CN105695624B - The method for quick identification in crude heparin sodium different genera source - Google Patents
The method for quick identification in crude heparin sodium different genera source Download PDFInfo
- Publication number
- CN105695624B CN105695624B CN201610276657.XA CN201610276657A CN105695624B CN 105695624 B CN105695624 B CN 105695624B CN 201610276657 A CN201610276657 A CN 201610276657A CN 105695624 B CN105695624 B CN 105695624B
- Authority
- CN
- China
- Prior art keywords
- heparin sodium
- crude heparin
- centrifuge tube
- crude
- measured
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method for quick identification in crude heparin sodium different genera source, the following steps are included: a) crude heparin sodium to be measured is dissolved in the aqueous solution containing sodium chloride and ethyl alcohol, add biomagnetic beads, the total DNA in crude heparin sodium, b are extracted by paramagnetic particle method) design pig, sheep, calf-derived Cyclospora diagnostic primers；C) using crude heparin sodium total DNA to be measured as template, PCR amplification is carried out respectively using pig, sheep, calf-derived Cyclospora diagnostic primers；D) amplified production is subjected to agarose gel electrophoresis respectively, the Species origin of the crude heparin sodium to be measured is judged according to obtained specific band molecular size range.Discrimination method provided by the invention can effectively solve the problems, such as that heparin present in conventional method inhibits PCR, and greatly reduce cost, and method is concise, it is fast and convenient, it is reproducible, it is easy to operate, accuracy is high, suitable for promoting and applying in the identification of crude heparin sodium Species origin.
Description
Technical field
The present invention relates to medicament sources detection methods, and specifically a kind of crude heparin sodium different genera source is quick
Discrimination method.
Background technique
Heparin sodium is to stick polysaccharide sulfate substance to be widely used in thrombosis or bolt because it is with blood coagulation resisting function
The clinical treatment of plug property disease.Recent study proves that heparin sodium also has effect for reducing blood fat.Currently, heparin sodium main source
In the intestinal mucosa of pig, ox or sheep.But there is the risk infected by correlated virus in the heparin sodium of the ox source source Xing Heyang property, and lead
Pig endogenous heparin sodium will be far longer than by causing the probability of happening of the adverse reactions such as thrombopenia and thrombus syndrome.Therefore, exist
People should can select as far as possible pig endogenous heparin sodium in clinical use.However, due to production material source complexity etc. in actual production
There is a possibility that being polluted by the animal material in the sources such as ox, sheep in many-sided reason, the raw materials for production that frequently can lead to pig source.
Therefore, establish the discrimination methods of the animal derived components such as pig source, Yang Yuan, ox source to control drug quality, prevent heterogenous animal source
The pollution of property ingredient is most important.
Currently, the method for detecting the heparin sodium in different genera source in the prior art mainly has immunochemistry and detection of nucleic acids
Deng.Wherein the use of fluorescence quantifying PCR method detection of nucleic acids is relatively more extensive, and animal is specifically first extracted from crude heparin sodium
Nucleic acid is remained, then is detected using quantitative fluorescent PCR.Fluorescent quantitative PCR technique is examined in real time using the variation of fluorescence signal
The variation for surveying each cyclic amplification product amount in pcr amplification reaction, by the analysis of Ct value and standard curve to starting template
Carry out quantitative analysis.This detection method result is more accurate, but there are certain defect when this method detection heparin sodium, because
There is very strong inhibitory activity to PCR for heparin, so before needing heparin sodium sample to be carried out using heparinase before doing quantitative PCR
Processing, cumbersome, heparinase complicated for operation and quantitative reagent expense are high, this makes this method medium and small what is lacked qualified technical personnel
Enterprise's use receives great limitation.As it can be seen that the liver in the different genera source that research and development are at low cost, operation is convenient, accuracy is high
The discrimination method of plain sodium is the project tried to explore in industry.
Summary of the invention
The object of the present invention is to provide a kind of method for quick identification in crude heparin sodium different genera source, existing to solve
Detection method otherwise be unable to control heparin to the inhibition of later period PCR cause detection accuracy reduce or pre-treatment it is cumbersome
The problem of complexity, higher cost.
The purpose of the present invention is what is be achieved through the following technical solutions: the quick identification in crude heparin sodium different genera source
Method, comprising the following steps:
(a) crude heparin sodium to be measured is dissolved in solvent A, adds biomagnetic beads, crude product heparin is extracted by paramagnetic particle method
Total DNA in sodium obtains crude heparin sodium total DNA to be measured；The solvent A is that 2g sodium chloride and 10g second are dissolved in every 100mL water
The mixed solution of alcohol；The crude heparin sodium, solvent A, biomagnetic beads mass volume ratio be 30mg:1mL:30 μ L；
(b) pig, sheep, calf-derived Cyclospora diagnostic primers are designed to be respectively as follows:
Pig derived component diagnostic primers:
Upstream primer: ATCTACATGATTCATTACAATTAC,
Downstream primer: CTATGTTTTTGAGTTTTGAGTTCA；
Sheep derived material diagnostic primers:
Upstream primer: ACACAACTTCTACCACAACCC,
Downstream primer: AAACAATGAGGGTAACGAGGG；
Calf-derived Cyclospora diagnostic primers:
Upstream primer: GCCATATACTCTCCTTGGTGACA,
Downstream primer: GTAGGCTTGGGAATAGTACGA；
(c) using crude heparin sodium total DNA to be measured obtained by step (a) as DNA profiling, the pig designed using step (b),
Sheep, calf-derived Cyclospora diagnostic primers carry out PCR amplification, amplification system respectively are as follows: 3 μ L of DNA profiling, 1 μ L of upstream primer, under
1 μ L of primer, 2 times of 25 μ L of PCR reagent premixed liquid are swum, ddH is used2O polishing is to 50 μ L；
PCR response procedures are as follows: the initial denaturation 5min at 95 DEG C；15s is denaturalized at 95 DEG C；Anneal 30s at 63 DEG C；72
Extend 30s at DEG C；Times of thermal cycle is 40 times；Obtain amplified production；
(d) amplified production is subjected to agarose gel electrophoresis respectively, has such as obtained the spy that molecular size range is 150bp
Anisotropic band then shows to contain pig endogenous heparin sodium ingredient in the crude heparin sodium to be measured；Such as obtaining molecular size range is
The specific band of 145bp then shows to contain sheep endogenous heparin sodium ingredient in the crude heparin sodium to be measured；Such as obtain molecular weight
Size is the specific band of 271bp, then shows to contain ox endogenous heparin sodium ingredient in the crude heparin sodium to be measured.
Biomagnetic beads described in step (a) of the present invention refer to magnetic bead MG101, are TIANGEN Biotech (Beijing) Co., Ltd.
Commercial product.The biomagnetic beads are the magnetic beads for referring to adsorption of DNA, by special process to the surface of magnetic nanoparticle into
Row modification, has very strong affinity to nucleic acid under certain condition, and when conditions change, the nucleic acid of magnetic bead release absorption,
It can achieve the purpose that fast separating and purifying nucleic acid.
Comprising the concrete steps that for total DNA in crude heparin sodium is extracted by paramagnetic particle method described in step (a) of the present invention: 1. will
The crude heparin sodium solution to be measured that biomagnetic beads are added, which is placed in centrifuge tube, vibrates 10s, is placed in incubation at room temperature 10min, during which every
It is vibrated every 3min and mixes 10s；2. centrifuge tube is placed on magnetic frame and stands 1min, liquid is removed when magnetic bead adsorbs completely；
3. centrifuge tube is removed from magnetic frame, the rinsing liquid A of 6 times of biomagnetic beads volumes is added, oscillation mixes 1min；4. will be from
Heart pipe, which is placed on magnetic frame, stands 1 min, after magnetic bead adsorbs completely, removes liquid；5. centrifuge tube is taken from magnetic frame
Under, the rinsing liquid B of 6 times of biomagnetic beads volumes is added, oscillation mixes 1 min；6. centrifuge tube is placed on magnetic frame
1 min is stood, after magnetic bead adsorbs completely, removes liquid；7. repeat step 5.-it is 6. primary；8. centrifuge tube is placed in magnetic force again
On frame, 56 DEG C are dried 5-10 min；9. centrifuge tube is removed from magnetic frame, the ddH of 20 μ L is added2O, 56 DEG C of oscillations mix 5
min；10. centrifuge tube is placed on magnetic frame and stands 2 min, after magnetic bead adsorbs completely, obtained DNA is transferred to one
In new centrifuge tube；The rinsing liquid A is the PEG of the NaCl and 200g in every 1L water dissolved with LiCl, 0.5mol of 0.8mol,
Its pH value is 7.0；The rinsing liquid B is the ethyl alcohol that mass percent concentration is 80%.
2 times of PCR reagent premixed liquids described in step (d) of the present invention refer to: Tris-HCl(pH value is 8.3) 20mmol/
L、dNTP 0.4mmol/L、 KCl 100mmol/L、MgCl23mmol/L, taq enzyme 0.05U/mL, solvent ddH2O。
Amplified production described in step (d) of the present invention carries out agarose gel electrophoresis respectively specifically comprises the processes of: takes 20 μ L
2 μ L of sample-loading buffer is added in the amplified production, use mass percent concentration for 1% agarose gel electrophoresis, voltage
100V, electrophoresis 20min.Sample-loading buffer refers to the bromjophenol blue, 0.25g that EDTA, 0.25g of 0.01mol are dissolved in 1L water
The mixed solution of the glycerol of dimethylbenzene cyanogen and 50g.
The present invention from crude heparin sodium by extracting total DNA, design specific primer, pcr amplification reaction and electrophoresis
The series of steps such as data analysis accurately have detected the different genera source of crude heparin sodium, while it is thick also quickly to authenticated this
Whether product heparin sodium is the product for being contaminated with sheep source property or calf-derived Cyclospora, this checks on for medication purchasing and clinical medical provides
Reliable inspection result.Special innovation of the invention is to sample to be tested total DNA using specific magnetic bead extraction method,
This method solves the problems, such as that heparin present in conventional method inhibits PCR, and greatly reduces cost, method letter
Clean to be illustrated, fast and convenient, reproducible, easy to operate, accuracy is high, suitable for promoting and applying in identification heparin crude product quality.
Detailed description of the invention
Fig. 1 be identify pig, sheep, ox source property crude heparin sodium electrophorogram.1 is molecular weight standard in figure；2. being Niu Yuan
Property ingredient negative control；3 be 1000 pg/ μ L calf-derived Cyclospora amplified production specific bands；4 be 10000 pg/ μ L pig source property
Ingredient amplified production specific band；5 be 1000 pg/ μ L pig derived component amplified production specific bands；, 6 be 100 pg/ μ
L pig derived component amplified production specific band；7 be pig derived component negative control；8 be sheep derived material negative control；9 are
10000 pg/ μ L sheep derived material amplified production specific bands；10 be 1000pg/ μ L sheep derived material amplified production specificity
Band；11 be 100 pg/ μ L sheep derived material amplified production specific bands.
Fig. 2 is to identify the electrophorogram for mixing sheep derived material in pig source property crude heparin sodium.1 is molecular weight mark in figure
Standard, 2 be the electrophoretic band that product contains the sheep endogenous heparin sodium that mass percent is 10%；3 be that product contains mass percent and is
The electrophoretic band of 1% sheep endogenous heparin sodium；4 be the electrophoresis strip that product contains the sheep endogenous heparin sodium that mass percent is 0.1%
Band；5 be negative control.
Fig. 3 is the present invention and total DNA quantity electrophorogram in comparative example extraction crude heparin sodium.1 is molecular weight mark in figure
Standard, 2 be sample A electrophoretic band, and 3 be sample B electrophoretic band.
Specific embodiment
Following example is for present invention be described in more detail, but embodiment does not do any type of limit to the present invention
It is fixed.Unless stated otherwise, the present invention uses reagent, method and apparatus is the art conventional reagents, method and apparatus.But
The invention is not limited in any way.
The heretofore described biomagnetic beads used come from the commercially available magnetic bead of TIANGEN Biotech (Beijing) Co., Ltd.
MG101。
The detection of 1 pig source property crude heparin sodium sample of embodiment
(1) total DNA of pig source property crude heparin sodium is extracted:It weighs pig source property crude heparin sodium 30mg and is dissolved in the molten of lmL
(it is dissolved with the mixed solution of 2g NaCl and 10g ethyl alcohol in 100mL water) in agent A, is placed in centrifuge tube；Into sample solution
30 μ L biomagnetic beads, lid upper tube cap are added, oscillation mixes 10 s；10 min are incubated at room temperature, during which every 3 min turns upside down mixed
Even 10 s, combines magnetic bead and nucleic acid sufficiently, and the liquid for being attached to tube wall and pipe lid is collected by centrifugation；Centrifuge tube is placed in magnetic
1 min is stood on power frame, when magnetic bead adsorbs completely, carefully sucks liquid；Centrifuge tube is removed from magnetic frame, is added
500 μ L rinsing liquid A(rinsing liquid A are the mixed of the PEG of the NaCl and 200g of LiCl, 0.5mol in 1L water dissolved with 0.8mol
Close solution, pH 7.0), oscillation mixes 1 min；Centrifuge tube is placed on magnetic frame and stands 1 min, magnetic bead adsorbs completely
Afterwards, liquid is carefully sucked；Centrifuge tube is removed from magnetic frame, 500 μ L rinsing liquid B(rinsing liquid B of addition are quality percentage
The ethyl alcohol that specific concentration is 80%), oscillation mixes 1 min；Centrifuge tube is placed on magnetic frame and stands 1 min, magnetic bead is inhaled completely
It is attached, carefully suck liquid；Repeat step-Once；For centrifuge tube on magnetic frame, 56 DEG C are dried 10 min；It will be from
Heart pipe is removed from magnetic frame, and the TE buffer of 20 μ L is added, and 56 DEG C of oscillations mix 5 min；Centrifuge tube is placed in magnetic force
2 min are stood on frame, after magnetic bead adsorbs completely, carefully obtained DNA are transferred in a new centrifuge tube, obtains crude product heparin
Sodium total DNA；
(2), dilute: it is 10000 pg/ that the crude heparin sodium total DNA that step (1) obtains, which is diluted to concentration with purified water,
The DNA profiling of mL, 1000 pg/mL, 100 pg/mL；
(3) PCR amplification:
1. configuring PCR system, 50 μ L reaction systems are as follows:
3 μ L of DNA profiling
1 μ L of upstream primer
1 μ L of downstream primer
2 times of 25 μ L of PCR reagent premixed liquid
ddH2O polishing is to 50 μ L；
Upstream primer and downstream primer in above-mentioned reaction system use pig derived component diagnostic primers:
Upstream primer: ATCTACATGATTCATTACAATTAC,
Downstream primer: CTATGTTTTTGAGTTTTGAGTTCA；
The configuration method of 2 times of PCR reagent premixed liquids is: the Tris-HCl for being 8.3 dissolved with pH value in 1L ultrapure water
20mmol、dNTP 0.4mmol、KCl 100mmol、MgCl2 3mmol, taq enzyme 50U.
Using purified water substitution DNA profiling as negative control；
2. PCR response procedures are as follows: 1. initial denaturation 5 minutes at 95 DEG C；2. being denaturalized 15 seconds at 95 DEG C；3. at 63 DEG C
Annealing 30 seconds；4. extending 30 seconds at 72 DEG C；Times of thermal cycle is 40 times；
PCR amplification is carried out for above three various concentration DNA profiling and negative control sample, obtains amplified production；
(4) Ago-Gel detects
Take the 20 μ L of amplified production of above-mentioned PCR that sample-loading buffer (0.01M EDTA, 0.25% bromjophenol blue, 0.25% is added
Dimethylbenzene cyanogen, 50% glycerol) 2 μ L, the Ago-Gel TAE electrophoresis for being 1% in mass percent concentration, voltage 100V, electrophoresis
20min, EB are dyed, and are observed under ultraviolet lamp, the result is shown in Figure 1.It can be seen that method provided by the invention can detecte in figure
Contain pig endogenous heparin sodium ingredient in the sample, specific band molecular size range is 150bp.
The detection of 2 sheep source property crude heparin sodium sample of embodiment
(1) total DNA of sheep source property crude heparin sodium is extracted:It weighs sheep source property crude heparin sodium 30mg and is dissolved in the molten of lmL
(it is dissolved with the mixed solution of 2g NaCl and 10g ethyl alcohol in 100mL water) in agent A, is placed in centrifuge tube；Into sample solution
30 μ L biomagnetic beads, lid upper tube cap are added, oscillation mixes 10 s；10 min are incubated at room temperature, during which every 3 min turns upside down mixed
Even 10 s, combines magnetic bead and nucleic acid sufficiently, and brief centrifugation collects the liquid for being attached to tube wall and pipe lid；Centrifuge tube is placed
In standing 1 min on magnetic frame, when magnetic bead adsorbs completely, liquid is carefully sucked；Centrifuge tube is removed from magnetic frame, is added
Enter the PEG's of NaCl and 200g that 500 μ L rinsing liquid A(rinsing liquid A are LiCl, 0.5mol in 1L water dissolved with 0.8mol
Mixed solution, pH 7.0), oscillation mixes 1 min；Centrifuge tube is placed on magnetic frame and stands 1 min, magnetic bead adsorbs completely
Afterwards, liquid is carefully sucked；Centrifuge tube is removed from magnetic frame, 500 μ L rinsing liquid B(rinsing liquid B of addition are quality percentage
The ethyl alcohol that specific concentration is 80%), oscillation mixes 1 min；Centrifuge tube is placed on magnetic frame and stands 1 min, magnetic bead is inhaled completely
It is attached, carefully suck liquid；Repeat step-Once；For centrifuge tube on magnetic frame, 56 DEG C are dried 10 min；It will be from
Heart pipe is removed from magnetic frame, and the TE buffer of 20 μ L is added, and 56 DEG C of oscillations mix 5 min；Centrifuge tube is placed in magnetic force
2 min are stood on frame, after magnetic bead adsorbs completely, carefully obtained DNA are transferred in a new centrifuge tube, obtains crude product heparin
The total DNA of sodium；
(2), dilute: it is 10000 that the total DNA for the crude heparin sodium that step (1) obtains, which is diluted to concentration with purified water,
The DNA profiling of pg/mL, 1000 pg/mL, 100 pg/mL；
(3) PCR amplification:
1. configuring PCR system, 50 μ L reaction systems are as follows:
3 μ L of DNA profiling
1 μ L of upstream primer
1 μ L of downstream primer
2 times of 25 μ L of PCR reagent premixed liquid
ddH2O polishing is to 50 μ L；
Upstream primer and downstream primer in above-mentioned reaction system use sheep derived material diagnostic primers:
Upstream primer ACACAACTTCTACCACAACCC
Downstream primer AAACAATGAGGGTAACGAGGG
2 times of PCR reagent premixed liquids are as follows: Tris-HCl(pH8.3) 20mmol/L, dNTP 0.4mmol/L, KCl
100mmol/L、MgCl23mmol/L, taq enzyme 0.05U/ μ L；
Using purified water substitution DNA profiling as negative control；
2. PCR response procedures are as follows: 1. initial denaturation 5 minutes at 95 DEG C；2. being denaturalized 15 seconds at 95 DEG C；3. at 63 DEG C
Annealing 30 seconds；4. extending 30 seconds at 72 DEG C；Times of thermal cycle is 40 times；
PCR amplification is carried out for above three various concentration DNA profiling and negative control sample, obtains amplified production；
(4) Ago-Gel detects
Take above-mentioned PCR 20 μ L of amplified production be added sample-loading buffer (0.01mol/L EDTA, 0.25% bromjophenol blue,
0.25% dimethylbenzene cyanogen, 50% glycerol) 2 μ L, the Ago-Gel TAE electrophoresis for being 1% in mass percent concentration, voltage 100V,
Electrophoresis 20min, EB dyeing are observed under ultraviolet lamp, and the result is shown in Figure 1.It can be seen that method provided by the invention can be examined in figure
It measures containing sheep endogenous heparin sodium ingredient in the sample, specific band molecular size range is 145bp.
The detection of 3 Ns of source property crude heparin sodium samples of embodiment
(1) total DNA of ox source property crude heparin sodium is extracted:It weighs ox source property crude heparin sodium 30mg and is dissolved in the molten of lmL
(it is dissolved with the mixed solution of 2g NaCl and 10g ethyl alcohol in 100mL water) in agent A, is placed in centrifuge tube；Into sample solution
30 μ L biomagnetic beads, lid upper tube cap are added, oscillation mixes 10 s；10 min are incubated at room temperature, during which every 3 min turns upside down mixed
Even 10 s, combines magnetic bead and nucleic acid sufficiently, and brief centrifugation collects the liquid for being attached to tube wall and pipe lid；Centrifuge tube is placed
In standing 1 min on magnetic frame, when magnetic bead adsorbs completely, liquid is carefully sucked；Centrifuge tube is removed from magnetic frame, is added
Enter the PEG's of NaCl and 200g that 500 μ L rinsing liquid A(rinsing liquid A are LiCl, 0.5mol in 1L water dissolved with 0.8mol
Mixed solution, pH 7.0), oscillation mixes 1 min；Centrifuge tube is placed on magnetic frame and stands 1 min, magnetic bead adsorbs completely
Afterwards, liquid is carefully sucked；Centrifuge tube is removed from magnetic frame, 500 μ L rinsing liquid B(rinsing liquid B of addition are quality percentage
The ethyl alcohol that specific concentration is 80%), oscillation mixes 1 min；Centrifuge tube is placed on magnetic frame and stands 1 min, magnetic bead is inhaled completely
It is attached, carefully suck liquid；Repeat step-Once；For centrifuge tube on magnetic frame, 56 DEG C are dried 10 min；It will be from
Heart pipe is removed from magnetic frame, and the TE buffer of 20 μ L is added, and 56 DEG C of oscillations mix 5 min；Centrifuge tube is placed in magnetic force
2 min are stood on frame, after magnetic bead adsorbs completely, carefully obtained DNA are transferred in a new centrifuge tube, obtains crude product heparin
The total DNA of sodium；
(2), dilute: it is 10000 that the total DNA for the crude heparin sodium that step (1) obtains, which is diluted to concentration with purified water,
The DNA profiling of pg/mL, 1000 pg/mL, 100 pg/mL；
(3) PCR amplification:
1. configuring PCR system, 50 μ L reaction systems are as follows:
3 μ L of DNA profiling
1 μ L of upstream primer
1 μ L of downstream primer
2 times of 25 μ L of PCR reagent premixed liquid
ddH2O polishing is to 50 μ L；
Upstream primer and downstream primer in above-mentioned reaction system use calf-derived Cyclospora diagnostic primers:
Upstream primer: GCCATATACTCTCCTTGGTGACA
Downstream primer: GTAGGCTTGGGAATAGTACGA
2 times of PCR reagent premixed liquids are as follows: Tris-HCl(pH8.3) 20mmol/L, dNTP 0.4mmol/L, KCl
100mmol/L、MgCl23mmol/L, taq enzyme 0.05U/ μ l；
Using purified water substitution DNA profiling as negative control；
2. PCR response procedures are as follows: 1. initial denaturation 5 minutes at 95 DEG C；2. being denaturalized 15 seconds at 95 DEG C；3. at 63 DEG C
Annealing 30 seconds；4. extending 30 seconds at 72 DEG C；Times of thermal cycle is 40 times；
PCR amplification is carried out for above three various concentration DNA profiling and negative control sample, obtains amplified production；
(4) Ago-Gel detects
Take the 20 μ L of amplified production of above-mentioned PCR that sample-loading buffer (0.01M EDTA, 0.25% bromjophenol blue, 0.25% is added
Dimethylbenzene cyanogen, 50% glycerol) 2 μ L, the Ago-Gel TAE electrophoresis for being 1% in mass percent concentration, voltage 100V, electrophoresis
20min, EB are dyed, and are observed under ultraviolet lamp, the result is shown in Figure 1, it can be seen that method provided by the invention can detecte the sample
Contain ox endogenous heparin sodium ingredient in product, specific band molecular size range is 271bp.
Embodiment 4 identifies in pig originality crude heparin sodium whether mixed sheep derived material
(1) mix sample preparation: 50 mg of crude heparin sodium of sheep source property and 450 mg of crude heparin sodium of pig source property are mixed
It closes, obtains the mixing sample containing 10% sheep source heparin sodium；By 50 mg of mixing sample and pig source property containing 10% sheep endogenous heparin sodium
450 mg of crude heparin sodium mixing, obtain the mixing sample containing 1% sheep endogenous heparin sodium；It will be mixed containing 1% sheep endogenous heparin sodium
It closes 50 mg of sample to mix with 450 mg of crude heparin sodium of pig source property, obtains the pig source property crude product liver containing 0.1% sheep derived material
Plain sodium mixing sample；It needs to stir when mixing, particulate material need to be pressed into powder；
(2) that extracts three concentration respectively mixes total DNA in sample:Weigh respectively step (1) preparation containing 10%,
1%, the pig source property crude heparin sodium mixing sample 30mg of 0.1% sheep derived material is respectively dissolved in the solvent A of lmL (in 100mL water
Mixed solution dissolved with 2g NaCl and 10g ethyl alcohol), it is placed in centrifuge tube；30 μ L biologies are added into sample solution respectively
Magnetic bead, lid upper tube cap, oscillation mix 10 s；It is incubated at room temperature 10 min respectively, during which every 3 min, which turns upside down, mixes 10 s,
Combine magnetic bead and nucleic acid sufficiently, brief centrifugation 1-2s is attached to the liquid of tube wall and pipe lid to collect；Respectively by centrifuge tube
It is placed on magnetic frame and stands 1 min, when magnetic bead adsorbs completely, carefully remove liquid；Respectively by centrifuge tube from magnetic frame
On remove, be added 500 μ L rinsing liquid A(rinsing liquid A be 1L water in dissolved with 0.8mol LiCl, 0.5mol NaCl and
The mixed solution of the PEG of 200g, pH 7.0), oscillation mixes 1 min；Centrifuge tube is placed on magnetic frame respectively and stands 1
Min carefully sucks liquid after magnetic bead adsorbs completely；Centrifuge tube is removed from magnetic frame respectively, 500 μ L rinsing liquids are added
B(rinsing liquid B is the ethyl alcohol that mass percent concentration is 80%), oscillation mixes 1 min；Centrifuge tube is placed in magnetic force respectively
1 min is stood on frame carefully sucks liquid after magnetic bead adsorbs completely；It respectively repeats steps-Once；It respectively will centrifugation
For pipe on magnetic frame, 56 DEG C are dried 10 min；Centrifuge tube is removed from magnetic frame respectively, the TE buffer of 20 μ L is added
(EDTA of the Tris-HCl and 1mmol/L of 10mmol/L, pH value 8.0), 56 DEG C of oscillations mix 5 min；It respectively will centrifugation
Pipe, which is placed on magnetic frame, stands 2 min, and after magnetic bead adsorbs completely, nucleic acid solution is carefully transferred to a new centrifuge tube
In, the total DNA of three parts of crude heparin sodiums is obtained, the DNA profiling as next step amplification；
(3) PCR amplification:
1. configuring PCR system, 50 μ L reaction systems are as follows:
3 μ L of DNA profiling
1 μ L of upstream primer
1 μ L of downstream primer
2 times of 25 μ L of PCR reagent premixed liquid
ddH2O polishing is to 50 μ L；
Upstream primer and downstream primer in above-mentioned reaction system use sheep derived material diagnostic primers:
Upstream primer ACACAACTTCTACCACAACCC
Downstream primer AAACAATGAGGGTAACGAGGG
2 times of PCR reagent premixed liquids are as follows: Tris-HCl(pH8.3) 20mmol/L, dNTP 0.4mmol/L, KCl
100mmol/L、MgCl23mmol/L, taq enzyme 0.05U/ μ l；
Using purified water substitution DNA profiling as negative control；
2. PCR response procedures are as follows: 1. initial denaturation 5 minutes at 95 DEG C；2. being denaturalized 15 seconds at 95 DEG C；3. being moved back at 63 DEG C
Fire 30 seconds；4. extending 30 seconds at 72 DEG C；Times of thermal cycle is 40 times；
PCR amplification is carried out for above three various concentration DNA profiling and negative control sample, obtains amplified production；
(4) Ago-Gel detects
Take the 20 μ L of amplified production of above-mentioned PCR that sample-loading buffer (0.01M EDTA, 0.25% bromjophenol blue, 0.25% is added
Dimethylbenzene cyanogen, 50% glycerol) 2 μ L, the Ago-Gel TAE electrophoresis for being 1% in mass percent concentration, voltage 100V, electrophoresis
20min, EB are dyed, and are observed under ultraviolet lamp, the result is shown in Fig. 2.It can be seen that its specific band molecular size range is in figure
145bp illustrates to be mixed with sheep endogenous heparin sodium in the crude heparin sodium, and is even if being only mixed with mass percent concentration in product
0.1% sheep endogenous heparin sodium can also be by method Accurate Determining provided by the invention and identification.
Compared with 5 present invention of embodiment extracts the accuracy of the total DNA of crude heparin sodium with comparative example
(1) it weighs pig source property crude heparin sodium 300mg and is dissolved in the solvent A of lmL and (contain 2g NaCl and 10g in 100mL
The aqueous solution of ethyl alcohol), obtain sample A；It weighs pig source property crude heparin sodium 30mg simultaneously to be dissolved in lmL pure water, obtains sample B；Respectively
It is placed in two centrifuge tubes, synchronizes perform the following operation respectively；
(2) 30 μ L biomagnetic beads, lid upper tube cap are added into sample A and sample B respectively, oscillation mixes 10 s；
(3) it is incubated at room temperature 10 min respectively, during which every 3 min, which turns upside down, mixes 10 s, ties magnetic bead and nucleic acid sufficiently
It closes, brief centrifugation collects the liquid for being attached to tube wall and pipe lid；
(4) centrifuge tube is placed on magnetic frame and stands 1 min, when magnetic bead adsorbs completely, carefully remove liquid；
(5) centrifuge tube is removed from magnetic frame, it is to be dissolved in 1L water that 500 μ L rinsing liquid A(rinsing liquid A, which are added,
The mixed solution of the PEG of the NaCl and 200g of LiCl, 0.5mol of 0.8mol, pH 7.0), oscillation mixes 1 min；
(6) centrifuge tube is placed on magnetic frame and stands 1 min after magnetic bead adsorbs completely and carefully sucks liquid；
(7) centrifuge tube is removed from magnetic frame, it is that mass percent concentration is that 500 μ L rinsing liquid B(rinsing liquid B, which are added,
80% ethyl alcohol), oscillation mixes 1 min；
(8) centrifuge tube is placed on magnetic frame and stands 1 min after magnetic bead adsorbs completely and carefully sucks liquid；
(9) it is primary that step (7)-(8) are repeated；
(10) for centrifuge tube on magnetic frame, 56 DEG C are dried 10 min；
(11) centrifuge tube is removed from magnetic frame, be added 20 μ L TE solution (Tris-HCl of 10mmol/L and
The EDTA of 1mmol/L, pH value 8.0), 56 DEG C of oscillations mix 5 min；
(12) centrifuge tube is placed on magnetic frame and stands 2 min, after magnetic bead adsorbs completely, the nucleic acid that will carefully obtain
Solution is transferred to respectively in a new centrifuge tube, obtains the total DNA of crude heparin sodium；
(13) it respectively takes 20 μ L to carry out gel electrophoresis the total DNA of the obtained crude heparin sodium of sample A and sample B, as a result sees
Fig. 3.As can be seen from Figure 3 by crude heparin sodium be dissolved in the special solvent of the present invention (ethyl alcohol of 2% NaCl and 10% it is water-soluble
Liquid) in sample A its DNA for finally extracting be significantly more than the sample B for being dissolved only in water.And it is measured by ultraviolet specrophotometer
The shading value of DNA260nm, with OD260It is equivalent to the DNA of 50 μ g/mL, the concentration that sample A obtains total DNA is about 0.8 μ g/ μ L,
The concentration that sample B obtains total DNA is about 0.2 μ g/ μ L.As it can be seen that being extracted in crude heparin sodium using in method provided by the invention
The quantity for the DNA that total DNA step obtains is apparently higher than the DNA quantity of check sample B, and crude product is first dissolved in solvent by the present invention
Heparin is avoided in A to the inhibiting effect of PCR, illustrates to extract crude heparin sodium tool to be measured using method provided by the invention with this
There is higher detection sensitivity, can be used for being contaminated with the accurate mirror of other micro origin components' products in the property crude heparin sodium of pig source
Not.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by the embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
Claims (5)
1. a kind of method for quick identification in crude heparin sodium different genera source, which comprises the following steps:
(a) crude heparin sodium to be measured is dissolved in solvent A, adds biomagnetic beads, extracted in crude heparin sodium by paramagnetic particle method
Total DNA, obtain crude heparin sodium total DNA to be measured；The solvent A is in every 100mL water dissolved with 2g sodium chloride and 10g ethyl alcohol；Institute
State crude heparin sodium, solvent A, biomagnetic beads mass volume ratio be 30mg:1mL:30 μ L；
(b) pig, sheep, calf-derived Cyclospora diagnostic primers are designed to be respectively as follows:
Pig derived component diagnostic primers:
Upstream primer: ATCTACATGATTCATTACAATTAC,
Downstream primer: CTATGTTTTTGAGTTTTGAGTTCA；
Sheep derived material diagnostic primers:
Upstream primer: ACACAACTTCTACCACAACCC,
Downstream primer: AAACAATGAGGGTAACGAGGG；
Calf-derived Cyclospora diagnostic primers:
Upstream primer: GCCATATACTCTCCTTGGTGACA,
Downstream primer: GTAGGCTTGGGAATAGTACGA；
(c) using crude heparin sodium total DNA to be measured obtained by step (a) as DNA profiling, using the pig of step (b) design, sheep, ox
Derived component diagnostic primers carry out PCR amplification, amplification system respectively are as follows: 3 μ L of DNA profiling, 1 μ L of upstream primer, downstream primer
1 μ L, 2 times of 25 μ L of concentration PCR reagent premixed liquid, use ddH2O polishing is to 50 μ L；
PCR response procedures are as follows: the initial denaturation 5min at 95 DEG C；15s is denaturalized at 95 DEG C；Anneal 30s at 63 DEG C；At 72 DEG C
Extend 30s；Thermal cycle 40 times；Obtain amplified production；
(d) amplified production is subjected to agarose gel electrophoresis respectively, has such as obtained the specificity that molecular size range is 150bp
Band then shows to contain pig endogenous heparin sodium ingredient in the crude heparin sodium to be measured；As obtained molecular size range for 145bp
Specific band then shows to contain sheep endogenous heparin sodium ingredient in the crude heparin sodium to be measured；Such as obtaining molecular size range is
The specific band of 271bp then shows to contain ox endogenous heparin sodium ingredient in the crude heparin sodium to be measured.
2. the method for quick identification in crude heparin sodium different genera according to claim 1 source, which is characterized in that step
(a) the to be measured of biomagnetic beads 1. the comprising the concrete steps that by the total DNA in paramagnetic particle method extraction crude heparin sodium described in: will be added
Crude heparin sodium solution, which is placed in centrifuge tube, vibrates 10s, is placed in incubation at room temperature 10min, oscillation；2. centrifuge tube is placed in magnetic force
1min is stood on frame, removes liquid；3. centrifuge tube is removed from magnetic frame, the rinsing liquid A of 6 times of biomagnetic beads volumes is added,
Oscillation mixes 1min；4. centrifuge tube is placed on magnetic frame and stands 1min, liquid is removed；5. centrifuge tube is taken from magnetic frame
Under, the rinsing liquid B of 6 times of biomagnetic beads volumes is added, oscillation mixes 1 min；6. centrifuge tube is placed on magnetic frame and stands 1
Min after magnetic bead adsorbs completely, removes liquid；7. repeat step 5.-it is 6. primary；8. centrifuge tube is placed on magnetic frame again, 56
DEG C dry 5-10 min；9. centrifuge tube is removed from magnetic frame, the TE buffer of 20 μ L is added, 56 DEG C of oscillations mix 5 min；
10. centrifuge tube is placed on magnetic frame and stands 2min, after magnetic bead adsorbs completely, isolated DNA is crude product liver to be measured
Plain sodium total DNA.
3. the method for quick identification in crude heparin sodium different genera according to claim 2 source, which is characterized in that described
Rinsing liquid A is the PEG of the NaCl and 200g in every 1L water dissolved with LiCl, 0.5mol of 0.8mol, pH value 7.0；The drift
Washing lotion B is the ethyl alcohol that mass percent concentration is 80%.
4. the method for quick identification in crude heparin sodium different genera according to claim 1 source, which is characterized in that step
(c) 2 times of concentration PCR reagent premixed liquids described in refer to: Tris-HCl 20mmol/L, dNTP 0.4mmol/L, KCl
100mmol/L、MgCl23mmol/L, taq enzyme 0.05U/ μ L.
5. the method for quick identification in crude heparin sodium different genera according to claim 1 source, which is characterized in that step
(d) amplified production described in carries out agarose gel electrophoresis respectively specifically comprises the processes of: amplified production described in 20 μ L is taken to be added
2 μ L of sample buffer, use mass percent concentration for 1% agarose gel electrophoresis, voltage 100V, electrophoresis 20min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610276657.XA CN105695624B (en) | 2016-04-29 | 2016-04-29 | The method for quick identification in crude heparin sodium different genera source |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610276657.XA CN105695624B (en) | 2016-04-29 | 2016-04-29 | The method for quick identification in crude heparin sodium different genera source |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105695624A CN105695624A (en) | 2016-06-22 |
| CN105695624B true CN105695624B (en) | 2019-04-23 |
Family
ID=56217883
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610276657.XA Active CN105695624B (en) | 2016-04-29 | 2016-04-29 | The method for quick identification in crude heparin sodium different genera source |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105695624B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106442353A (en) * | 2016-09-26 | 2017-02-22 | 南通科技职业学院 | Detection method of pig heparin sodium crude product mixed with ruminant source |
| EP3399034B1 (en) * | 2017-05-05 | 2022-12-28 | Siemens Healthcare Diagnostics Inc. | Device for extracting nucleic acids from biological sample materials with solvent-free reagents |
| CN109371105B (en) * | 2018-12-06 | 2022-04-05 | 南通麦杰生物科技有限公司 | Method for extracting genome DNA from heparin sodium sample |
| CN112080553A (en) * | 2019-06-13 | 2020-12-15 | 苏州融析生物科技有限公司 | qPCR detection method for sheep and pig gene content in crude sheep heparin sodium |
-
2016
- 2016-04-29 CN CN201610276657.XA patent/CN105695624B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| 常规PCR 法快速鉴别不同种属来源的粗品肝素钠;陈川等;《中国生物制品学杂志》;20140530;第27卷(第5期);摘要、表1/2、结果部分 |
| 肝素钠中猪、牛及羊源性成分的PCR检测;王自强等;《中国药师》;20151231;第18卷(第9期);摘要、第1507页 |
| 肝素钠提取原料中牛羊源成分的分子检测方法;向海等;《第十三次全国畜禽遗传标记研讨会论文集 》;20120818;全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105695624A (en) | 2016-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Detection of exosomes by ZnO nanowires coated three-dimensional scaffold chip device | |
| CN105695624B (en) | The method for quick identification in crude heparin sodium different genera source | |
| CN108411036A (en) | A kind of quickly detection first, influenza B virus kit for detecting nucleic acid and method | |
| CN102533724B (en) | A kind of cell cracking agent for biological sample amplifying nucleic acid extraction purification | |
| CN103572378B (en) | Based on Ion Proton tMthe construction process of the small segment DNA library of order-checking platform and application thereof | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN105420403A (en) | Real-time fluorescence quantification PCR method with magnetic bead nucleic acid extraction and amplification conducted in one tube | |
| Akarapipad et al. | Smartphone-based sensitive detection of SARS-CoV-2 from saline gargle samples via flow profile analysis on a paper microfluidic chip | |
| CN106755584B (en) | A kind of ebb virus's detection kit and detection method | |
| CN102839169B (en) | Kits for extracting enterovirus RNA and corresponding method for extracting and purifying enterovirus RNA | |
| CN104830996B (en) | A kind of influenza virus detection pre-treating method based on antibody magnetic capture | |
| CN103642942A (en) | High-precision nucleic acid quantitative detection kit for hepatitis C virus (HCV) | |
| CN104846122A (en) | Nucleic acid detection kit of enterovirus type 71 (EV71) and coxsackievirus type A16 (CA16) (fluorescent polymerase chain reaction (PCR) method) | |
| CN103710338A (en) | Kit for extracting DNA (deoxyribonucleic acid) from white cells in human whole blood | |
| CN110218819A (en) | A kind of high-throughput micro-fluidic chip and detection method detecting porcine respiratory epidemic disease cause of disease | |
| CN107058628A (en) | A kind of LAMP primer composition thing and its related application for being used to detect the related pathogen of hand-foot-and-mouth disease | |
| US11535902B2 (en) | RNA separation and related techniques for determining viruses such as coronaviruses | |
| Goodell et al. | Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time reverse-transcription polymerase chain reaction and virus isolation | |
| Yu et al. | Nanoparticle based bio-bar code technology for trace analysis of aflatoxin B1 in Chinese herbs | |
| CN101570798B (en) | Detection kit and detection method for 3 species of food-borne viruses in marine products | |
| CN104212914B (en) | The heavy quick super quick detection kit of fluorescent PCR of Ebola five and application thereof | |
| CN105420411A (en) | Nucleic acid fluorescence PCR detection kit for universal enterovirus, coxsackievirus A16 and enterovirus 71 | |
| JP2011038903A (en) | Specimen pretreatment reagent containing water-soluble ammonium polymer, and specimen pretreatment method | |
| CN105807070B (en) | A kind of kit for detecting hepatitis B | |
| CN102140547A (en) | One-step real-time fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) kit for measles virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |