100 bacteriums of culture dish or so) of suitable concn surplus with extension rate according to three dilution factors
Bacterial concentration in as original bacterium solution.
5. bacterium is collected：Probiotics is collected by centrifugation in zymotic fluid containing profitable probliotics and is dissolved in freezing liquid (commercialization freezing
Liquid or self-control freezing liquid), freeze-drying.Bacterium in probiotics dry powder is estimated that after freezing according to the bacterial concentration before freezing
Concentration, i.e., the number (CFU/ grams) of bacterium in every gram.
6. mixing：According to the content of probiotics in the probiotics bacterium powder after freeze-drying weigh eight kinds of constant weight it is prebiotic
Bacterium is well mixed.With every gram of prebiotic bacterial content, the prebiotic bacterium number of each capsule predetermined design and the predetermined capsule number for needing to pay close attention to
The Freeze-dry Powder of Probioctics of weighing required for can determining, you can carry out tank capsule.Present invention determine that in each capsule probiotics it is total
Number is 107~1013CFU.The quantity of wherein every kind of probiotics can be equal or unequal.Same probiotic group into it is thin
Tablet or pulvis can also be made in addition to capsule preparations are made in bacterium number, and compares the effect of between various formulations not bright
Aobvious difference.
7. capsule polishes：Capsule is polished with capsule polishing separator, and sub-elects unqualified capsule.Qualified capsule is mounted in
It is closed in the clean rustless steel container sterilized, and be then dispensed into Packaging Bottle.Bottleneck is sealed, puts -80 degree refrigerator for cold.
Embodiment one
Eight kinds of probiotics in table 1., be respectively prepared eight kinds of simply connected probiotics capsule preparations (every dose comprise only it is a kind of prebiotic
Bacterium), but the dosage of single bacterium is 107CFU.Effect observation is carried out in diabetic with the probiotics capsule preparation.At random
50~70 years old diabetic is selected, current blood glucose control is bad, and blood glucose value is between 8~11 mMs.Patient is randomly divided into
Eight groups, every group of 16 people.Patient takes an agent capsules daily, continuously takes three months.Front and rear each extraction blood sample is taken, and detects blood
Lactoferrin A1c content.It the results are shown in Table 2.
Therapeutic effect of the 2. single probiotics preparation of table to glycated hemoglobin
| Probiotics name | Before treatment | After treatment | Δ average |
| Lactobacillus acidophilus | 9.4 | 9.21 | 0.19* |
| Lactobacillus plantarum | 9.62 | 9.37 | 0.25* |
| Lactobacillus rhamnosus | 9.28 | 9.11 | 0.17* |
| Lactobacillus casei | 9.51 | 9.29 | 0.22* |
| Lactobacillus reuteri | 9.35 | 9.22 | 0.13* |
| Bifidobacterium bifidum | 9.45 | 9.3 | 0.15* |
| Long Bifidobacterium Bifidum | 9.31 | 9.12 | 0.19* |
| Animal bifidobacteria | 9.56 | 9.35 | 0.21* |
*P<0.01
Experiment shows, using single probiotics, there is significant therapeutic effect to the glycated hemoglobin of diabetic.It is hypoglycemic
Average is acted between 0.13~0.25 mM, average value 0.19, P<0.01, there is the statistical significance of highly significant.
Embodiment two
Probiotics and corresponding dosage in table 3., we are made eight probiotics preparations, counted in each capsule probiotics
For 8 × 1012CFU.Effect observation is equally carried out in diabetic with the probiotics capsule preparation.Random selection 50-70 year
The people of diabetic 16, current blood glucose control is bad, and blood glucose value is between 8~11 mMs.Patient takes an agent capsules daily,
Continuously take three months.Front and rear each extraction blood sample is taken, and detects the content of glycated hemoglobin.
The probiotics title of table 3. 8 and preparation bacterium number
| Probiotics name | Probiotics English name | Probiotics preparation (CFU) containing bacterium number |
| Lactobacillus acidophilus | Lactobacillusacidophilus | 1012 |
| Lactobacillus plantarum | Lactobacillusplantarum | 1012 |
| Lactobacillus rhamnosus | Lactobacillusrhamnosus | 1012 |
| Lactobacillus casei | Lactobacilluscasei | 1012 |
| Lactobacillus reuteri | Lactobacillusreuteri | 1012 |
| Bifidobacterium bifidum | Bifidobacteriumbifidum | 1012 |
| Long Bifidobacterium Bifidum | Bifidobacteriumlongum | 1012 |
| Animal bifidobacteria | Bifidobacteriumanimalissubsp.lactis | 1012 |
It the results are shown in Table 4.
Effect observation of the probiotics preparation of table 4. 8 to drop glycated hemoglobin
| Case | Before treatment | After treatment | Δ average |
| 1 | 8.8 | 7.2 | 1.6 |
| 2 | 10.6 | 8.1 | 2.5 |
| 3 | 10 | 7.9 | 2.1 |
| 4 | 8.9 | 7 | 1.9 |
| 5 | 9.6 | 7.5 | 2.1 |
| 6 | 10.4 | 7.7 | 2.7 |
| 7 | 9.3 | 7.4 | 1.9 |
| 8 | 10.5 | 8.1 | 2.4 |
| 9 | 9.8 | 7.7 | 2.1 |
| 10 | 9.9 | 8.1 | 1.8 |
| 11 | 9.5 | 7.6 | 1.9 |
| 12 | 10.2 | 7.7 | 2.5 |
| 13 | 9.8 | 7.5 | 2.3 |
| 14 | 9.3 | 7.1 | 2.2 |
| 15 | 9.6 | 8.1 | 1.5 |
| 16 | 9.7 | 7.9 | 1.8 |
| Average | 9.74 | 7.66 | 2.08* |
*P<0.01
As a result show, the average A1c values of the preceding patient for the treatment of are 9.74, and A1c values are 7.66 after treatment, averagely reduce by 2.08, P<
0.01.Statistical significance with highly significant.Averagely reduced with the line antidiabetic drug melbine of document report anti-diabetic one
A1c1% is compared, and is 2.08 times of melbine effect.With highly significant effect.
Embodiment three
According to the probiotics and corresponding dosage listed in table 3., we according to randomly assigne have selected seven kinds, six kinds, five kinds,
Four kinds, three kinds and two kinds different probiotics respectively be made seven, six, 5-linked, tetrad, three, bigeminy probiotics preparation.Often
Total prebiotic bacterium number of kind preparation is identical with example two, i.e., each prebiotic bacterium number of capsule is still 8 × 1010CFU.It is equally prebiotic with this
Bacterium capsule preparations carry out effect observation in diabetic.50~70 years old people of diabetic 16 of random selection, current blood glucose
Control bad, blood glucose value is between 8~11 mMs.Patient takes the probiotics capsule in one table 5 daily, continuously takes three
Individual month.Front and rear each extraction blood sample is taken, and detects the content of glycated hemoglobin.As a result show as follows：
Effect observation of the 5. multi-joint probiotics preparation of table to drop glycated hemoglobin
| Probiotics preparation | Every group of patient's number | Before treatment | After treatment | Δ average |
| Seven | 16 | 9.5 | 7.3 | 2.2* |
| Six | 16 | 10.5 | 8.5 | 2.0* |
| 5-linked | 16 | 9.3 | 7.4 | 1.9* |
| Tetrad | 16 | 9.8 | 8.0 | 1.8* |
| Three | 16 | 9.1 | 7.5 | 1.6* |
| Bigeminy | 16 | 10.2 | 8.6 | 1.7* |
*P<0.01
Experimental result is shown, using identical probiotics quantity, although reducing the species of probiotics to some extent, in a short time
Different preparations still has including seven, six, 5-linked, tetrad, three, bigeminy probiotics preparation combines bacteria preparation phase with eight
Near obvious blood sugar reducing function, there is the statistical significance of very significant, P<0.01.
Enteron aisle caused by coming from age, eating habit etc. in view of the more generally acknowledged onset diabetes mechanism of academic circles at present
Micropopulation disorder and cause body to be chronically at a kind of chronic infecting state.Just because of the length of body chronic infecting state
Phase is present, and causes forfeiture of the body progressive to the sensitiveness of insulin, i.e. insulin resistance, and ultimately forms diabetes.
And probiotics has regulation human body alimentary canal function simultaneously, strengthen the effect of immunity of organism, so, this probiotics blood sugar reducing preparation
It is as comprehensively that all probiotics with certain hypoglycemic effect are all included as possible, preferably to play benefit comprehensively
Mutual synergy between raw bacterium corrects enteric microorganism disorder to reach, and strengthens immunity of organisms, treats the mesh of diabetes
's.
Implement blood sugar reducing preparation in the application and preparation method thereof, technology beneficial effect feature is：
Progressive one：
Although the pathogenesis of diabetes come from caused by the disorder of enteric microorganism it is theoretical progressively obtained academia and
Clinical medical extensive accreditation, still, up to the present, also without a kind of for this disorderly II type glycosuria of enteric microorganism
The remedy measures or medicine of disease morbidity true cause.This probiotics antihypelipidemic preparation is currently the only to go out from onset diabetes mechanism
Hair, carry out " underlying " treatment diabetes and hypoglycemic preparation.It will fundamentally change current treating diabetes and drop
The present situation of blood glucose, the blood glucose of diabetic is efficiently controlled, reduce or eliminate mortality diabetic complication, improve diabetes
The weather of patient, mitigate diabetes family and country to the medical burdens of diabetes, have it is extremely important economical and
Social effect.
Progressive two：
Our systems and comprehensively collect and screened institute's profitable probliotics, select five kinds of lactobacillus and three kinds of Bifidobacteriums
A kind of preparation of probiotics eight is made in totally eight kinds of probiotics (being shown in Table 3).Our experiment proves that such combination has reached
The optimum efficiency of probiotics agents treatment diabetes.
Progressive three：
The body chronic infecting state caused by enteric microorganism disorder is also a series of other diseases of old people such as obesity, high blood
Pressure, disease of cardiovascular system, Neuro-degenerative become disease, such as senile dementia, the original morbidity root waited, use the present invention
Probiotics preparation, also can simultaneously to a series of above-mentioned diseases have alleviation or therapeutic action, to further strengthen the elderly guarantor
It is strong to have important practical significance.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
God any modification, equivalent substitution and improvements made etc., should be included in the scope of the protection with principle.
Claims (9)
1. a kind of blood sugar reducing preparation for human body, it is characterised in that composition includes at least one probiotics, every kind of prebiotic
Bacterium number amount is 107~1013Between CFU, every dose bacterium number is at least altogether：8×107~8 × 1013CFU。
2. blood sugar reducing preparation as claimed in claim 1, it is characterised in that the probiotics includes：Lactobacillus or Bifidobacterium
In one or more.
3. blood sugar reducing preparation as claimed in claim 2, it is characterised in that described lactobacillus includes：Lactobacillus acidophilus, plant
One or more in lactobacillus, Lactobacillus rhamnosus, Lactobacillus casei, lactobacillus reuteri.
4. blood sugar reducing preparation as claimed in claim 2 or claim 3, it is characterised in that described Bifidobacterium includes：The double qi bars of two qis
One or more in bacterium, long Bifidobacterium Bifidum, animal bifidobacteria.
5. blood sugar reducing preparation as claimed in claim 4, it is characterised in that the blood sugar reducing preparation can be derived from a kind of probiotics
Simply connected preparation is made, takes two kinds of probiotics that duplex preparation is made, takes three kinds of probiotics that three preparations are made, the rest may be inferred.
6. blood sugar reducing preparation as claimed in claim 1, it is characterised in that the probiotics is bacteria preparation or inactivation of bacterial living
Preparation.
7. blood sugar reducing preparation as claimed in claim 1, it is characterised in that described blood sugar reducing preparation is Formulation, capsule
Preparation or powderous preparations.
A kind of 8. manufacture method of blood sugar reducing preparation for human body, it is characterised in that：
The production of probiotics：It is made using the ferment tank of high-precision fermentation；
The identification of probiotics：Extracted to obtain the specific DNA of every kind of probiotics respectively with standard purification methods, with more
Polymerase chain reaction expands to obtain the 16S rRNA genetic fragments of every kind of probiotics, and this amplified fragments is sent into business sequencing mechanism surveys
Sequence, determine whether survey series is specific prebiotic by standard by genetic analysis software with the 16S rRNA genes of every kind of probiotics
Bacterium, polymerase chain reaction,PCR amplification universal primer are as follows：
Lac1:AACAGGATTAGATACCCTGGTAGTC
Lac2:GCGGTGTGTACAAGGCCCGGGAACG
Count of bacteria：Bacterium solution after fermentation is diluted to three different diluted concentrations of every 0.5 milliliter 10,100,500 bacterium, respectively
The bacterium solution bedding after 0.5 milliliter of dilution is taken out into an agarose culture dish, is cultivated 24 hours, the bacterium in count plates
Number, counting × extension rate of the culture dish, each 100 bacteriums of culture dish or so of suitable concn is selected according to three dilution factors
Bacterial concentration in as original bacterium solution；
Bacterium is collected：Probiotics is collected by centrifugation in zymotic fluid containing profitable probliotics and is dissolved in freezing liquid, is freeze-dried, according to cold
Bacterial concentration before jelly is estimated that the concentration of bacterium in probiotics dry powder after freezing, i.e., the number of bacterium in every gram；
Mixing：The probiotics mixing that constant weight is weighed according to the content of probiotics in the probiotics bacterium powder after freeze-drying is equal
It is even, it can be determined with every gram of prebiotic bacterial content, the prebiotic bacterium number of each capsule predetermined design and the predetermined capsule number for needing to pay close attention to
The Freeze-dry Powder of Probioctics of required weighing, you can tank capsule is carried out, it is determined that the sum of probiotics is 10 in each capsule7~
1013CFU, wherein, the quantity of every kind of probiotics can be equal or unequal；
Capsule polishes：Capsule is polished with capsule polishing separator, and sub-elects unqualified capsule, qualified capsule is mounted in and sterilized
Clean rustless steel container in, it is closed, and be then dispensed into Packaging Bottle, seal bottleneck, put -80 degree refrigerator for cold.
9. manufacture method as claimed in claim 8, it is characterised in that the probiotics includes：In lactobacillus or Bifidobacterium
One or more, described lactobacillus includes：Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus casei,
Lactobacillus reuteri, use commercial lactobacillus MRS culture mediums；Described Bifidobacterium includes：Bifidobacterium bifidum, long double qi bars
Bacterium, animal bifidobacteria, use commercial reinforced clostridial medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710902310.6A CN107468717A (en) | 2017-09-28 | 2017-09-28 | A kind of blood sugar reducing preparation for human body and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710902310.6A CN107468717A (en) | 2017-09-28 | 2017-09-28 | A kind of blood sugar reducing preparation for human body and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107468717A true CN107468717A (en) | 2017-12-15 |
Family
ID=60604722
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710902310.6A Withdrawn CN107468717A (en) | 2017-09-28 | 2017-09-28 | A kind of blood sugar reducing preparation for human body and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107468717A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111228316A (en) * | 2020-03-02 | 2020-06-05 | 成都六然医疗科技有限公司 | Composite probiotics for improving diabetes |
| CN115137757A (en) * | 2022-07-29 | 2022-10-04 | 承葛健康科技(广东)有限公司 | Probiotic composition assisting in reducing blood sugar |
| CN115281345A (en) * | 2022-04-06 | 2022-11-04 | 金华银河生物科技有限公司 | Application of composite probiotic composition in combination with dimethylguanidine to treatment of type II diabetes |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104413334A (en) * | 2013-08-30 | 2015-03-18 | 深圳华大基因科技有限公司 | Edible composition as well as preparation method and application thereof |
| CN104740138A (en) * | 2013-12-31 | 2015-07-01 | 深圳华大基因科技有限公司 | Composition containing aloe, probiotics and prebiotics and application of composition |
| CN104968780A (en) * | 2012-09-20 | 2015-10-07 | 普洛特拉有限公司 | Probiotic compositions and methods for the treatment of obesity and obesity-related conditions |
| CN105039217A (en) * | 2015-07-16 | 2015-11-11 | 山东凤凰生物有限公司 | Hypoglycemic probiotic preparation and its preparation method |
| CN106619743A (en) * | 2016-12-28 | 2017-05-10 | 山东龙力生物科技股份有限公司 | Probiotic solid drink with hypoglycaemic effect and preparation method of probiotic solid drink |
-
2017
- 2017-09-28 CN CN201710902310.6A patent/CN107468717A/en not_active Withdrawn
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104968780A (en) * | 2012-09-20 | 2015-10-07 | 普洛特拉有限公司 | Probiotic compositions and methods for the treatment of obesity and obesity-related conditions |
| CN104413334A (en) * | 2013-08-30 | 2015-03-18 | 深圳华大基因科技有限公司 | Edible composition as well as preparation method and application thereof |
| CN104740138A (en) * | 2013-12-31 | 2015-07-01 | 深圳华大基因科技有限公司 | Composition containing aloe, probiotics and prebiotics and application of composition |
| CN105039217A (en) * | 2015-07-16 | 2015-11-11 | 山东凤凰生物有限公司 | Hypoglycemic probiotic preparation and its preparation method |
| CN106619743A (en) * | 2016-12-28 | 2017-05-10 | 山东龙力生物科技股份有限公司 | Probiotic solid drink with hypoglycaemic effect and preparation method of probiotic solid drink |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111228316A (en) * | 2020-03-02 | 2020-06-05 | 成都六然医疗科技有限公司 | Composite probiotics for improving diabetes |
| CN115281345A (en) * | 2022-04-06 | 2022-11-04 | 金华银河生物科技有限公司 | Application of composite probiotic composition in combination with dimethylguanidine to treatment of type II diabetes |
| CN115137757A (en) * | 2022-07-29 | 2022-10-04 | 承葛健康科技(广东)有限公司 | Probiotic composition assisting in reducing blood sugar |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112175864B (en) | Bifidobacterium animalis and breeding method and application thereof | |
| CN109123295B (en) | Probiotic solid beverage and preparation method thereof | |
| CN102274245B (en) | Novel lactacidophilus, composition thereof and use thereof in preparation of medicines for relieving diabetes mellitus and complications | |
| CN100484964C (en) | New use of tremella heteropolysaccharide or its extract | |
| CN102935092B (en) | Novel lactobacilli and composition thereof, and application thereof in preparing medicines used for ameliorating diabetes and complications thereof | |
| CN103476273A (en) | Bifidobacterium bifidum strains for application in gastrointestinal diseases | |
| CN105146614A (en) | Functional Chinese dwarf cherry seed ferment, ferment beverage and production method of ferment beverage | |
| CN104413334A (en) | Edible composition as well as preparation method and application thereof | |
| CN108743851A (en) | A kind of preparation method and compound probiotic powder of compound probiotic powder | |
| CN106176833A (en) | A kind of prevent and treat diabetes the compound probiotic liquid controlling body weight and preparation method thereof | |
| CN113855712B (en) | Composition capable of promoting defecation and application thereof | |
| CN109069549A (en) | Food composition for wean | |
| CN105121627B (en) | Composition containing lactobacillus bacterium | |
| CN110157649A (en) | It is a kind of to have effects that improve the lactobacillus paracasei L9 of people's constipation and its application | |
| CN104415061B (en) | Edible composition and its production and use | |
| CN107468717A (en) | A kind of blood sugar reducing preparation for human body and preparation method thereof | |
| CN109221519A (en) | A kind of hypoglycemic oligosaccharide probiotics solid beverage and preparation method thereof | |
| CN100482104C (en) | Process for preparing lactic acid bacteria oral liquor | |
| CN115089619A (en) | Application of lactobacillus plantarum ZDY2013 in preparation with function of relieving non-alcoholic fatty liver disease | |
| CN102845695A (en) | Konjac fermented food and beverage and preparation method thereof | |
| CN108514563A (en) | The application of chitosan oligosaccharide, the composition containing chitosan oligosaccharide, the drug containing chitosan oligosaccharide or food and chitosan oligosaccharide | |
| CN112273657A (en) | Probiotic composition for preventing or improving allergic diseases, preparation method and application | |
| CN108795823A (en) | It is a kind of improve women pregnant and lying-in women's intestinal flora probiotics cultural method and application | |
| CN111035661A (en) | Application of lactobacillus plantarum | |
| CN102919956A (en) | Nutrient solution capable of nursing human digestive system and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20171215 |
|
| WW01 | Invention patent application withdrawn after publication |