CN106682919A - Commercially available Ranae oviductus medicinal material inspection method based on DNA bar code technology - Google Patents
Commercially available Ranae oviductus medicinal material inspection method based on DNA bar code technology Download PDFInfo
- Publication number
- CN106682919A CN106682919A CN201710007929.0A CN201710007929A CN106682919A CN 106682919 A CN106682919 A CN 106682919A CN 201710007929 A CN201710007929 A CN 201710007929A CN 106682919 A CN106682919 A CN 106682919A
- Authority
- CN
- China
- Prior art keywords
- bar code
- medicinal material
- sampling
- sample
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G06—COMPUTING; CALCULATING OR COUNTING
- G06Q—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
- G06Q30/00—Commerce
- G06Q30/018—Certifying business or products
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
Landscapes
- Business, Economics & Management (AREA)
- Physics & Mathematics (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Theoretical Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Biotechnology (AREA)
- Evolutionary Biology (AREA)
- Biophysics (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Entrepreneurship & Innovation (AREA)
- Accounting & Taxation (AREA)
- Development Economics (AREA)
- Economics (AREA)
- Finance (AREA)
- Marketing (AREA)
- Strategic Management (AREA)
- General Business, Economics & Management (AREA)
- General Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a commercially available Ranae oviductus medicinal material inspection method based on the DNA bar code technology. The method comprises the steps that field sampling is conducted; laboratory sampling is conducted on samples obtained after field sampling, a COI bar code sequence of a sample obtained after laboratory sampling is obtained; the obtained COI bar code sequence is compared with a Rana temporaria chensinensis COI characteristic bar code sequence; according to a comparison result, the authenticity of original species is judged, that is whether the original species are in accordance with the species collected in edition 2005 of China pharmacopeia or not is judged. The commercially available Ranae oviductus medicinal material inspection method based on the DNA bar code technology is established for the first time, and the method is good in objectivity, stability and accuracy.
Description
Technical field
The present invention relates to the Chinese medicine method of inspection, and in particular to a kind of commercially available Oviductus Ranae medicine based on DNA bar code technology
The material method of inspection.
Background technology
Oviductus Ranae (Ranae oviductus) is ranid Rana temporaria chensinensis (Rana temporaria
Chensinensis David) the female frog fallopian tubal, Jing gather and process be dried and obtain, main component has protein, amino acid, fat
Acid, phosphatide, hormone and vitamin etc., the effect of with tonifying kidney and benefiting sperm, Yin nourishing and lung moistening.For weak after being ill, spiritlessness and weakness, palpitaition
Insomnia, night sweat, consumptive disease is coughed hemoptysis.It is more from other batrachias similar product oviducal with toad class or adulterant in the market.
Record according to 2015 editions Chinese Pharmacopoeias, the authentication method of current Oviductus Ranae medicinal material has Characters Identification, high performance liquid chromatography and expansion
Degree determination method.Characters Identification is easily affected by factors such as collection processing, storages, and Traits change is larger, subjective；Efficient liquid phase
Chromatography is compared comprising 1-methyl-2,4-imidazolidinedione detection and reference substance chromatographic peak, easily by growing environment, stage of development and chromatographic technique sheet
The separation of body and detecting energy power restriction, have limitation using the identification of single composition, while the chemical analysis and color of nearly edge species
Spectral peak difference is less, is difficult directly observation；Dilation determination method is easily by the shadow of the factors such as sample comminution degree, water temperature, soak time
Ring, and Oviductus Ranae expansion multiple individual difference is larger, repeated and less stable.
Chinese medicine DNA bar code molecular methods are entered using one section in genome generally acknowledged, relatively short DNA sequence dna
A kind of Protocols in Molecular Biology of row species identification.At present Chinese medicine DNA bar code molecular methods guideline has been included
2015 editions Chinese Pharmacopoeias, but concrete Materia Medica Identification is not yet applied to, also lack the concrete of Oviductus Ranae medicinal material DNA bar code identification
Implementation.
The authentication method of current Oviductus Ranae medicinal material has Characters Identification, high performance liquid chromatography and dilation determination method, objective
Property, stability, accuracy there is certain limitation.Meanwhile, not yet there is the Chinese medicine DNA bar code Molecular Identification side of the marketization
Method.
The content of the invention
Authentication method in view of Oviductus Ranae medicinal material in prior art has Characters Identification, high performance liquid chromatography and dilation
There is the defect of limitation in determination method, objectivity, stability, accuracy, the technical problem to be solved is to provide one kind
The commercially available Oviductus Ranae medicinal material method of inspection based on DNA bar code technology.
The commercially available Oviductus Ranae medicinal material method of inspection based on DNA bar code technology of the present invention, method is comprised the following steps：
1) scene sampling；
2) sample of scene sampling is carried out into laboratory sampling；
3) the COI bar code sequences that laboratory samples sample are obtained；
4) the COI bar code sequences of acquisition are compared with Rana temporaria chensinensis COI feature bar code sequences；
5) the base species true and false is judged according to comparison result, i.e., whether records species with 2015 editions Chinese Pharmacopoeias consistent.
Further, step 1) in scene be sampled to：
For little parcel post, broken oil and powder all sample 1 part to 1 position；Line oil sampling 1；1 piece of block oil sampling；
For middle parcel post, broken oil and powder all sample 3 parts to 3 positions；Line oil samples 3 to 3 positions；Block oil is to 3
Individual position samples 3 pieces；
For big parcel post, broken oil and powder all sample 5-10 parts to 5-10 position；Line oil is to 5-10 position sampling 5-
10；Block oil is to 5-10 position sampling 5-10 block.
Further, step 2) in laboratory be sampled as：
For broken oil and powder：3 parts are divided into after sample blending per a scene sampling, 1/3 for lab analysis,
Another 1/3 for checking, and remaining 1/3 keeps sample preservation；
For line oil：3 sections are divided into per the sample of a scene sampling, 1/3 for lab analysis, another 1/3 for checking
With remaining 1/3 keeps sample preservation；
For block oil：3 parts are divided into per the sample of a scene sampling, 1/3 for lab analysis, another 1/3 for checking
With remaining 1/3 keeps sample preservation.
Further, step 3) include：DNA extractions are carried out to the sample of laboratory sampling；Carry out to extracting the DNA for obtaining
PCR is expanded；The product of PCR amplifications is sequenced and is spliced.
Further, the base species of certified products Oviductus Ranae medicinal material are Rana temporaria chensinensis, and the base species of the mixed adulterant of Oviductus Ranae are extremely
Include bufo gargarizans Cantor and Rans amurensis less.
Further, step 4) in Rana temporaria chensinensis COI features bar code sequence as shown in SEQ ID No.1.
Further, step 4) described in sequence alignment shown in the COI bar code sequences and the SEQ ID No.1 that obtain,
Base difference is less than 2%, and its base species is Rana temporaria chensinensis.
Further, the COI features bar code sequence of bufo gargarizans Cantor is as shown in SEQ ID No.4, this feature sequence with
Series difference shown in SEQ ID No.1 is 21.9%.
Further, the COI features bar code sequence of Rans amurensis is as shown in SEQ ID No.5, this feature sequence with
Series difference shown in SEQ ID No.1 is 12.6%.
The present invention sets up first commercially available Oviductus Ranae DNA bar code molecular methods, and its objectivity, stability, accuracy are good.
It is an advantage of the present invention that providing Rana temporaria chensinensis feature bar code sequence, by the concrete judgment criteria for being given, can accurately reflect
Whether the true and false of fixed commercially available Oviductus Ranae medicinal material, i.e., record species consistent with 2015 editions Chinese Pharmacopoeias.
Specific embodiment
The present invention is further described below with reference to embodiment, it should be understood that these embodiments mesh only illustratively
, it is not used in and limits the scope of the invention.
Taken out based on the market Oviductus Ranae medicinal material inspection method of DNA bar code technology, including the scene of Oviductus Ranae medicinal material
Quadrat method, laboratory sampling method, Rana temporaria chensinensis feature bar code sequence, base species identification standard.
Sample in the market of embodiment 1
1.1 Oviductus Ranae medicinal material parcel post visual examinations
Before extracting sample, license, the name of an article, the place of production, specification, grade and parcel post style should be checked, check packaging integrality,
Clean-up performance and whether there is water mark, go mouldy or situations such as other Substances Pollutions, in detail record.All parcel posts for having an abnormal conditions, should
Individually check and take pictures.
1.2 Oviductus Ranae medicinal material parcel post amount of samplings
No matter parcel post is sampled piece by piece.
The each parcel post sampling amount of 1.3 Oviductus Ranae medicinal materials
1) little parcel post (less than 100g or less than 20)：
Broken oil and powder：1 position in parcel post, samples 1 part, about 5g
Line oil：1
Block oil：1 piece, about 5g
2) parcel post in (less than 500g or less than 100)：
Broken oil and powder：3 positions in parcel post, sample 3 parts, altogether about 10g
Line oil：3 positions in parcel post, 3
Block oil：3 positions in parcel post, 3 pieces, common about 10g
3) big parcel post (more than 500g or more than 100)：
Broken oil and powder：5-10 position in parcel post, samples 5-10 parts, altogether about 20-100g
Line oil：5-10 position in parcel post, 5-10
Block oil：5-10 position in parcel post, 5-10 blocks, common about 20-100g.
Note：The sample that same parcel post different parts are extracted is mixed without the need for mixing.
The laboratory sampling method of embodiment 2 and experimental check method
Note：If no special instructions, 1 part of sample for each sampling point is below processed, multiple sample need to individually be located
Reason, can not intersect.
The 2.1 final sample sizes for inspection purpose for extracting
Broken oil and powder：3 parts are divided into after mixing, 1/3 for lab analysis, another 1/3 for checking, remaining 1/3 is stayed
Sample is preserved.
Line oil：3 sections are divided into, 1/3 for lab analysis, another 1/3 for checking, remaining 1/3 keeps sample preservation.
Block oil：3 parts are divided into, 1/3 for lab analysis, another 1/3 for checking, remaining 1/3 keeps sample preservation.
2.2 samples for laboratory analysis
Sample weighting amount：About 5mg.
2.3DNA extracting method
Oviductus Ranae medicinal material about 5mg is taken, 2.0mL centrifuge tubes are inserted, water of the 500 μ L containing 0.1%~2% hydrochloric acid is added, is used
Grinding pestle grinds 30 seconds or so repeatedly, to without obvious particle and mixing.
360 μ L are added containing 1%~2.5% dodecyl sodium sulfate, 10~20mM glycine and 10mM ethylenediamine tetrems
The buffer solution of sour sodium and 40 μ L Proteinase Ks (20mg/mL) lysate samples, are mixed 30 seconds or so using vortex mixed instrument, and 56 DEG C incubate
Educate to solution clarification, reverse biased sample 2~3 times per half an hour, or use water bath chader.
Buffer solutions of the 400 μ L containing 10~20mM glycine and 10mM ethylenediamine tetraacetic acid (EDTA) is added, is vortexed and is mixed 30 seconds.
Add 700 μ L phenol/chloroform/isoamyl alcohol (25:24:1), acutely vibration mixes 30sec, room temperature on turbine mixer
Under 5min is at full throttle centrifuged.
It is careful that supernatant is transferred to into a new centrifuge tube, add 700 μ L chloroforms/isoamyl alcohol (24:1), in vortex mixed
Acutely vibration is mixed 30 seconds on device, is at full throttle centrifuged under room temperature 5 minutes.
Equal-volume absolute ethyl alcohol is added, acutely vibration is mixed 30 seconds on turbine mixer, 2~5min is stood under room temperature.
It is careful that supernatant is transferred to into a new centrifuge tube, the sodium acetate of the 3mol/L PH 5.2 of 1/10 volume is added,
Slightly vibrate on turbine mixer or flick centrifugation tube wall with finger and be allowed to mix several times.
The absolute ethyl alcohol or equal-volume isopropanol of 2~2.5 times of volumes ice colds are added, the vibration on turbine mixer is mixed,
Ice bath 5min, is at full throttle centrifuged 5min under room temperature.
Supernatant discarded, the 70% ethanol washing for adding 1mL precoolings is precipitated 1~2 time.
It is deposited in vacuum desiccator or vacuum rotary evaporator and is dried, or carefully suck supernatant, by centrifuge tube
It is inverted on a piece of paper, normal temperature is spontaneously dried.
Add 50 μ L ddH2O to dissolve, obtain the DNA for extracting, save backup in 4 DEG C or -20 DEG C.
2.4PCR amplification
DNA is obtained as masterplate with said extracted, with forward primer LWF01 (SEQ ID No.2)：5’-TCTC TACT
AATC ATAA AGA YATYGG-3’；Reverse primer LWR01 (SEQ ID No.3)：5’-TAAA CTTC AGGG TGAC
CAAARAATCA-3 ' is expanded.In primer, it can be A or G that R is represented；It can be C or T that Y is represented.
Wherein, primer pair LWF01 and LWR01 are used to expand the partial sequence in COI sequences, namely DNA amplification bar code.
PCR reaction conditions are：
94 DEG C 1 minute；94 DEG C 1 minute, 54 DEG C, 1.5 minutes, 72 DEG C 1 minute, 35 circulation；72 DEG C 5 minutes.
2.5 sequencings using based on Sanger be sequenced the ABI 3130/3130XL of principle, 3730/3730XL, 3500/
The first generation sequenator such as 3500XL is sequenced.Skilled person will appreciate that, other sequencing technologies can also be used for into performing PCR
The sequencing of product.
2.6 sequence assemblies and quality control
Sequence assembly is carried out based on the software that sequencing quality splices using Codoncode Aligner etc..
After removing guiding region, uniformity (Consensus) sequence average mass value need to be more than Q40, and mass value is less than Q30's
Base is less than 1%.
2.7 base species identifications
The sequence that any sampling position is obtained and Oviductus Ranae (Rana temporaria chensinensis Rana temporaria chensinensis
David) feature COI series difference must not exceed 2%, as from the Oviductus Ranae of Rana temporaria chensinensis, with 2015 editions China
It is consistent that pharmacopeia records base species.
Wherein, COI characteristic sequences are such as Oviductus Ranae (Rana temporaria chensinensis Rana temporaria chensinensis David)
Shown in lower (SEQ ID No.1)：
AACCCTCTACCTAATCTTCGGGGCCTGAGCCGGCATGGTCGGAACAGCCCTAAGCCTTCTTATTCGAGC
AGAATTAAGCCAACCGGGAACTCTCTTGGGGGACGACCAGATCTACAATGTTATCGTCACTGCCCACGCATTTGTAA
TGATTTTCTTTATAGTCATACCAATCCTAATCGGGGGCTTTGGTAACTGACTAATCCCCATGATGATTGGAGCCCCT
GACATAGCCTTCCCCCGGATAAATAATATGAGCTTCTGGCTACTCCCACCATCCTTCTTTCTCCTCTTAGCCTCCTC
TACAGTTGAAGCTGGAGCAGGTACAGGCTGAACAGTCTATCCCCCTTTAGCTGGCAACCTAGCCCACGCGGGCCCAT
CGGTAGACCTAGCCATCTTCTCGCTACACCTGGCCGGGGTATCATCAATCCTGGGGGCAATCAATTTTATTACAACA
ATTATTAATATAAAACCCGCATCCACAACACAATACCAAACACCCCTGTTCGTCTGATCTGTTCTGATCACTGCTGT
ACTCCTGCTTCTTTCTCTCCCAGTCCTAGCCGCTGGAATTACCATACTTCTCACAGACCGAAATCTAAACACCACCT
TTTTCGACCCTGCAGGGGGAGGAGACCCAGTTCTCTACCAGCACCTATTC
For the main adulterant of Oviductus Ranae：Bufo gargarizans Cantor oil (bufo gargarizans Cantor Bufo gargarizans Cantor)
With Rans amurensis oil (Rans amurensis Rana amurensis Boulenger), their oil (Oviductus Ranae) with Rana temporaria chensinensis
Difference is as follows：
1) bufo gargarizans Cantor oil COI feature bar code sequences (SEQ ID No.4) as follows, this feature sequence and Kazakhstan toad
Oily COI features bar code sequence base difference is 21.9%：
TACTCTATATCTTATTTTTGGGGCCTGAGCAGGAATAGTAGGAACTGCCCTTAGCCTCCTTATCCGAGC
TGAGCTGAGTCAACCAGGCTCCCTCTTGGGCGATGATCAGATCTATAATGTCATTGTTACCGCCCACGCCTTCGTCA
TAATTTTCTTTATGGTCATGCCCATCCTAATCGGAGGCTTCGGTAACTGACTTGTCCCCCTGATAATTGGGGCCCCT
GACATAGCCTTCCCCCGAATGAATAACATAAGCTTTTGATTACTCCCCCCGTCATTTCTACTCCTCTTGGCATCCGC
CGGAGTCGAAGCAGGGGCAGGAACCGGCTGAACTGTATACCCCCCTCTGGCTGGGAACCTTGCACACGCAGGCCCAT
CAGTCGACTTAACCATTTTTTCCCTCCACCTTGCGGGTGTATCATCTATCCTAGGCGCAATTAATTTTATTACAACA
ACCCTTAACATGAAGCCACCATCAATGACTCAATACCAAACACCCTTATTTGTATGATCCGTCTTGATTACTGCTGT
TTTACTCCTACTCTCCCTGCCAGTCCTCGCTGCAGGAATCACTATACTCCTCACTGACCGAAACCTAAACACAACAT
TCTTTGACCCTGCTGGCGGAGGCGACCCCATCCTCTATCAACACCTCTTT
2) Rans amurensis oil COI feature bar code sequences (SEQ ID No.5) as follows, this feature sequence and Kazakhstan toad
Oily COI features bar code sequence base difference is 12.6%：
AACCCTCTATTTTATCTTCGGGGCCTGAGCCGGCATAATCGGAACAGCTCTAAGCCTCCTCATTCGAGC
GGAACTAAGTCAGCCAGGAACCCTCCTGGGAGACGATCAAATTTATAATGTCATCGTCACTGCCCACGCATTTGTAA
TAATTTTTTTTATAGTTATACCAATCCTAATTGGAGGCTTTGGCAATTGACTTATCCCCCTAATGATTGGAGCCCCT
GATATAGCTTTTCCGCGAATAAACAACATAAGCTTCTGACTACTCCCACCCTCTTTTTTCCTTCTCTTAGCCTCCTC
CATAGTTGAAGCCGGAGCAGGCACAGGCTGAACAGTTTACCCCCCACTAGCCAGCAATCTCGCCCACGCAGGCCCAT
CAGTAGACATGGCCATTTTTTCATTACATTTAGCTGGGGTATCCTCCATTCTAGGGGCCATTAATTTCATTACAACA
ATTATTAATATAAAACCCTCATCCACAACCCAATACCAAACCCCTCTCTTTGTTTGATCAGTCTTAATTACTGCTGT
TCTCCTACTTCTTTCCCTCCCTGTCCTAGCCGCCGGGATCACTATACTTCTTACAGACCGGAATCTGAACACTACCT
TCTTTGATCCTGCTGGAGGCGGAGACCCAGTTCTCTACCAACACCTATTC
The commercially available little parcel post Oviductus Ranae medicinal material inspection of embodiment 3
1) scene sampling
Little parcel post, randomly selects line oil 1.
2) sample of scene sampling is carried out into laboratory sampling
3 sections are divided into, 1/3 for lab analysis, another 1/3 for checking, remaining 1/3 keeps sample preservation.
3) bar code sequence (COI) that laboratory samples sample is obtained
A. sample weighting amount：5.15mg, inserts 2.0mL centrifuge tubes
B.DNA is extracted
Water of the 500 μ L containing 0.1%~2% hydrochloric acid is added, is ground repeatedly 30 seconds or so using grinding pestle, to without obvious particle
And mix.
360 μ L are added containing 1%~2.5% dodecyl sodium sulfate, 10~20mM glycine and 10mM ethylenediamine tetrems
The buffer solution of sour sodium and 40 μ L Proteinase Ks (20mg/mL) lysate samples, are mixed 30 seconds or so using vortex mixed instrument, and 56 DEG C incubate
Educate to solution clarification, reverse biased sample 2~3 times per half an hour.
Add 700 μ L phenol/chloroform/isoamyl alcohol (25:24:1), acutely vibration is mixed 30 seconds on turbine mixer, room temperature
Under be at full throttle centrifuged 5 minutes.
It is careful that supernatant is transferred to into a new centrifuge tube, add 700 μ L chloroforms/isoamyl alcohol (24:1), in vortex mixed
Acutely vibration is mixed 30 seconds on device, is at full throttle centrifuged under room temperature 5 minutes
Equal-volume absolute ethyl alcohol is added, acutely vibration is mixed 30 seconds on turbine mixer, under room temperature 5 minutes are stood.
It is careful that supernatant is transferred to into a new centrifuge tube, the sodium acetate of the 3mol/L PH 5.2 of 1/10 volume is added,
Slightly vibration is allowed to mix on turbine mixer.
The absolute ethyl alcohol for adding 2~2.5 times of volumes ice colds vibrates mixing, ice bath 5 minutes, under room temperature on turbine mixer
At full throttle it is centrifuged 5 minutes.
Supernatant discarded, the 70% ethanol washing for adding 1mL precoolings is precipitated 2 times.
It is deposited in vacuum desiccator or vacuum rotary evaporator and is dried.
Add 50 μ L ddH2O dissolves, and saves backup at 4 DEG C.
C.PCR is expanded
PCR amplification system (25 μ L)：2×Taq PCR Mix：12.50μL；Forward primer LWF01：1.00μL；Reversely draw
Thing LWR01：1.00μL；dd H2O：8.50μL；Template DNA：2.00μL.
PCR reaction conditions are：
94 DEG C 1 minute；94 DEG C 1 minute, 54 DEG C, 1.5 minutes, 72 DEG C 1 minute, 35 circulation；72 DEG C 5 minutes.
D. it is sequenced and splices
Two-way sequencing is carried out using ABI 3130, using CodonCode Aligner 6.0.2 sequence assembly and matter are completed
Amount detection.Obtain sequence as follows：
AACCCTCTACCTAATCTTCGGGGCCTGAGCCGGCATGGTCGGAACAGCCCTAAGCCTTCTTATTCGAGC
AGAATTAAGCCAACCGGGAACTCTCTTGGGGGACGACCAGATCTACAATGTTATCGTCACTGCCCACGCATTTGTAA
TGATTTTCTTTATAGTCATACCAATCCTAATCGGGGGCTTTGGTAACTGACTAATCCCCATGATGATTGGAGCCCCT
GACATAGCCTTCCCCCGGATAAATAATATGAGCTTCTGGCTACTCCCACCATCCTTCTTTCTCCTCTTAGCCTCCTC
TACAGTTGAAGCTGGAGCAGGTACAGGCTGAACAGTCTATCCCCCTTTAGCTGGCAACCTAGCCCACGCGGGCCCAT
CGGTAGACCTAGCCATCTTCTCGCTACACCTGGCCGGGGTATCATCAATCCTGGGGGCAATCAATTTTATTACAACA
ATTATTAATATAAAACCCGCATCCACAACACAATACCAAACACCCCTGTTCGTCTGATCTGTTCTGATCACTGCTGT
ACTCCTGCTTCTTTCTCTCCCAGTCCTAGCCGCTGGAATTACCATACTTCTCACAGACCGAAATCTAAACACCACCT
TTTTCGACCCTGCAGGGGGAGGAGACCCAGTTCTCTACCAGCACCTATTC
4) bar code sequence for being obtained is completely the same with Rana temporaria chensinensis COI feature bar code sequences (SEQ ID No.1).
5) the sample base species are certified products, meet 2015 editions Chinese Pharmacopoeias.
Sequence table
<110>Harbin City food and medicine inspection center；China Medical Sciences Academy Medical Plants Institute
<120>A kind of commercially available Oviductus Ranae medicinal material method of inspection based on DNA bar code technology
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 658
<212> DNA
<213>Rana temporaria chensinensis（Rana temporaria chensinensis David）
<400> 1
aaccctctac ctaatcttcg gggcctgagc cggcatggtc ggaacagccc taagccttct 60
tattcgagca gaattaagcc aaccgggaac tctcttgggg gacgaccaga tctacaatgt 120
tatcgtcact gcccacgcat ttgtaatgat tttctttata gtcataccaa tcctaatcgg 180
gggctttggt aactgactaa tccccatgat gattggagcc cctgacatag ccttcccccg 240
gataaataat atgagcttct ggctactccc accatccttc tttctcctct tagcctcctc 300
tacagttgaa gctggagcag gtacaggctg aacagtctat ccccctttag ctggcaacct 360
agcccacgcg ggcccatcgg tagacctagc catcttctcg ctacacctgg ccggggtatc 420
atcaatcctg ggggcaatca attttattac aacaattatt aatataaaac ccgcatccac 480
aacacaatac caaacacccc tgttcgtctg atctgttctg atcactgctg tactcctgct 540
tctttctctc ccagtcctag ccgctggaat taccatactt ctcacagacc gaaatctaaa 600
caccaccttt ttcgaccctg cagggggagg agacccagtt ctctaccagc acctattc 658
<210> 2
<211> 25
<212> DNA
<213>Artificial sequence
<220>
<223> LWF01
<400> 2
tctctactaa tcataaagay atygg 25
<210> 3
<211> 26
<212> DNA
<213>Artificial sequence
<220>
<223> LWR01
<400> 3
taaacttcag ggtgaccaaa raatca 26
<210> 4
<211> 658
<212> DNA
<213>Bufo gargarizans Cantor（Bufo gargarizans Cantor）
<400> 4
tactctatat cttatttttg gggcctgagc aggaatagta ggaactgccc ttagcctcct 60
tatccgagct gagctgagtc aaccaggctc cctcttgggc gatgatcaga tctataatgt 120
cattgttacc gcccacgcct tcgtcataat tttctttatg gtcatgccca tcctaatcgg 180
aggcttcggt aactgacttg tccccctgat aattggggcc cctgacatag ccttcccccg 240
aatgaataac ataagctttt gattactccc cccgtcattt ctactcctct tggcatccgc 300
cggagtcgaa gcaggggcag gaaccggctg aactgtatac ccccctctgg ctgggaacct 360
tgcacacgca ggcccatcag tcgacttaac cattttttcc ctccaccttg cgggtgtatc 420
atctatccta ggcgcaatta attttattac aacaaccctt aacatgaagc caccatcaat 480
gactcaatac caaacaccct tatttgtatg atccgtcttg attactgctg ttttactcct 540
actctccctg ccagtcctcg ctgcaggaat cactatactc ctcactgacc gaaacctaaa 600
cacaacattc tttgaccctg ctggcggagg cgaccccatc ctctatcaac acctcttt 658
<210> 5
<211> 658
<212> DNA
<213>Rans amurensis（Rana amurensis Boulenger）
<400> 5
aaccctctat tttatcttcg gggcctgagc cggcataatc ggaacagctc taagcctcct 60
cattcgagcg gaactaagtc agccaggaac cctcctggga gacgatcaaa tttataatgt 120
catcgtcact gcccacgcat ttgtaataat tttttttata gttataccaa tcctaattgg 180
aggctttggc aattgactta tccccctaat gattggagcc cctgatatag cttttccgcg 240
aataaacaac ataagcttct gactactccc accctctttt ttccttctct tagcctcctc 300
catagttgaa gccggagcag gcacaggctg aacagtttac cccccactag ccagcaatct 360
cgcccacgca ggcccatcag tagacatggc cattttttca ttacatttag ctggggtatc 420
ctccattcta ggggccatta atttcattac aacaattatt aatataaaac cctcatccac 480
aacccaatac caaacccctc tctttgtttg atcagtctta attactgctg ttctcctact 540
tctttccctc cctgtcctag ccgccgggat cactatactt cttacagacc ggaatctgaa 600
cactaccttc tttgatcctg ctggaggcgg agacccagtt ctctaccaac acctattc 658
Claims (9)
1. a kind of commercially available Oviductus Ranae medicinal material method of inspection based on DNA bar code technology, it is characterised in that methods described includes：
1) scene sampling；
2) sample of scene sampling is carried out into laboratory sampling；
3) the COI bar code sequences that laboratory samples sample are obtained；
4) the COI bar code sequences of acquisition are compared with Rana temporaria chensinensis COI feature bar code sequences；
5) the base species true and false is judged according to comparison result.
2. the commercially available Oviductus Ranae medicinal material method of inspection of DNA bar code technology is based on as claimed in claim 1, it is characterised in that
Step 1) in scene be sampled to：
For little parcel post, broken oil and powder all sample 1 part to 1 position；Line oil sampling 1；1 piece of block oil sampling；
For middle parcel post, broken oil and powder all sample 3 parts to 3 positions；Line oil samples 3 to 3 positions；Block oil is to 3 portions
3 pieces of position sampling；
For big parcel post, broken oil and powder all sample 5-10 parts to 5-10 position；Line oil is to 5-10 position sampling 5-10；
Block oil is to 5-10 position sampling 5-10 block.
3. the commercially available Oviductus Ranae medicinal material method of inspection of DNA bar code technology is based on as claimed in claim 1, it is characterised in that
Step 2) in laboratory be sampled as：
For broken oil and powder：3 parts are divided into after sample blending per a scene sampling, 1/3 for lab analysis, another 1/
3 for checking, and remaining 1/3 keeps sample preservation；
For line oil：3 sections are divided into per the sample of a scene sampling, 1/3 for lab analysis, and another 1/3 for checking, its
Remaining and 1/3 keep sample preservation；
For block oil：3 parts are divided into per the sample of a scene sampling, 1/3 for lab analysis, and another 1/3 for checking, its
Remaining and 1/3 keep sample preservation.
4. the commercially available Oviductus Ranae medicinal material method of inspection of DNA bar code technology is based on as claimed in claim 1, it is characterised in that
Step 3) include：DNA extractions are carried out to the sample of laboratory sampling；Enter performing PCR amplification to extracting the DNA for obtaining；PCR is expanded
Product be sequenced and spliced.
5. the market Oviductus Ranae medicinal material method of inspection of DNA bar code technology is based on as claimed in claim 1, it is characterised in that
The base species of certified products Oviductus Ranae medicinal material are Rana temporaria chensinensis, the base species of the mixed adulterant of Oviductus Ranae at least include bufo gargarizans Cantor and
Rans amurensis.
6. the market Oviductus Ranae medicinal material method of inspection of DNA bar code technology is based on as claimed in claim 5, it is characterised in that
The step 4) in Rana temporaria chensinensis COI features bar code sequence as shown in SEQ ID No.1.
7. the commercially available Oviductus Ranae medicinal material method of inspection of DNA bar code technology is based on as claimed in claim 6, it is characterised in that
Step 4) described in sequence alignment shown in the COI bar code sequences and the SEQ ID No.1 that obtain, base difference is less than 2%,
Its base species is Rana temporaria chensinensis.
8. the commercially available Oviductus Ranae medicinal material method of inspection of DNA bar code technology is based on as claimed in claim 6, it is characterised in that
The COI features bar code sequence of bufo gargarizans Cantor as shown in SEQ ID No.4, shown in this feature sequence and SEQ ID No.1
Series difference is 21.9%.
9. the commercially available Oviductus Ranae medicinal material method of inspection of DNA bar code technology is based on as claimed in claim 6, it is characterised in that
The COI features bar code sequence of Rans amurensis as shown in SEQ ID No.5, shown in this feature sequence and SEQ ID No.1
Series difference is 12.6%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710007929.0A CN106682919B (en) | 2017-01-05 | 2017-01-05 | Method for inspecting commercial oviductus ranae medicinal materials based on DNA bar code technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710007929.0A CN106682919B (en) | 2017-01-05 | 2017-01-05 | Method for inspecting commercial oviductus ranae medicinal materials based on DNA bar code technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106682919A true CN106682919A (en) | 2017-05-17 |
| CN106682919B CN106682919B (en) | 2021-04-06 |
Family
ID=58850018
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710007929.0A Active CN106682919B (en) | 2017-01-05 | 2017-01-05 | Method for inspecting commercial oviductus ranae medicinal materials based on DNA bar code technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106682919B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111575389A (en) * | 2020-06-16 | 2020-08-25 | 吉林大学 | Method for identifying and quantifying authenticity of oviductus ranae based on mitochondrial IGS56 sequence |
| CN112725458A (en) * | 2019-10-28 | 2021-04-30 | 成都市食品药品检验研究院 | PCR kit and PCR method for identifying oviductus ranae |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102363817A (en) * | 2011-11-30 | 2012-02-29 | 辽宁医学院 | Method for identifying truth and false of bear bile powder by polymerase chain reaction |
| CN102586448A (en) * | 2012-03-06 | 2012-07-18 | 北华大学 | Deer antler capillary electrophoresis DNA (deoxyribonucleic acid) fingerprint spectrum and identification method |
| CN105256065A (en) * | 2015-11-27 | 2016-01-20 | 西南林业大学 | Method for detecting redried tobacco varietal complexity |
-
2017
- 2017-01-05 CN CN201710007929.0A patent/CN106682919B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102363817A (en) * | 2011-11-30 | 2012-02-29 | 辽宁医学院 | Method for identifying truth and false of bear bile powder by polymerase chain reaction |
| CN102586448A (en) * | 2012-03-06 | 2012-07-18 | 北华大学 | Deer antler capillary electrophoresis DNA (deoxyribonucleic acid) fingerprint spectrum and identification method |
| CN105256065A (en) * | 2015-11-27 | 2016-01-20 | 西南林业大学 | Method for detecting redried tobacco varietal complexity |
Non-Patent Citations (1)
| Title |
|---|
| 国家药典委员会: "《中华人民共和国药典》", 30 June 2015 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725458A (en) * | 2019-10-28 | 2021-04-30 | 成都市食品药品检验研究院 | PCR kit and PCR method for identifying oviductus ranae |
| CN111575389A (en) * | 2020-06-16 | 2020-08-25 | 吉林大学 | Method for identifying and quantifying authenticity of oviductus ranae based on mitochondrial IGS56 sequence |
| CN111575389B (en) * | 2020-06-16 | 2022-09-20 | 吉林大学 | Method for identifying and quantifying authenticity of oviductus ranae based on mitochondrial IGS56 sequence |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106682919B (en) | 2021-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110093455B (en) | Respiratory virus detection method | |
| CN104603267B (en) | Separation includes the method for the RNA of tiny RNA with high yield | |
| CN106834273A (en) | The method of seperated nuclear acid | |
| CN105420229B (en) | A kind of lysate and method of extraction ancient biological bone DNA | |
| US20240052396A1 (en) | Selective protection of nucleic acids | |
| CN104846101B (en) | A kind of special primer pair and method for identifying pseudo-ginseng | |
| CN106682919A (en) | Commercially available Ranae oviductus medicinal material inspection method based on DNA bar code technology | |
| CN111487404A (en) | Kit for extracting DNA of body fluid tumor cells | |
| CN102154264A (en) | Method for rapidly extracting total ribonucleic acid from blood | |
| CN106498050A (en) | A kind of Chinese patent drug living species constituent monitoring method based on SMRT sequencing technologies | |
| Liu et al. | The species identification in traditional herbal patent medicine, Wuhu San, based on shotgun metabarcoding | |
| CN101613758A (en) | Identify PCR method and the special primer thereof of long-nosed pit viper | |
| CN105695624B (en) | The method for quick identification in crude heparin sodium different genera source | |
| CN108251515A (en) | A kind of method for building FFPE sample DNAs library | |
| CN109750093A (en) | Identify or assisting in the method for identifying Radix Glycyrrhizae | |
| Majumdar et al. | A streamlined protocol for extracting RNA and genomic DNA from archived human blood and muscle | |
| CN104293772B (en) | The method of FNA material extraction genomic DNA and RNA | |
| CN105274245B (en) | A kind of method and its special primer pair for identifying David's-harp | |
| CN113684292A (en) | SSR molecular marker primer and method for identifying wild buckwheat in Guizhou region | |
| CN106350510B (en) | Method, kit and its application of rapidly extracting Oviductus Ranae genomic DNA | |
| CN102732634A (en) | Molecular identification method of authenticity and category of rhinoceros horn products | |
| CN107365766A (en) | Mechanical crushing method extraction mycotic spore RNA method | |
| US20170335312A1 (en) | Method for enriching microvesicles | |
| CN106755452B (en) | PCR amplification primer and amplification method for identifying oviductus ranae medicinal material DNA bar code | |
| CN109055352B (en) | Traditional Chinese medicine plant genome DNA extraction kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |