CN107365766A - Mechanical crushing method extraction mycotic spore RNA method - Google Patents

Mechanical crushing method extraction mycotic spore RNA method Download PDF

Info

Publication number
CN107365766A
CN107365766A CN201710662062.2A CN201710662062A CN107365766A CN 107365766 A CN107365766 A CN 107365766A CN 201710662062 A CN201710662062 A CN 201710662062A CN 107365766 A CN107365766 A CN 107365766A
Authority
CN
China
Prior art keywords
rna
mycotic spore
spore
mechanical crushing
mycotic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710662062.2A
Other languages
Chinese (zh)
Other versions
CN107365766B (en
Inventor
罗云波
许文涛
黄昆仑
田兰芳
贺晓云
郭明璋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN201710662062.2A priority Critical patent/CN107365766B/en
Publication of CN107365766A publication Critical patent/CN107365766A/en
Application granted granted Critical
Publication of CN107365766B publication Critical patent/CN107365766B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor

Landscapes

  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a kind of mechanical crushing method extraction mycotic spore RNA method, including mycotic spore liquid is taken, add glass bead, carry out Mechanical Crushing processing, then carry out RNA extractions.The present invention is crushed using Mechanical Method to mycotic spore wall, column method of purification carries out RNA extraction, purifying after broken, kit is recycled to carry out reverse transcription, then by the quality of real-time fluorescence quantitative PCR and detected through gel electrophoresis extraction effect, and precisely extraction mycotic spore RNA technical system is established according to this.Mycotic spore RNA extraction method after the optimization that the present invention is drawn, not only have the advantages that efficient extraction efficiency, simple operation are easily-controllable, nontoxic, and the RNA mass above all extracted is good, meet that unicellular later stage sequencing requires, can be sequenced for monospore from now on and good reference value is provided.

Description

Mechanical crushing method extraction mycotic spore RNA method
Technical field
The present invention relates to a kind of mechanical crushing method extraction mycotic spore RNA method.
Background technology
Although the extracting method on RNA is many, many methods have also reached its maturity, and are answered for cell wall constituent Miscellaneous fungi, these conventional method for extracting nucleic acid have the material such as limitation, the polysaccharide being rich in fungi, pigment, nuclease to make RNA extraction and separation it is more difficult, particularly as mycotic spore it is this kind of containing harder conidial cell wall RNA extraction more by Limitation.
On the other hand, due to the appearance of unicellular genome sequencing technology, our traditional large sample cells are changed Sequencing mode, the analysis to individual cells is also transformed to by the analysis to a cell colony, can be provided to us more Valuable research, such as diverse location in mycotic culture ware, may due to the difference of the reasons such as nutriment, mould quantity, The gene composition of diverse location mould is not quite similar.At the same time, this also just improve to a small amount of sample rna extraction quality with The requirement of quantity.Conventional method requires a large amount of samples so that the method for unicellular sequencing can not apply the research in mycotic spore In.
The content of the invention
In order to solve the above technical problems, the present invention provides a kind of mechanical crushing method extraction mycotic spore RNA method.
The present invention is crushed using Mechanical Method to mycotic spore wall, broken rear column method of purification progress RNA extraction, Purifying, recycle kit to carry out reverse transcription, then pass through the excellent of real-time fluorescence quantitative PCR and detected through gel electrophoresis extraction effect It is bad, and precisely extraction mycotic spore RNA technical system is established according to this.
Technical solution of the present invention is as follows：
A kind of mechanical crushing method extraction mycotic spore RNA method, including：Take mycotic spore liquid, add glass bead (with Lower abbreviation pearl), Mechanical Crushing processing is carried out, then carries out RNA extractions.
Such as indicated without special, Mechanical Crushing of the present invention is primarily referred to as milled processed.
Further, mycotic spore liquid miospore quantity >=1 × 102Individual/mL.
Further, mycotic spore liquid miospore quantity >=5 × 107Individual/mL.
Further, in terms of 1mL mycotic spore liquid, glass bead quantity used is 20-40 in Mechanical Crushing processing procedure , glass bead size (referring to diameter, similarly hereinafter) is 1-3mm, and Mechanical Crushing processing (grinding) time is (2 × 5) min- (4 × 5) min。
Wherein, (2 × 5) min refers to take out after Mechanical Crushing (grinding) 5min placement and cooled on ice at least 30s, enters altogether The row operation 2 times；(4 × 5) min refers to take out after Mechanical Crushing (grinding) 5min placement and cooled on ice at least 30s, carries out altogether The operation 4 times.
In the preferred embodiment of the present invention, in terms of 1mL mycotic spore liquid, the mycotic spore liquid miospore number Amount >=5 × 107Individual/mL, glass bead quantity are 40, and glass bead size be 1mm, and Mechanical Crushing handles (grinding) time and is (3×5)min。
In another preferred embodiment of the present invention, in terms of 1mL mycotic spore liquid, when spore in the mycotic spore liquid Quantum count is no less than 1 × 102During individual/mL scopes, glass bead quantity is 20, and glass bead size is 1mm, at Mechanical Crushing Reason (grinding) time is (4 × 5) min.
Specifically, above-mentioned mechanical crushing method extraction mycotic spore RNA method comprises the following steps：
(1) mycotic spore liquid is taken, adds glass bead, carries out Mechanical Crushing (grinding) processing (broken wall treatment)；
(2) the mycotic spore liquid after broken wall is transferred to a clean centrifuge tube, 12,000rpm centrifugation 2min, takes supernatant (homogenizing process)；
(3) 70% ethanol of 1 times of volume is added into supernatant；
(4) it is vortexed and mixes；
(5) it is transferred to centrifugal column (each most 700 μ, until transfer completely)；
(6) 12,000rpm centrifugation 15s (room temperature), abandon waste liquid；
(7) add 700 μ L Wash buffer I, 12,000rpm centrifugation 15s, abandon waste liquid, be put into a new centrifuge tube；
(8) add 500 μ L Wash buffer II, 12,000rpm centrifugation 15s, abandon waste liquid；
(9) (8) are repeated；
(10) 12,000rpm centrifuges 2min again, is put into a new collecting pipe, and room temperature places 5min thoroughly to dry suction Remaining rinsing liquid in enclosure material；
(11) plus 50 μ Rnase-free water are to centrifugal column center, and room temperature places 1min, 12,000rpm centrifugation 2min；
(12) solution that centrifugation obtains being added in centrifugal column, room temperature places 1min, 12,000rpm centrifugation 2min, with Improve RNA concentration.
After having extracted total serum IgE, cDNA synthesis can be directly carried out.
Further, the mycotic spore is aspergillus niger spore.
Strain used in the present invention and reagent is commercially available buys.
Mycotic spore Mechanical Method extraction RNA technologies actually on be to provide strong guarantor in the accurate research to mycotic spore Barrier, after precisely high quality, efficient mycotic spore RNA is extracted, it is possible to study the difference between mycotic spore individual.This Invent the mycotic spore RNA extraction method after the optimization that draws, not only with efficient extraction efficiency, simple operation is easily-controllable, nothing The advantages that poison is harmless, and the RNA mass above all extracted is good, meets that unicellular later stage sequencing requires, can be the present Monospore sequencing afterwards provides good reference value.
Advantage of the present invention：
1st, there is efficient RNA extraction efficiencies.
2nd, there is the easily-controllable advantage of simple operation.
3rd, there is nontoxic advantage.
4th, mycotic spore is accurate to 10 first2Individual spore carries out RNA extractions.
5th, accurate research that can be mycotic spore from the group research steerings of a large amount of cells to unicellular or a small amount of cell.
6th, the mRNA mass extracted is good, meets that unicellular later stage sequencing requires, can be sequenced and provide for monospore from now on Good reference value.
Brief description of the drawings
Fig. 1 represents design of primers principle；
Fig. 2 is the quantitative testing result of a large amount of spore RNA physical intersections；
Fig. 3 is the quantitative testing result of a large amount of spore RNA integralities；
Fig. 4 is a small amount of spore RNA heminested PCR quantitative results；
Fig. 5 is the agarose gel electrophoresis figure of a small amount of spore rna ladder degree dilution；
Fig. 6 is a small amount of spore RNA orthogonal tests heminested PCR quantitative result；
Fig. 7 is the agarose gel electrophoresis figure of a small amount of spore RNA orthogonal tests.
Embodiment
Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.It is unreceipted specific in embodiment Technology or condition person, carried out according to the technology or condition described by document in the art, or according to product description.It is used Reagent or the unreceipted production firm person of instrument, it is the conventional products that can be commercially available by regular distributor.If do not refer in particular to It is bright, below according to conventional laboratory conditions, as Sambrook equimoleculars Cloning: A Laboratory Manual (Sambrook J＆Russell DW, Molecular Cloning:A Laboratory Manual, 2001), or the condition according to manufacturer's specification suggestion.
Embodiment
1. experiment material
Mycotic spore used in experiment is mainly aspergillus niger spore below, and it is public that aspergillus niger strain is purchased from the multiple auspicious biology in Shanghai Department, is stored in 0.9% aseptic sodium chloride solution containing 15% glycerine, to be freeze-dried strain as 0 generation, in experiment predominantly 3rd, 4 generations.By this area conventional method culture.
Mycotic spore Mechanical Crushing method used in experiment below 2.：Mycotic spore liquid is taken, it is (following to add glass bead Abbreviation pearl), Mechanical Crushing (grinding) processing is carried out, then can carry out RNA extractions.
RNA extraction method used in experiment below 3.：
Mycotic spore liquid after Mechanical Crushing (grinding) processing is directly carried out to RNA extraction.
RNA extracts detailed process：
(1) mycotic spore liquid is taken, adds glass bead (hereinafter referred to as pearl), it is (broken to carry out Mechanical Crushing (grinding) processing Wall processing)；
(2) the mycotic spore liquid after broken wall is transferred to a clean centrifuge tube, 12,000rpm centrifugation 2min, takes supernatant (homogenizing process)；
(3) 70% ethanol of 1 times of volume is added into supernatant；
(4) it is vortexed and mixes；
(5) it is transferred to centrifugal column (each most 700 μ, until transfer completely)；
(6) 12,000rpm centrifugation 15s (room temperature), abandon waste liquid；
(7) add 700 μ L Wash buffer I, 12,000rpm centrifugation 15s, abandon waste liquid, be put into a new centrifuge tube；
(8) add 500 μ L Wash buffer II, 12,000rpm centrifugation 15s, abandon waste liquid；
(9) (8) are repeated；
(10) 12,000rpm centrifuges 2min again, is put into a new collecting pipe, and room temperature places 5min thoroughly to dry suction Remaining rinsing liquid in enclosure material；
(11) plus 50 μ Rnase-free water are to centrifugal column center, and room temperature places 1min, 12,000rpm centrifugation 2min；
(12) solution that centrifugation obtains being added in centrifugal column, room temperature places 1min, 12,000rpm centrifugation 2min, with Improve RNA concentration.
4th, specific experiment scheme
4.1 experiment materials, ibid.
The influence of 4.2 each factors of Orthogonal Method research spore RNA extractions a large amount of to Physical
Before Physical orthogonal test starts, have chosen first bead size, the quantity of pearl and bead mill time this Three three factors high with crushing effect correlation, study these three factors to the RNA influences extracted and validity.This section is tried It is 5 × 10 to test middle taken bacterial concentration7Individual/mL, takes 1ml to test every time, and beveller operations specifications are 28frequency/s.
Each horizontal parameters of each factor of a large amount of spore RNA Physical orthogonal tests carry out orthogonal test with reference to following table.
A large amount of spore RNA extracts physical orthogonal tests
Time on grinding, it is contemplated that Physical frictional heat, temperature is too high may influence nucleic acid extraction quality and Quantity, the 30s that cools on ice is placed so being taken out after 5min is ground in this method.
In order to prevent RNase pollutions, should be noted that in experimentation：New gloves are often changed in extraction process, because skin Skin often carries bacterium, RNase may be caused to pollute；Cross pollution is avoided using the plastic products without RNase and pipette tips.
After having extracted total serum IgE, cDNA synthesis is directly carried out, the synthesis concrete operations of the chains of cDNA first are：
(1) template ribonucleic acid is thawed on ice；Primer, 10 × RT mix (wherein comprising RNasin and DTT), Super Pure dNTP mixed liquors, RNase-Free ddH2O thaw for (15-25 DEG C) in room temperature, are immediately placed in after defrosting on ice (before use Every kind of solution vortex oscillation is mixed, brief centrifugation remains in the liquid of tube wall to collect)；
(2) mixed liquor is prepared according to the reverse transcription system of following table, thoroughly mixed, the vortex oscillation time is no more than 5s.Briefly Centrifugation, is placed on ice, and RNA templates please add in the 4th step；
(3) if to do multiple reverse transcription reactions, it can will be divided in single reaction tube, put after the mixed liquor prepared In on ice；
(4) template ribonucleic acid is added in mixed liquor, thoroughly mixed, the vortex oscillation time is no more than 5s, and brief centrifugation is to receive The liquid of manifold wall residual；
(5) 37 DEG C of incubation 60min.
Reverse transcription reaction system
CDNA after reverse transcription is re-used as reacting in template addition quantifying system, then the inspection of the RNA progress purity to extraction Survey, then carry out RT-PCR reactions.Real-time fluorescence quantitative PCR program is arranged to：After 95 DEG C of denaturation 5min；In 95 DEG C, 30s, 60 DEG C, 30s；68 DEG C, 30s；After 39 circulations, 65 DEG C of 95 DEG C, increment0.5 DEG C of to.PCR reaction systems are：The μ of water 10.75 The μ l of l, realtime mix 11.25, each 0.5 μ l of primer, the μ l of DNA profiling 2.Primer is Asp-F (CTGTCCGAGCGTCATTG) With ITS-R (TCCTCCGCTTATTGATAT).
And the integrality that 3 pairs of primers carry out checking RNA, design principle such as Fig. 1 are devised, if the RNA of extraction is complete, before Section, stage casing, back segment three should be consistent to the amplification of same gene in primer pair same sample, if the RNA of extraction is endless Whole, then the amplification of stage casing primer can be noticeably greater than the amplification of leading portion or rear end primer.Primer sequence is as shown in the table.
Verify the primer sequence of RNA integralities
4.3 a small amount of spore RNA extractions Test of threshold
Before a small amount of spore RNA extractions are carried out, Test of threshold has first been carried out.Primer has changed one and half half-nest type primers into, First time heminested PCR pfkA-qian-F (TCAGTGACGTACTGGTTGCC) and pfkA-zhong-R (AATGACGAATCCACGCTGGT), second of heminested PCR pfkA-qian-F and pfkA-qian-R (CCACCAGAGGTCAAGACACC)。
It is respectively provided with 1 × 104It is individual, 1 × 103It is individual, 1 × 102It is individual, 1 × 101Individual four gradients of spore.First two groups are by height Concentration bacterium solution dilutes to obtain, and it is every milliliter 5 × 10 to concentration that specific practice, which is,7Individual spore suspension carries out gradient dilution, concentration 2.5 × 10 are diluted to respectively4Individual/mL, 2.5 × 103Individual/mL, 400 μ L bacterium solutions are taken respectively to centrifuge tube i.e. available 1 × 104Individual, 1×103Individual spores solution.Due to 1 × 102It is individual, 1 × 101Individual spores solution concentration is too low, the mistake that the method for gradient dilution is brought Difference is too big, so using for reference the unicellular method selected first.Specific practice is with clean rifle certain density spore bacterium solution Head, which has been drawn, to be dripped on sterilized slide, and slide is placed under the microscope, draws out a certain amount of spore extremely In 0.05% (v/v) Tween 80 and 0.9% sterile Nacl solution, spore is set preferably to be dissolved in solution.
In a small amount of spore RNA extracts Test of threshold, preprocessing process extracts orthogonal test using a large amount of spore RNA In obtain advantest method processing sample.
After physics is broken, RNA extraction and reverse transcription are first carried out, then carries out first round heminested PCR reaction, the first round Template of the quantitative amount of product that heminested PCR has reacted as the second wheel heminested PCR.First time heminested PCR and for the second time half The specific system of nest-type PRC is as shown in the table, adds sample and is put into quantitative real time PCR Instrument and reacts.
Heminested PCR system
Because first time heminested PCR fragment length is longer, extension extension of time is 1min, and specific procedure is set For：After 95 ° of denaturation 5min；In 95 °, 30s, 60 °, 30s；68 °, 1min；After 40 circulations, 65 ° of 95 °, increment0.5 ° of to. Second of heminested PCR program be：After 95 ° of denaturation 5min；In 95 °, 30s, 60 °, 30s；68 °, 30s；After 40 circulations, 65 ° of to 95 °, increment0.5 °.For the purpose of being confirmed whether after second of heminested PCR with reference to dissolving peak and gel electrophoresis race glue size Gene.
The influence that 4.4 research physical intersection methods are extracted to a small amount of spore RNA
After a small amount of spore RNA extractions lowest threshold is obtained, take the bacterium solution of least concentration dense as a small amount of spore RNA extractions Degree, 400 μ L bacterium solutions are drawn in centrifuge tube, with the Three factors-levels of a large amount of spore RNA physical intersections experiment test, Test parameters such as following table.
A small amount of spore RNA extracts physical orthogonal tests
Bacterium solution first carries out RNA extraction and reverse transcription after physics has crushed, and then takes the solution of reverse transcription to be used as the The template of one wheel heminested PCR.The first round reacted after heminested PCR quantitative amount of product as second wheel heminested PCR mould Plate, dissolving peak is combined after second of heminested PCR and gel electrophoresis runs glue size and is confirmed whether it is target gene.Heminested PCR Reaction system and response procedures are same as above.
5th, experimental result
The influence of 5.1 each factors of Orthogonal Method research spore RNA extractions a large amount of to Physical
In a large amount of spore RNA physics crush orthogonal test, to orthogonal examination in terms of concentration, purity and integrality three Test result to be analyzed, wherein using concentration as supplemented by main condition optimizing index, purity and integrality.Concentration is with quantitative inspection The Cq values reaction of result is surveyed, purity is reacted by measuring A260/280 value, and integrality passes through 3 pairs of primers before, during and after design RNA integrality is reacted, testing result is quantified and RNA purity concrete numerical value see the table below and Fig. 2.In Fig. 2, RFU：Relative fluorescence list Position；Cycle：Period；Temperature：Temperature；Celsius:Degree Celsius；d(RFU)/dt：Derivation；Melt peak：Dissolving Peak.
A large amount of spore RNA physics crush the quantitative testing result of orthogonal test and RNA purity
From physical disruption methods this 9 groups of orthogonal tests, the 3rd group of Cq values are minimum, i.e., crushing efficiency highest, all samples are molten Solution temperature is stable in 89.5-90 DEG C.The checking of integrality, optimal the 3rd group is picked to do RNA integrity tests, it is quantitative Testing result is shown in Fig. 3.
By in Fig. 3, disconnected Cq values are equal to 26.33 afterwards, slightly larger than leading portion (Cq=25.86) and stage casing (Cq=25.82), but It is that difference degree is little, from leading portion and middle piecewise analysis, RNA is not degrade, it may be possible to not transcription completely in the cell.
Quadrature analysis is carried out according to result, draws test index sum K corresponding during the i.e. pearl 1mm of level of A factors 1 (A1) it is equal to 57.02, average value k (A1) is equal to 19.00,；The level of A factors 2 test index sum corresponding when being pearl 3mm K (A2) is equal to 64.73, and average value k (A2) is equal to 21.58,；The level of A factors 3 test index corresponding when being pearl 2mm it It is equal to 70.07 with K (A3), average value k (A3) is equal to 23.36；Because Cq values are inversely proportional with nucleic acid content, so each horizontal to examination The influence size for testing index is：K (A1) ＞ k (A2) ＞ k (A3), i.e. 1mm are the optimal level of A factors.The level of B factors 1 is pearl When quantum count is 20, corresponding test index sum K (B1) is equal to 66.66, and average value k (B1) is equal to 22.22,；B factors 2 levels be pearl quantity be 30 when, corresponding test index sum K (B2) be equal to 66.01, average value k (B2) is equal to 22.00；The level of B factors 3 be pearl quantity be 40 when, corresponding test index sum K (B3) be equal to 59.15, average value k (B3) it is equal to 19.71,；Each horizontal influence size to test index is：K (B3) ＞ k (B2) ＞ k (B1), i.e. pearl quantity 40 Be B factors optimal level.The level of C factors 1 be milling time for 5min × 2 when, corresponding test index sum K (C1) Equal to 61.65, average value k (C1) is equal to 20.55；The level of C factors 2 be milling time for 5min × 3 when, corresponding experiment refers to Mark sum K (C2) and be equal to 59.09, average value k (C2) is equal to 19.70；The level of C factors 3 be milling time for 5min × 4 when, institute Corresponding test index sum K (C3) is equal to 71.07, and average value k (C3) is equal to 23.69,；Each horizontal influence to test index Size is：K (C2) ＞ k (C1) ＞ k (C3), i.e. 5min × 3 are the optimal level of B factors.Through orthogonal test analysis, it is known that A1B3C2 is that the optimal level of this experiment combines, i.e., a large amount of spore RNA physics crush orthogonal test optimal result and are：1mm、40 , 5min × 3.
5.2 a small amount of spore RNA extractions Test of threshold
In a small amount of spore RNA extractions Test of threshold, heminested PCR quantitative result see the table below and Fig. 4 shown in (preceding two figures are First round heminested PCR, latter two be the second wheel heminested PCR result).
A small amount of spore RNA heminested PCR quantitative results
Not notable from the Cq values linear relationship of first round heminested PCR quantitative result, concentration is 1 × 103Individual spore amplification Out Cq values are than 1 × 102Individual spore is higher, it is possible the reason for be that amplification generates wrong segment for the first time, and at second half It can be seen that in nest-type PRC quantitative result, with the reduction of spore concentration, Cq values are in increase trend.This also just embodies half-nest type PCR specificity, even if there are false segments for the first time, but primer pairing and the probability expanded can be carried out in false segments It is extremely low.Second wheel heminested PCR quantitative result can be seen that concentration and Cq values are linearly related, and the is can be seen that from solvent peak figure The positive of one wheel heminested PCR and the dissolving peak of test specimen are more mixed and disorderly, but also show it and have in negative temperature (79-79.5 DEG C) One big peak, there is a small peak in the solution temperature (88.5-89.5 DEG C) of target product.The dissolving peak of second wheel heminested PCR Can be seen that, only 1,2,3 and positive solvent peak at sample solution temperature (87 DEG C).The agarose gel electrophoresis of quantitative amount of product is run Glue is verified, as a result sees Fig. 5.
As seen from Figure 5,1,2, No. 3 and positive are to have obvious band at 303bp in primer size, No. 4 and negative nothing Band, with reference to result above, a small amount of spore RNA concentration extracted is set to 1 × 102Individual spore.
The influence that 5.4 research physical intersection methods are extracted to a small amount of spore RNA
In a small amount of spore RNA extracts physical orthogonal tests, heminested PCR quantitative result is (first two as shown in following table and Fig. 6 Figure be first round heminested PCR, latter two be the second wheel heminested PCR result).
A small amount of spore RNA orthogonal test heminested PCR quantitative results
From the point of view of the solvent peak figure of first round heminested PCR quantitative result, dissolving peak is more miscellaneous relatively disorderly, but at 78.5 DEG C and 88.5 DEG C still visible peak.All sample solution temperatures of second wheel are stable in 86.5-87 DEG C.Quantitative amount of product Ago-Gel As shown with 7, from running cementing fruit, 1-9 stripe sizes and target product are in the same size for electrophoretogram.
From 9 groups of data of a small amount of spore RNA extracts physical orthogonal tests, the 3rd group of Cq values are minimum, i.e., bead size is 1mm, pearl quantity are 40, milling time is 5min × 4 for optimal set in 9 groups of experiments, be then 1 successively, 7,2,8,4,6, 9、5.Quadrature analysis is carried out according to table 4-7 results, draws test index sum K corresponding during the i.e. pearl 1mm of level of A factors 1 (A1) it is equal to 32.46, average value k (A1) is equal to 10.82,；The level of A factors 2 test index sum corresponding when being pearl 3mm K (A2) is equal to 39.32, and average value k (A2) is equal to 13.10,；The level of A factors 3 test index corresponding when being pearl 2mm it It is equal to 35.54 with K (A3), average value k (A3) is equal to 11.85,；Because Cq values are inversely proportional with nucleic acid content, so each level is right The influence size of test index is：K (A1) ＞ k (A3) ＞ k (A2), i.e. 1mm are the optimal level of A factors.The level of B factors 1 is When pearl quantity is 20, corresponding test index sum K (B1) is equal to 33.89, and average value k (B1) is equal to 11.30,；B because Plain 2 level be pearl quantity for 30 when, equal to 37.71, average value k (B2) is equal to corresponding test index sum K (B2) 12.57,；The level of B factors 3 be pearl quantity be 40 when, corresponding test index sum K (B3) be equal to 35.73, average value K (B3) is equal to 11.91,；Each horizontal influence size to test index is：K (B1) ＞ k (B3) ＞ k (B2), i.e. pearl quantity 20 Be B factors optimal level.The level of C factors 1 be milling time for 5min × 2 when, corresponding test index sum K (C1) Equal to 35.46, average value k (C1) is equal to 11.82,；The level of C factors 2 be milling time for 5min × 3 when, corresponding experiment Index sum K (C2) is equal to 36.61, and average value k (C2) is equal to 12.20,；The level of C factors 3 be milling time for 5min × 4 when, Corresponding test index sum K (C3) is equal to 35.26, and average value k (C3) is equal to 11.75,；Each horizontal shadow to test index Ringing size is：K (C3) ＞ k (C1) ＞ k (C2), i.e. 5min × 4 are the optimal level of C factors.Through orthogonal test analysis, it is known that A1B1C3 is that the optimal level of this experiment combines, i.e., a small amount of spore RNA physics crushes orthogonal test optimal result and is：1mm、20 , 5min × 4.
Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>China Agricultural University
<120>Mechanical crushing method extraction mycotic spore RNA method
<130> KHP171114535.8
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 17
<212> DNA
<213>Artificial sequence
<400> 1
ctgtccgagc gtcattg 17
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<400> 2
tcctccgctt attgatat 18
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
tcagtgacgt actggttgcc 21
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
ccaccagagg tcaagacacc 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
ttcactggga ggatgttcgc 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
aatgacgaat ccacgctggt 20
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence
<400> 7
gccattcaca acggtttccc 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<400> 8
ttcttgaagc tcttcgccgt 20

Claims (7)

  1. A kind of 1. mechanical crushing method extraction mycotic spore RNA method, it is characterised in that including：Mycotic spore liquid is taken, adds glass Glass pearl, Mechanical Crushing processing is carried out, then carry out RNA extractions；
    In terms of 1mL mycotic spore liquid, glass bead quantity used is 20-40 in Mechanical Crushing processing procedure, and glass bead is big Small is 1-3mm, and Mechanical Crushing processing time is (2 × 5) min- (4 × 5) min.
  2. 2. according to the method for claim 1, it is characterised in that mycotic spore liquid miospore quantity >=1 × 102Individual/ mL；Preferably, mycotic spore liquid miospore quantity >=5 × 107Individual/mL.
  3. 3. according to the method for claim 1, it is characterised in that in terms of 1mL mycotic spore liquid, spore in the mycotic spore liquid Quantum count >=5 × 107Individual/mL, glass bead quantity are 40, and glass bead size is 1mm, and Mechanical Crushing processing time is (3 ×5)min。
  4. 4. according to the method for claim 1, it is characterised in that in terms of 1mL mycotic spore liquid, spore in the mycotic spore liquid Quantum count is no less than 1 × 102Individual/mL, glass bead quantity are 20, and glass bead size is 1mm, Mechanical Crushing processing time For (4 × 5) min.
  5. 5. according to the method described in claim any one of 1-4, it is characterised in that the Mechanical Crushing is milled processed.
  6. 6. according to the method described in claim any one of 1-5, it is characterised in that the mechanical crushing method extracts mycotic spore RNA method comprises the following steps：
    (1) mycotic spore liquid is taken, adds glass bead, carries out Mechanical Crushing processing；
    (2) the mycotic spore liquid after broken wall is transferred to a clean centrifuge tube, 12,000rpm centrifugation 2min, takes supernatant；
    (3) 70% ethanol of 1 times of volume is added into supernatant；
    (4) it is vortexed and mixes；
    (5) it is transferred to centrifugal column；
    (6) 12,000rpm centrifuge 15s, abandon waste liquid；
    (7) add 700 μ L Wash buffer I, 12,000rpm centrifugation 15s, abandon waste liquid, be put into a new centrifuge tube；
    (8) add 500 μ L Wash buffer II, 12,000rpm centrifugation 15s, abandon waste liquid；
    (9) (8) are repeated
    (10) 12,000rpm centrifuges 2min again, is put into a new collecting pipe, and room temperature places 5min thoroughly to dry adsorption material Remaining rinsing liquid in material；
    (11) plus 50 μ Rnase-free water are to centrifugal column center, and room temperature places 1min, 12,000rpm centrifugation 2min；
    (12) solution that centrifugation obtains is added in centrifugal column, room temperature places 1min, 12,000rpm centrifugation 2min, to improve RNA concentration.
  7. 7. according to the method described in claim any one of 1-6, it is characterised in that the mycotic spore is aspergillus niger spore.
CN201710662062.2A 2017-08-04 2017-08-04 Method for extracting RNA of mould spore by mechanical crushing method Active CN107365766B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710662062.2A CN107365766B (en) 2017-08-04 2017-08-04 Method for extracting RNA of mould spore by mechanical crushing method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710662062.2A CN107365766B (en) 2017-08-04 2017-08-04 Method for extracting RNA of mould spore by mechanical crushing method

Publications (2)

Publication Number Publication Date
CN107365766A true CN107365766A (en) 2017-11-21
CN107365766B CN107365766B (en) 2020-10-02

Family

ID=60308739

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710662062.2A Active CN107365766B (en) 2017-08-04 2017-08-04 Method for extracting RNA of mould spore by mechanical crushing method

Country Status (1)

Country Link
CN (1) CN107365766B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111238889A (en) * 2020-01-16 2020-06-05 江西业力医疗器械有限公司 Liquid-based fungus detection method based on flaking method
CN113324818A (en) * 2021-08-04 2021-08-31 潍坊市检验检测中心 Fermented food viable bacteria separation device based on gel electrophoresis principle

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101935643A (en) * 2010-08-19 2011-01-05 中国水产科学研究院黄海水产研究所 Method for efficiently extracting biological total DNA from Apostichopus japonicus intestinal content and environmental substrate sludge
CN105586333A (en) * 2016-01-07 2016-05-18 中国人民解放军第二军医大学 Quick extraction method for total DNA of yeast-like fungi for nucleic acid amplification
WO2017129814A1 (en) * 2016-01-30 2017-08-03 Safeguard Biosystems Holdings Ltd. Bead beating tube and method for extracting deoxyribonucleic acid and/or ribonucleic acid from microorganisms

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101935643A (en) * 2010-08-19 2011-01-05 中国水产科学研究院黄海水产研究所 Method for efficiently extracting biological total DNA from Apostichopus japonicus intestinal content and environmental substrate sludge
CN105586333A (en) * 2016-01-07 2016-05-18 中国人民解放军第二军医大学 Quick extraction method for total DNA of yeast-like fungi for nucleic acid amplification
WO2017129814A1 (en) * 2016-01-30 2017-08-03 Safeguard Biosystems Holdings Ltd. Bead beating tube and method for extracting deoxyribonucleic acid and/or ribonucleic acid from microorganisms

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111238889A (en) * 2020-01-16 2020-06-05 江西业力医疗器械有限公司 Liquid-based fungus detection method based on flaking method
CN113324818A (en) * 2021-08-04 2021-08-31 潍坊市检验检测中心 Fermented food viable bacteria separation device based on gel electrophoresis principle
CN113324818B (en) * 2021-08-04 2021-09-28 潍坊市检验检测中心 Fermented food viable bacteria separation device based on gel electrophoresis principle

Also Published As

Publication number Publication date
CN107365766B (en) 2020-10-02

Similar Documents

Publication Publication Date Title
EP3636769B1 (en) Sample nucleic acid measurement test kit, reagent, and application thereof
CN102146466B (en) Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method
CN107058307A (en) Primer, kit and the method for detecting HBB gene sequence
CN102086471B (en) Kit and method for identifying and detecting Cordyceps sinensis
CN110343785B (en) Kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13a
CN104498599A (en) Microsporidium molecule universal detection primers and kit thereof
CN103602757A (en) Development and application of multiple fluorescence RT-PCR detection method for foot-and-mouth disease, vesicular stomatitis and swine vesicular disease
CN101586162B (en) Method of extracting target nucleic acid and performing PCR amplification
CN104561332A (en) SSR molecular marker for identifying aspen gender and application of SSR molecular marker
CN107365766A (en) Mechanical crushing method extraction mycotic spore RNA method
Liu et al. The species identification in traditional herbal patent medicine, Wuhu San, based on shotgun metabarcoding
CN107164471B (en) Molecular identification method for rapidly identifying truth of beauveria bassiana in traditional Chinese medicine stiff silkworm
CN106282373A (en) A kind of Herba Dendrobii and the contrast authentication method of Henan Herba Dendrobii
CN105525012A (en) Molecular identification method of peanut hybrid
CN105603106A (en) PCR (polymerase chain reaction) method and kit for identifying peach kernel and bitter almond on basis of ITS sequence site
CN102643801B (en) Extraction method for glycocalyx-generating bacterium genome DNA (Deoxyribonucleic Acid) suitable for whole-genome sequencing
CN102586404B (en) Kit for specifically detecting genotype of ApoE4 and application of kit
CN104531902B (en) A kind of kit and preparation method thereof
CN104004835A (en) Multiplex PCR detection method of rabbit skin fungi
CN104975077B (en) Pig source eperythrozoon fluorescent quantificationally PCR detecting kit and its application
CN102140451A (en) Method for extracting DNA (Desoxyribonucleic Acid) and RNA (Ribonucleic Acid)
CN106399475B (en) A method of it obtaining rDNA ITS2 sequence and is used to identify Tiepi Fengdou
CN104498509B (en) HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection
CN106682919A (en) Commercially available Ranae oviductus medicinal material inspection method based on DNA bar code technology
CN106755554A (en) Pine wood nematode SSR label primer is used for the purposes of pine wood nematode detection and the PCR detection method of pine wood nematode

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information

Inventor after: Xu Wentao

Inventor after: Luo Yunbo

Inventor after: Huang Kunlun

Inventor after: Tian Lanfang

Inventor after: He Xiaoyun

Inventor after: Guo Mingzhang

Inventor before: Luo Yunbo

Inventor before: Xu Wentao

Inventor before: Huang Kunlun

Inventor before: Tian Lanfang

Inventor before: He Xiaoyun

Inventor before: Guo Mingzhang

CB03 Change of inventor or designer information
GR01 Patent grant
GR01 Patent grant