CN107384917B - Mini-gene splicing report plasmid and construction method and application thereof - Google Patents

Abstract

The invention provides a mini-gene splicing report plasmid and a construction method and application thereof, wherein the mini-gene splicing report plasmid has a sequence shown in a sequence table <400>1, obtains three discontinuous sequences on DMD genes through PCR amplification, and is respectively inserted into pcDNA3.1 to construct the mini-gene splicing report plasmid, and can be used for 1. identifying and analyzing splicing regulatory elements in exons and introns; 2. it was examined whether minor mutations (point mutations and microdeletions/repeats) would have an effect on exon splicing.

Description

Mini-gene splicing report plasmid and construction method and application thereof

Technical Field

The invention relates to the field of molecular biology, in particular to a mini-gene splicing report plasmid and a construction method and application thereof.

Background

RNA splicing is a very important biological process in eukaryotic gene expression, and by removing introns and joining exons, many functional mrnas with encoded information can be produced, which is essential for the development and evolution of the organism.

The splicing of mRNA precursors, which is the process of removing introns and splicing exons together to form mature mRNA catalyzed by spliceosomes, is an essential step in gene expression in higher eukaryotes and also one of the key mechanisms for the generation of molecular diversity of proteins. The entire splicing process is carried out in the nucleus and is carefully and strictly regulated. Mutations in the splice sites necessarily result in alterations in the splicing pattern, and the correct sequence of the splice sites and their positions are all necessary to ensure proper splicing of the RNA. The splicing process requires three important splicing signals, a 5 ' splice site (donor site), a3 ' splice site (acceptor site) and a branching site (near the 3 ' end of the intron). The 5 ' splice site is typically GU plus the next few bases that are not particularly conserved, and the 3 ' splice site region contains multiple conserved elements, in turn a branch point, a polypyrimidine tract and an AG at the 3 ' end of the intron. In addition, the splicing process requires the assistance of several other cis-regulatory elements, which are classified into the four categories of Exon Splicing Enhancer (ESE), Exon Splicing Silencer (ESS), Intron Splicing Enhancer (ISE), and Intron Splicing Silencer (ISS) according to their positions and functions. If certain nucleotide changes affect splicing signals and acting elements, the splicing pattern of the gene will be changed, resulting in the occurrence of certain diseases. On the other hand, the clinical phenotype of certain diseases can also be modified by altering the splicing pattern of the gene. With the clinical application and development of antisense oligonucleotide drugs, the mini-gene can definitely influence the specific nucleotide sequence of the splicing mode, thereby providing an effective method for searching drug treatment targets. In addition, the mini-gene can be used for screening some targeted therapeutic drugs by researching the influence of certain compounds on gene splicing patterns, and can be used for screening drugs for spinal muscular atrophy, muscular dystrophy, familial autonomic dysfunction and other genetic diseases.

In general, these accessory regulatory elements promote or inhibit the recognition of splice sites by recruiting some trans-acting factors, i.e., splice regulatory proteins, and can regulate the splicing process by regulating the assembly of spliceosomes. The splicing regulatory proteins known to date are mainly the serine/arginine-rich protein (SR protein) family and the nuclear heterogeneous ribonucleoprotein (hnRNP) family. Generally, SR proteins are combined on purine-rich ESE and ISE to promote the combination of U1snRNP and 5 'ss and the combination of U2AF and 3' ss, and the assembly of U4/U6-U5snRNP trimer on spliceosome, thereby enhancing the splicing efficiency; hnRNP family members typically bind to inhibit splice site recognition and use on ESS and ISS. The correct splicing process can only be achieved by a complex interaction of cis-acting elements and trans-acting factors.

In some genes, the splicing pattern of the RNA precursor is altered by mutations in the splice donor, acceptor sites or flanking conserved sequences thereof, such that mature RNA is produced that contains introns or lacks exon sequences. The correctness of the splicing pattern depends on the correct splicing site, the error of the splicing pattern is greatly related to the disease, and the genetic disease of about 1/4 is caused by the fact that the normal splicing site is changed by gene mutation. Due to the high affinity of normal splice sites for the splicing system, mutation of a splice junction results in skipping of the corresponding exon or activation of adjacent cryptic splice sites present in introns or exons, thereby leaving an intron or deleting an exon in the mature mRNA molecule and sometimes converting a normal gene into an oncogene. Splicing is particularly important in most precursor mrnas because it is difficult to study their splicing effects due to their large length, and because mutations in some endogenous genes in the cell can alter the splicing pattern and affect the function of the expressed protein. In addition, since various mutations occur in human genes, it is difficult to know whether these mutations affect splicing of genes, which makes it difficult to grasp the relationship between mutation and splicing and disease.

Disclosure of Invention

The invention aims to solve the technical problem of providing a mini-gene splicing report plasmid.

Another technical problem to be solved by the invention is to provide a construction method of the mini-gene splicing reporter plasmid.

Another technical problem to be solved by the invention is to provide an application of the mini-gene splicing reporter plasmid.

In order to solve the technical problems, the technical scheme of the invention is as follows:

a mini-gene splicing reporter plasmid is a plasmid NKU-YC-1 and has a sequence shown in a sequence table SEQ ID NO. 1.

Preferably, the two ends of the recombination sequence and the middle of the recombination sequence of the mini-gene splicing report plasmid are provided with corresponding enzyme cutting sites for detecting the gene to be detected, and the total length of the recombination sequence is 980 bp.

According to the construction method of the mini-gene splicing report plasmid, three discontinuous sequences on the human DMD gene are obtained through PCR amplification and are respectively inserted into pcDNA3.1 to construct the mini report plasmid NKU-YC-1, and the inserted partial sequence has a sequence shown in a sequence table SEQ ID NO. 2.

The application of the mini-gene splicing report plasmid is used for identifying and analyzing splicing regulatory elements in exons and introns.

The application of the mini-gene splicing reporter plasmid is used for detecting whether minor mutation (point mutation and minor deletion/duplication) can influence the splicing of the exon.

The invention has the beneficial effects that:

the mini-gene splicing report plasmid has a sequence shown in a sequence table SEQ ID NO:1, obtains three discontinuous sequences on DMD genes through PCR amplification, is respectively inserted into pcDNA3.1 to construct, can be used for identifying and analyzing splicing regulation elements in exons and introns, and can be used for detecting whether micro mutation (point mutation and micro deletion/repetition) can bring influence on splicing of the exons.

Drawings

FIG. 1 is a schematic diagram showing the structure of mini-gene NKU-YC-1 plasmid.

FIG. 2 is a schematic diagram of the structure of an insert.

FIG. 3 is an electrophoretic identification chart of a recombinant plasmid, in which,

m: DNA molecular weight standard;

1: insert PCR amplification product, about 980 bp;

2: recombinant vector double enzyme digestion product.

FIG. 4 is a functional validation of the mini-gene splicing reporter system, wherein,

m: DNA molecular weight standard;

NKU: the splicing pattern of NKU-YC-1 mini-gene in Hela cells.

FIG. 5 is an analysis of the identification of splicing regulatory elements in exons to be detected, wherein,

a, WT is a schematic diagram of the normal exon to be detected in minigene reporter plasmid; d1-6 is a schematic diagram of deletion of different regions of the exon to be detected;

panel b is an electrophoretogram of the splicing result of the WT and the deleted (Mutant) exon in Hela cells;

and c, detecting a Splicing Factor (SF) in a pull down product by Western blot after RNA pull down is carried out by using a deletion section probe. NE is Hela nuclear extract, D2 is the pull down product of D2 deletion segment.

FIG. 6 is a test of the effect of mutations on exon splicing, wherein,

a is a schematic of the mutation pattern of patient 1;

panel b is a graph of the results of a cDNA analysis of patient 1, C is a normal control, and P is patient 1;

c is a diagram for constructing minigene containing the mutant exon and the in vitro splicing result thereof, wherein W is a normal minigene splicing diagram, and M is a minigene splicing diagram of point mutation.

Detailed Description

In order to make those skilled in the art better understand the technical solution of the present invention, the following detailed description is made with reference to the accompanying drawings and the detailed description.

The gene amplification primers used in the following examples were synthesized by Beijing Huada Gene Co.

Example 1

Construction process of minigene splicing reporter plasmid

Three discontinuous sequences on the DMD gene are obtained by PCR amplification and are respectively inserted into pcDNA3.1 to construct minigene reporter plasmid NKU-YC-1.

Materials and reagents:

the vector pcDNA3.1 was purchased from Invitrogen, the LB plates and the culture medium were purchased from Shanghai Biotech, the competence Trans1-T1 was purchased from Quanyujin Biotech, the agarose recovery kit and the T4 ligase were purchased from NEB Biotech, and the restriction enzymes used in the experimental procedure were purchased from TAKARA Biotech.

(1) The genomic DNA of a normal human was used as a template to design primers Y1F-NheI (sequence shown in SEQ ID NO:3 of the sequence Listing) and Y1R-KpnI (sequence shown in SEQ ID NO:4 of the sequence Listing) for PCR amplification. The primers are as follows (where the underlined are the cleavage sites):

Y1F-NheI:CTAGCTAGCGCTGAAGTTGATGTTTT

Y1R-KpnI:CGGGGTACCGAATTCATTAAAAAAAATCCACT

the components are mixed evenly and then put into a PCR instrument. PCR reaction parameters: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 35 cycles, and termination at 72 ℃ for 10 min. And after the reaction is finished, detecting the amplified product fragment by electrophoresis. The size of the fragment is about 204bp, and the target fragment is recovered by cutting gel. The target fragment and pcDNA3.1 are subjected to double enzyme digestion by NheI and KpnI at the same time, and the enzyme digestion system is as follows:

reacting for 2-4 hours at 37 ℃, detecting by electrophoresis, cutting and recovering. The product was recovered for ligation and reacted overnight at 16 ℃. The following day 5ul of the ligation product was added to 50ul of competent Trans1-T1, ice-cooled for 30min, heat-shocked at 42 ℃ for 45s, added to 500ul of LB liquid medium, shaken at 37 ℃ for one hour at 200r, centrifuged, resuspended and pellet-plated ampicillin-resistant plates and cultured overnight at 37 ℃. The next day, the sequencing of the selected bacteria is carried out to detect whether the target gene is correctly inserted into the known vector, and the successfully identified plasmid is pcDNA3.1-A.

(2) Primers Y2F-KpnI (sequence shown in SEQ ID NO:5 of the sequence table) and Y2R-XhoI (sequence shown in SEQ ID NO:6 of the sequence table) were designed using genomic DNA of normal persons as a template, and PCR amplification was performed. The primers are as follows (where the underlined are the cleavage sites):

Y2F-KpnI:CGGGGTACCAAAAGACAAAAATCCAT

Y2R-XhoI:CCGCTCGAGGGATCCAATATATACCATGAAAA

the fragment size was about 455bp, and the reaction procedure was as above.

And carrying out double enzyme digestion and recovery on the recovered product and the plasmid A by using KpnI and XhoI, taking the recovered product, carrying out connection, transformation, plating and bacterium selection for identification, wherein the successfully identified plasmid is pcDNA3.1-AX.

(3) Primers Y3F-XhoI (sequence shown in SEQ ID NO:7 of the sequence table) and Y3R-XbaI (sequence shown in SEQ ID NO:8 of the sequence table) were designed using genomic DNA of normal persons as a template, and PCR amplification was performed. The primers are as follows (where the underlined are the cleavage sites):

Y3F-XhoI:CCGCTCGAGTTATGGGAAATTGAGTG

Y3R-XbaI:TGCTCTAGAAATCTCTCTCAAGATAC

the fragment size was about 296bp, and the reaction procedure was as above.

XhoI and XbaI are used for carrying out double enzyme digestion on the recovered product and the plasmid pcDNA3.1-AX and recovering, the recovered product is taken out for connection, transformation, plating and bacteria selection for identification, and the successfully identified plasmid is NKU-YC-1 (shown in a figure 1 and a figure 2) and has a sequence shown in a sequence table SEQ ID NO. 1. The PCR of the insert fragment with primers at both ends of the fragment and the double digestion of plasmid NKU-YC-1 with NheI and XbaI revealed the presence of a band of about 980bp (see FIG. 3).

Example 2

Construction method of mutant mini-gene

Design of primer M-F: GTGGGCAGTAGATAAAGAATGAAGC

M-R:CTTTATCTACTGCCCACCTTCATTG

Using NKU-YC-1 plasmid as template, designing primers M-F (sequence shown in SEQ ID NO:9 of sequence table) and M-R (sequence shown in SEQ ID NO:10 of sequence table) for PCR amplification, wherein the primers are as follows:

M-F:GTGGGCAGTAGATAAAGAATGAAGC

M-R:CTTTATCTACTGCCCACCTTCATTG

the components are mixed evenly and then put into a PCR instrument. PCR reaction parameters: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 10min, 35 cycles, and termination at 72 ℃ for 5 min. After the reaction is finished, 5ul of PCR product is taken to carry out electrophoresis detection on the amplified product fragment, and the size of the fragment is about 5 kb. Taking 20ul PCR product for DpnI digestion, wherein the digestion system is as follows:

the reaction was carried out at 37 ℃ for 2 hours. 5ul of the digested product was added to 50ul of competent Trans1-T1, ice-cooled for 30min, heat-shocked at 42 ℃ for 45s, added to 500ul of LB liquid medium, shaken at 37 ℃ for 200r for one hour, centrifuged, resuspended and precipitated and spread on ampicillin resistant plates, and cultured overnight at 37 ℃. And (4) detecting whether the base A of the exon X is mutated into T by sequencing of the selected bacteria on the next day, wherein the successfully identified plasmid is the mutant.

Example 3

Functional validation of the mini-gene splicing reporter System

1) HeLa cells were transfected with the plasmid NKU-YC-1 by a liposome-mediated method using liposome Lipo2000 from Invitrogen, according to the instructions of the transfection reagents, as follows:

adding 0.5ug of plasmid and 8ul of transfection reagent into 200ul of serum-free culture medium in the evening, incubating at room temperature for 5min to fully wrap the plasmid in the liposome, adding the liposome into 2ml of well-grown Hela cells, culturing in an incubator overnight, and changing the serum-free culture medium into the serum-containing culture medium in the morning of the next day to continue culturing.

2) And (3) RNA extraction: 48 hours after transfection, the medium was aspirated, washed twice with PBS, repeatedly flushed with 500ul Trizol and transferred to a 1.5ml centrifuge tube. Adding 100ul of trichloromethane, shaking for 15s, standing at room temperature for 2-3min, and centrifuging at 4 deg.C and 12000 rpm for 15 min. Carefully transferring the upper layer phase into a new centrifuge tube, adding 250ul isopropanol, slightly reversing and mixing, standing at room temperature for 10min, and centrifuging at 4 ℃ at 12000 for 10 min. The supernatant was decanted, 500ul of 75% absolute ethanol pre-chilled in advance was added, and the mixture was centrifuged at 4 ℃ and 7500 ℃ for five minutes. The supernatant was decanted off and EB buffer was added to dissolve after the precipitate was completely dried.

3) And (3) cDNA synthesis: the extracted RNA was reverse transcribed into cDNA using a TAKARA reverse transcription kit.

4) And (3) PCR: PCR was performed using the cDNA as a template and primers Y1F-NheI and Y3R-XbaI. 5ul of PCR product was subjected to agarose gel electrophoresis. And detecting the splicing mode of the target gene.

5) And (4) analyzing results: as shown in FIG. 4, it can be seen from the results of electrophoresis and sequencing of the PCR product that the three exons carried by NKU-YC-1 are correctly identified in HeLa cells, and the splicing pattern is the same as that of the dystrophin gene in human body, thus confirming the effectiveness of the splicing reporter system.

Example 4

Identification and analysis of splicing regulatory elements in exons

On the basis of minigene NKU-YC-1, plasmids were designed in which deletion of different segments in exon X (D1-6) was detected (see FIG. 5 a). Hela cells were transfected with Wild type and different segment-deleted plasmids, respectively, and splicing of exon X was detected by RT-PCR (see FIG. 5 b). Results analysis the plasmids with deletion of the D2 and D6 segments affected the recognition of exon X leading to exon skipping, indicating that both sequences of the deletion contain cis-acting elements that bind to specific trans-acting factors and thereby affect splicing. Next, we focused our studies on the D2 segment which most significantly affects splicing, and designed an RNA probe of the D2 segment sequence, and performed an RNA pull down experiment by incubating with a nuclear extract to detect the splicing factor bound thereto. The mass spectrometry of the Pull down product and the validation of the Western blot revealed that four splicing factors bind to the deletion region and participate in the regulation of exon X splicing (see FIG. 5 c). This experiment demonstrates that minigene NKU-YC-1 can be used to identify splicing regulatory elements in exons and introns.

Example 5

Whether a point mutation would affect exon splicing is detected.

One example of a DMD patient whose dystrophin gene contains a nonsense mutation of a > T (see fig. 6a) was found by cDNA analysis to result in some skipping of the corresponding exon (see fig. 6 b). We inserted the exon and flanking sequence containing this mutation into the plasmid NKU-YC-1 to construct a mutant plasmid (see FIG. 6 c). Respectively transfecting wild type and mutant mini-gene into Hela cells, culturing for 48 hours, extracting RNA, carrying out reverse transcription to obtain cDNA, and analyzing the splicing efficiency of the exon to be detected by PCR. The PCR results produced two bands of different sizes, one for normal splicing (cloning) and the other for exon skipping (skipped) (see FIG. 6c), consistent with the patient's own splicing pattern, indicating that the minigene NKU-YC-1 based splicing reporter system is a good model for studying the effect of minor mutations on exon splicing in vitro.

The above detailed description of the mini-gene splicing reporter plasmid and the construction method and application thereof with reference to the specific embodiments is illustrative and not restrictive, and several examples can be cited according to the limited scope, so that changes and modifications without departing from the general concept of the present invention shall fall within the protection scope of the present invention.

Sequence listing

<110> university of southern kayak

<120> mini-gene splicing report plasmid and construction method and application thereof

<130> 2017

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6318

<212> DNA

<213> pcDNA3.1(pcDNA3.1)

<220>

<221> gene

<222> (1)..(6318)

<400> 1

gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60

ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120

cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180

ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240

gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300

tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360

cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540

atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600

tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660

actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720

aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780

gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840

ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900

gctgaagttg atgtttttct gaaggaggaa tggcctgccc ttggggattc agaaattcta 960

aaaaagcagc tgaaacagtg cagagtaaga tttttatatg atgcctttaa tatgaataat 1020

tttgtatgaa tattatttgg ttagatcagt gttttacagc tggggtggat tttgctctcc 1080

cctccccagt ggattttttt taatgaattc ggtaccaaaa gacaaaaatc catatgcaat 1140

gccatcagtc ccaattttac attttctagc tatgtttcat atctaatatg tggcagtaat 1200

ttttttcagc tggcttaaat tgatttattt tcttagcttt tagtcagtga tattcagaca 1260

attcagccca gtctaaacag tgtcaatgaa ggtgggcaga agataaagaa tgaagcagag 1320

ccagagtttg cttcgagact tgagacagaa ctcaaagaac ttaacactca gtgggatcac 1380

atgtgccaac aggtatagac aatctctttc actgtggctt gcctcaacgt acttaactaa 1440

gatttcctaa tgtctccctt caccgttact tttggttaag gctttgttcc tatgtttttg 1500

ctttaaagca caattaattc tgacaaatta atcttttttc tagcatatct aaatattttc 1560

atggtatata ttggatccct cgagttatgg gaaattgagt gtatctgatc cccatgagtt 1620

attttcttat gcatataagc tttttacttc tttatcatta ctaactaagc tttctgttat 1680

ttacatactg atgaaataat ataataataa tgtttcatca ctgtcaataa tcgtgttttg 1740

tttgtttgtt ttgtggaagg tctatgccag aaaggaggcc ttgaagggag gtttggagaa 1800

aactgtaagc ctccagaaag atctatcaga gatgcacgaa tggatgacac aagctgaaga 1860

agagtatctt gagagagatt tctagagggc ccgtttaaac ccgctgatca gcctcgactg 1920

tgccttctag ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg 1980

aaggtgccac tcccactgtc ctttcctaat aaaatgagga aattgcatcg cattgtctga 2040

gtaggtgtca ttctattctg gggggtgggg tggggcagga cagcaagggg gaggattggg 2100

aagacaatag caggcatgct ggggatgcgg tgggctctat ggcttctgag gcggaaagaa 2160

ccagctgggg ctctaggggg tatccccacg cgccctgtag cggcgcatta agcgcggcgg 2220

gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt 2280

tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc 2340

gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg 2400

attagggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga 2460

cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc 2520

ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa 2580

aaaatgagct gatttaacaa aaatttaacg cgaattaatt ctgtggaatg tgtgtcagtt 2640

agggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa 2700

ttagtcagca accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag 2760

catgcatctc aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct 2820

aactccgccc agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc 2880

agaggccgag gccgcctctg cctctgagct attccagaag tagtgaggag gcttttttgg 2940

aggcctaggc ttttgcaaaa agctcccggg agcttgtata tccattttcg gatctgatca 3000

agagacagga tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg caggttctcc 3060

ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa tcggctgctc 3120

tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga 3180

cctgtccggt gccctgaatg aactgcagga cgaggcagcg cggctatcgt ggctggccac 3240

gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa gggactggct 3300

gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa 3360

agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc 3420

attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct 3480

tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg aactgttcgc 3540

caggctcaag gcgcgcatgc ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg 3600

cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct 3660

gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg ctgaagagct 3720

tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca 3780

gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga gcgggactct ggggttcgaa 3840

atgaccgacc aagcgacgcc caacctgcca tcacgagatt tcgattccac cgccgccttc 3900

tatgaaaggt tgggcttcgg aatcgttttc cgggacgccg gctggatgat cctccagcgc 3960

ggggatctca tgctggagtt cttcgcccac cccaacttgt ttattgcagc ttataatggt 4020

tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct 4080

agttgtggtt tgtccaaact catcaatgta tcttatcatg tctgtatacc gtcgacctct 4140

agctagagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg ttatccgctc 4200

acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg tgcctaatga 4260

gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 4320

tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 4380

cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg 4440

gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga 4500

aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 4560

gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 4620

aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 4680

gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 4740

ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 4800

cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 4860

ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 4920

actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 4980

tggcctaact acggctacac tagaagaaca gtatttggta tctgcgctct gctgaagcca 5040

gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 5100

ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 5160

ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 5220

gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt 5280

aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 5340

gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 5400

gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 5460

cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 5520

gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg 5580

gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca 5640

ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 5700

tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct 5760

ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg 5820

cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 5880

accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata 5940

cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 6000

tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact 6060

cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 6120

acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc 6180

atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga 6240

tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga 6300

aaagtgccac ctgacgtc 6318

<210> 2

<211> 992

<212> DNA

<213> human DMD Gene (human gene)

<220>

<221> gene

<222> (1)..(992)

<400> 2

gctagcgctg aagttgatgt ttttctgaag gaggaatggc ctgcccttgg ggattcagaa 60

attctaaaaa agcagctgaa acagtgcaga gtaagatttt tatatgatgc ctttaatatg 120

aataattttg tatgaatatt atttggttag atcagtgttt tacagctggg gtggattttg 180

ctctcccctc cccagtggat tttttttaat gaattcggta ccaaaagaca aaaatccata 240

tgcaatgcca tcagtcccaa ttttacattt tctagctatg tttcatatct aatatgtggc 300

agtaattttt ttcagctggc ttaaattgat ttattttctt agcttttagt cagtgatatt 360

cagacaattc agcccagtct aaacagtgtc aatgaaggtg ggcagaagat aaagaatgaa 420

gcagagccag agtttgcttc gagacttgag acagaactca aagaacttaa cactcagtgg 480

gatcacatgt gccaacaggt atagacaatc tctttcactg tggcttgcct caacgtactt 540

aactaagatt tcctaatgtc tcccttcacc gttacttttg gttaaggctt tgttcctatg 600

tttttgcttt aaagcacaat taattctgac aaattaatct tttttctagc atatctaaat 660

attttcatgg tatatattgg atccctcgag ttatgggaaa ttgagtgtat ctgatcccca 720

tgagttattt tcttatgcat ataagctttt tacttcttta tcattactaa ctaagctttc 780

tgttatttac atactgatga aataatataa taataatgtt tcatcactgt caataatcgt 840

gttttgtttg tttgttttgt ggaaggtcta tgccagaaag gaggccttga agggaggttt 900

ggagaaaact gtaagcctcc agaaagatct atcagagatg cacgaatgga tgacacaagc 960

tgaagaagag tatcttgaga gagatttcta ga 992

<210> 3

<211> 26

<212> DNA

<213> genome of normal human (human gene)

<220>

<221> gene

<222> (1)..(26)

<400> 3

ctagctagcg ctgaagttga tgtttt 26

<210> 4

<211> 32

<212> DNA

<213> genome of normal human (human gene)

<220>

<221> gene

<222> (1)..(32)

<400> 4

cggggtaccg aattcattaa aaaaaatcca ct 32

<210> 5

<211> 26

<212> DNA

<213> genome of normal human (human gene)

<220>

<221> gene

<222> (1)..(26)

<400> 5

cggggtacca aaagacaaaa atccat 26

<210> 6

<211> 32

<212> DNA

<213> genome of normal human (human gene)

<220>

<221> gene

<222> (1)..(32)

<400> 6

ccgctcgagg gatccaatat ataccatgaa aa 32

<210> 7

<211> 26

<212> DNA

<213> genome of normal human (human gene)

<220>

<221> gene

<222> (1)..(26)

<400> 7

ccgctcgagt tatgggaaat tgagtg 26

<210> 8

<211> 26

<212> DNA

<213> genome of normal human (human gene)

<220>

<221> gene

<222> (1)..(26)

<400> 8

tgctctagaa atctctctca agatac 26

<210> 9

<211> 25

<212> DNA

<213> design of primer (primer)

<220>

<221> primer_bind

<222> (1)..(25)

<400> 9

gtgggcagta gataaagaat gaagc 25

<210> 10

<211> 25

<212> DNA

<213> design of primer (primer)

<220>

<221> primer_bind

<222> (1)..(25)

<400> 10

ctttatctac tgcccacctt cattg 25

Claims (5)

1. A mini-gene splicing reporter plasmid characterized by: is a plasmid NKU-YC-1 with a sequence shown in a sequence table SEQ ID NO. 1.

2. The mini-gene splicing reporter plasmid of claim 1, characterized in that: the recombination sequence is a discontinuous sequence obtained on three DMD genes by PCR amplification, and comprises 3 exon A, X, B and flanking intron sequences thereof, corresponding enzyme cutting sites are arranged at two ends of the recombination sequence and in the middle of the recombination sequence for detecting the gene to be detected, and the total length of the recombination sequence is 980 bp.

3. The method for constructing the mini-gene splicing reporter plasmid of claim 1, which is characterized in that: three discontinuous sequences on the DMD gene are obtained by PCR amplification and are respectively inserted into pcDNA3.1 to construct the DMD gene.

4. The use of the mini-gene splicing reporter plasmid of claim 1, wherein: for the identification and analysis of splicing regulatory elements in exons and introns.

5. The use of the mini-gene splicing reporter plasmid of claim 1, wherein: the method is used for detecting whether minor mutation can influence splicing of the exons, and the minor mutation aims at the exon and flanking intron sequences of the gene to be detected.

Images