CN105695624A - Rapid identification method for different species of crude heparin sodium - Google Patents
Rapid identification method for different species of crude heparin sodium Download PDFInfo
- Publication number
- CN105695624A CN105695624A CN201610276657.XA CN201610276657A CN105695624A CN 105695624 A CN105695624 A CN 105695624A CN 201610276657 A CN201610276657 A CN 201610276657A CN 105695624 A CN105695624 A CN 105695624A
- Authority
- CN
- China
- Prior art keywords
- heparin sodium
- crude heparin
- centrifuge tube
- crude
- magnetic frame
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rapid identification method for different species of crude heparin sodium.The method comprises the following steps that a, crude heparin sodium is dissolved into a water solution containing sodium chloride and ethyl alcohol, then, biological magnetic beads are added, and the total DNA in the crude heparin sodium is extracted through a magnetic bead method; b, pig, sheep and bovine derived material identification primers are designed; c, the total DNA of the crude heparin sodium to be tested is used as a template, and the pig, sheep and bovine derived material identification primers are adopted for PCR amplification; d, agarose gel electrophoresis is performed on amplified products, and the species source of the crude heparin sodium to be tested is judged according to the size of the obtained specificity band molecular weight.According to the identification method, the problem that existing heparin in a traditional method restrains PCR can be effectively solved, the cost is greatly lowered, the method is simple, clear, rapid, easy and convenient to implement, good in repeatability, easy to implement, high in accuracy and suitable for being applied and popularized for identifying different species of crude heparin sodium.
Description
Technical field
The present invention relates to medicament sources detection method, specifically the method for quick identification in a kind of crude heparin sodium different genera source。
Background technology
Heparin sodium is mucopolysaccharide sulfuric acid ester material, because it has blood coagulation resisting function, is widely used in the clinical treatment of thrombosis or embolism class diseases。Recent study proves, heparin sodium also has effect for reducing blood fat。At present, heparin sodium is mainly derived from the intestinal mucosa of pig, cattle or sheep。But, there is the risk infected by correlated virus in the heparin sodium of Xing Heyang source, cattle source property, and causes that the probability of happening of the untoward reaction such as thrombocytopenia and thrombosis syndrome to be far longer than pig endogenous heparin sodium。Therefore, in Clinical practice, people can select pig endogenous heparin sodium as far as possible。But, owing to producing many-sided reasons such as material source complexity in actual production, frequently can lead to the raw materials for production in pig source and exist by the probability of the animal material pollution in the source such as cattle, sheep。Therefore, set up the discrimination method of the animal derived components such as pig source, Yang Yuan, Niu Yuan to controlling drug quality, the pollution that prevents heterogenous animal derived component most important。
At present, the method for the heparin sodium detecting different genera source in prior art mainly has immunochemistry and detection of nucleic acids etc.。Wherein fluorescence quantifying PCR method detection of nucleic acids uses relatively more extensive, specifically first extracts animal residual nucleic acid from crude heparin sodium, then adopts quantitative fluorescent PCR to detect。Fluorescent quantitative PCR technique is that the change utilizing fluorescence signal detects the change of each cyclic amplification product amount in pcr amplification reaction in real time, by the analysis of Ct value and standard curve, starting template is carried out quantitative analysis。This detection method result is comparatively accurate, but there is certain defect during this method detection heparin sodium, because PCR is had very strong inhibitory activity by heparin, so needing to use heparinase that heparin sodium sample is carried out pre-treatment before doing quantitative PCR, its complicated operation is loaded down with trivial details, heparinase and quantitative reagent costly, this makes the method use at the medium-sized and small enterprises that lack qualified technical personnel and receives great limitation。The discrimination method of the heparin sodium in the different genera source that visible, R&D costs are low, simple operation, accuracy are high is the problem tried to explore in industry。
Summary of the invention
It is an object of the invention to provide the method for quick identification in a kind of crude heparin sodium different genera source, the suppression of later stage PCR is caused that detection accuracy reduces solving existing detection method or uncontrollable heparin, or the problem that pre-treatment complex operation is complicated, relatively costly。
It is an object of the invention to be achieved through the following technical solutions: the method for quick identification in crude heparin sodium different genera source, comprise the following steps:
A crude heparin sodium to be measured is dissolved in solvent orange 2 A by (), add biomagnetic beads, extracts the STb gene in crude heparin sodium by paramagnetic particle method, obtains crude heparin sodium STb gene to be measured；Described solvent orange 2 A is be dissolved with 2g sodium chloride and the mixed solution of 10g ethanol in every 100mL water；Described crude heparin sodium, solvent orange 2 A, biomagnetic beads mass volume ratio be 30mg:1mL:30 μ L；
B () design pig, sheep, calf-derived Cyclospora diagnostic primers are respectively as follows:
Pig derived component diagnostic primers:
Forward primer: ATCTACATGATTCATTACAATTAC,
Downstream primer: CTATGTTTTTGAGTTTTGAGTTCA；
Sheep derived material diagnostic primers:
Forward primer: ACACAACTTCTACCACAACCC,
Downstream primer: AAACAATGAGGGTAACGAGGG；
Calf-derived Cyclospora diagnostic primers:
Forward primer: GCCATATACTCTCCTTGGTGACA,
Downstream primer: GTAGGCTTGGGAATAGTACGA；
C () is using step (a) gained crude heparin sodium STb gene to be measured as DNA profiling, pig that step (b) designs, sheep, calf-derived Cyclospora diagnostic primers is adopted to carry out pcr amplification respectively, its amplification system is: DNA profiling 3 μ L, forward primer 1 μ L, downstream primer 1 μ L, 2 times of PCR reagent premixed liquid 25 μ L, uses ddH2O polishing is to 50 μ L；
PCR response procedures is: denaturation 5min at 95 DEG C；Degeneration 15s at 95 DEG C；Anneal 30s at 63 DEG C；30s is extended at 72 DEG C；Times of thermal cycle is 40 times；Obtain amplified production；
D described amplified production is carried out agarose gel electrophoresis by () respectively, as obtained the specific band that molecular size range is 150bp, then show in this crude heparin sodium to be measured containing pig endogenous heparin sodium composition；As obtained the specific band that molecular size range is 145bp, then show in this crude heparin sodium to be measured containing sheep endogenous heparin sodium composition；As obtained the specific band that molecular size range is 271bp, then show in this crude heparin sodium to be measured containing cattle endogenous heparin sodium composition。
Biomagnetic beads described in step (a) of the present invention refers to magnetic bead MG101, for the commercially available prod of TIANGEN Biotech (Beijing) Co., Ltd.。Described biomagnetic beads refers to the magnetic bead of adsorption of DNA, by special process, the surface of magnetic nanoparticle is modified, under certain condition nucleic acid is had very strong affinity, and when conditions change, the nucleic acid of magnetic bead release absorption, it is possible to reach the purpose of fast separating and purifying nucleic acid。
Comprising the concrete steps that of STb gene in crude heparin sodium is extracted by paramagnetic particle method: be 1. placed in centrifuge tube by the crude heparin sodium solution to be measured adding biomagnetic beads vibration 10s described in step (a) of the present invention, being placed in incubated at room 10min, period is every 3min vibration mixing 10s；2. centrifuge tube is positioned on magnetic frame and stands 1min, when magnetic bead adsorbs completely, remove liquid；3. centrifuge tube is taken off from magnetic frame, add the rinsing liquid A of 6 times of described biomagnetic beads volumes, vibration mixing 1min；4. centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, remove liquid；5. centrifuge tube is taken off from magnetic frame, add the rinsing liquid B of 6 times of described biomagnetic beads volumes, vibration mixing 1min；6. centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, remove liquid；7. repeat step 5.-6. once；8. being placed on magnetic frame by centrifuge tube again, 56 DEG C are dried 5-10min；9. centrifuge tube is taken off from magnetic frame, add the ddH of 20 μ L2O, 56 DEG C of vibration mixing 5min；10. centrifuge tube is positioned on magnetic frame and stands 2min, after magnetic bead adsorbs completely, the DNA obtained is transferred in a new centrifuge tube；Described rinsing liquid A is the PEG of NaCl and the 200g of LiCl, the 0.5mol in every 1L water dissolved with 0.8mol, and its pH value is 7.0；Described rinsing liquid B is mass percent concentration is the ethanol of 80%。
Described in step (d) of the present invention 2 times PCR reagent premixed liquid refers to: Tris-HCl(pH value is 8.3) 20mmol/L, dNTP0.4mmol/L, KCl100mmol/L, MgCl23mmol/L, taq enzyme 0.05U/mL, solvent is ddH2O。
Amplified production described in step (d) of the present invention carries out agarose gel electrophoresis respectively specifically comprises the processes of: takes amplified production described in 20 μ L and adds sample-loading buffer 2 μ L, adopting mass percent concentration is the agarose gel electrophoresis of 1%, voltage 100V, electrophoresis 20min。Sample-loading buffer refers to the mixed solution of the glycerol of the bromjophenol blue of EDTA, 0.25g of being dissolved with 0.01mol in 1L water, the dimethylbenzene cyanogen of 0.25g and 50g。
The present invention have detected the different genera source of crude heparin sodium exactly by extracting the series of steps such as STb gene, design specific primer, pcr amplification reaction and electrophoresis data analysis from crude heparin sodium, also quickly authenticated whether this crude heparin sodium is the product being contaminated with sheep source property or calf-derived Cyclospora, this checks on for medication purchasing and clinical medical provides reliable assay simultaneously。The special innovation of the present invention is in that to the employing of testing sample STb gene be specific magnetic bead extraction method, the method efficiently solves the heparin existed in traditional method to the PCR problem suppressed, and greatly reduce cost, method is short and sweet, fast and convenient, reproducible, easily operate, accuracy is high, is suitable to popularization and application in identifying heparin crude product quality。
Accompanying drawing explanation
Fig. 1 is the electrophoresis pattern differentiating pig, sheep, cattle source property crude heparin sodium。In figure, 1 is molecular weight standard；2. it is calf-derived Cyclospora negative control；3 is 1000pg/ μ L calf-derived Cyclospora amplified production specific band；4 is 10000pg/ μ L pig derived component amplified production specific band；5 is 1000pg/ μ L pig derived component amplified production specific band；, 6 is 100pg/ μ L pig derived component amplified production specific band；7 is pig derived component negative control；8 is sheep derived material negative control；9 is 10000pg/ μ L sheep derived material amplified production specific band；10 is 1000pg/ μ L sheep derived material amplified production specific band；11 is 100pg/ μ L sheep derived material amplified production specific band。
Fig. 2 is the electrophoresis pattern differentiating to mix in the property crude heparin sodium of pig source sheep derived material。In figure, 1 is molecular weight standard, and 2 contain the electrophoretic band of the sheep endogenous heparin sodium that mass percent is 10% for product；3 contain the electrophoretic band of the sheep endogenous heparin sodium that mass percent is 1% for product；4 contain the electrophoretic band of the sheep endogenous heparin sodium that mass percent is 0.1% for product；5 is negative control。
Fig. 3 is that the present invention extracts STb gene quantity electrophoresis pattern in crude heparin sodium with comparative example。In figure, 1 is molecular weight standard, and 2 is sample A electrophoretic band, and 3 is sample B electrophoretic band。
Detailed description of the invention
Example below is used for further describing the present invention, but the present invention is not limited in any form by embodiment。Unless stated otherwise, the present invention adopts reagent, method and apparatus are the art conventional reagent, method and apparatus。But do not limit the present invention in any form。
The biomagnetic beads of heretofore described use is from the commercially available magnetic bead MG101 of TIANGEN Biotech (Beijing) Co., Ltd.。
The detection of embodiment 1 pig source property crude heparin sodium sample
(1) STb gene of pig source property crude heparin sodium is extracted:Weigh pig source property crude heparin sodium 30mg and be dissolved in the solvent orange 2 A of lmL (100mL water is dissolved with the mixed solution of 2gNaCl and 10g ethanol), be placed in centrifuge tube；30 μ L biomagnetic beads, lid upper tube cap, vibration mixing 10s is added in sample solution；Incubated at room 10min, period every 3min turn upside down and mix 10s, make magnetic bead and nucleic acid fully combine, and centrifugal collection is attached to tube wall and the liquid of pipe lid；Centrifuge tube is positioned on magnetic frame and stands 1min, when magnetic bead adsorbs completely, carefully suck liquid；Centrifuge tube is taken off from magnetic frame, adds the mixed solution of the PEG of NaCl and 200g that 500 μ L rinsing liquid A(rinsing liquid A are LiCl, 0.5mol of being dissolved with 0.8mol in 1L water, pH7.0), vibration mixing 1min；Centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；Being taken off from magnetic frame by centrifuge tube, adding 500 μ L rinsing liquid B(rinsing liquid B be mass percent concentration is the ethanol of 80%), vibration mixing 1min；Centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；Repeat step-Once；Centrifuge tube is on magnetic frame, and 56 DEG C are dried 10min；Centrifuge tube is taken off from magnetic frame, adds the TE buffer of 20 μ L, 56 DEG C of vibration mixing 5min；Centrifuge tube is positioned on magnetic frame and stands 2min, after magnetic bead adsorbs completely, carefully the DNA obtained is transferred in a new centrifuge tube, obtains crude heparin sodium STb gene；
(2), dilution: crude heparin sodium STb gene purified water step (1) obtained is diluted to the DNA profiling that concentration is 10000pg/mL, 1000pg/mL, 100pg/mL；
(3) pcr amplification:
1. configuring PCR system, 50 μ L reaction systems are as follows:
DNA profiling 3 μ L
Forward primer 1 μ L
Downstream primer 1 μ L
The PCR reagent premixed liquid 25 μ L of 2 times
ddH2O polishing is to 50 μ L；
Forward primer and downstream primer in above-mentioned reaction system adopt pig derived component diagnostic primers:
Forward primer: ATCTACATGATTCATTACAATTAC,
Downstream primer: CTATGTTTTTGAGTTTTGAGTTCA；
The collocation method of 2 times of PCR reagent premixed liquids is: be dissolved with Tris-HCl20mmol, dNTP0.4mmol, KCl100mmol, MgCl that pH value is 8.3 in 1L ultra-pure water23mmol, taq enzyme 50U。
DNA profiling is substituted for negative control with purified water；
2. PCR response procedures is: 1. denaturation 5 minutes at 95 DEG C；2. degeneration 15 seconds at 95 DEG C；3. anneal 30 seconds at 63 DEG C；4. extend 30 seconds at 72 DEG C；Times of thermal cycle is 40 times；
Pcr amplification is carried out for above three variable concentrations DNA profiling and negative control sample, obtains amplified production；
(4) agarose gel detection
The amplified production 20 μ L taking above-mentioned PCR adds sample-loading buffer (0.01MEDTA, 0.25% bromjophenol blue, 0.25% dimethylbenzene cyanogen, 50% glycerol) 2 μ L, at the agarose gel TAE electrophoresis that mass percent concentration is 1%, voltage 100V, electrophoresis 20min, EB dyes, observing under uviol lamp, its result is shown in Fig. 1。It can be seen that method provided by the invention can detect that its specific band molecular size range is 150bp containing pig endogenous heparin sodium composition in this sample in figure。
The detection of embodiment 2 sheep source property crude heparin sodium sample
(1) STb gene of sheep source property crude heparin sodium is extracted:Weigh sheep source property crude heparin sodium 30mg and be dissolved in the solvent orange 2 A of lmL (100mL water is dissolved with the mixed solution of 2gNaCl and 10g ethanol), be placed in centrifuge tube；30 μ L biomagnetic beads, lid upper tube cap, vibration mixing 10s is added in sample solution；Incubated at room 10min, period every 3min turn upside down and mix 10s, make magnetic bead and nucleic acid fully combine, and brief centrifugation is collected and is attached to tube wall and the liquid of pipe lid；Centrifuge tube is positioned on magnetic frame and stands 1min, when magnetic bead adsorbs completely, carefully suck liquid；Centrifuge tube is taken off from magnetic frame, adds the mixed solution of the PEG of NaCl and 200g that 500 μ L rinsing liquid A(rinsing liquid A are LiCl, 0.5mol of being dissolved with 0.8mol in 1L water, pH7.0), vibration mixing 1min；Centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；Being taken off from magnetic frame by centrifuge tube, adding 500 μ L rinsing liquid B(rinsing liquid B be mass percent concentration is the ethanol of 80%), vibration mixing 1min；Centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；Repeat step-Once；Centrifuge tube is on magnetic frame, and 56 DEG C are dried 10min；Centrifuge tube is taken off from magnetic frame, adds the TE buffer of 20 μ L, 56 DEG C of vibration mixing 5min；Centrifuge tube is positioned on magnetic frame and stands 2min, after magnetic bead adsorbs completely, carefully the DNA obtained is transferred in a new centrifuge tube, obtains the STb gene of crude heparin sodium；
(2), dilution: the STb gene purified water of crude heparin sodium step (1) obtained is diluted to the DNA profiling that concentration is 10000pg/mL, 1000pg/mL, 100pg/mL；
(3) pcr amplification:
1. configuring PCR system, 50 μ L reaction systems are as follows:
DNA profiling 3 μ L
Forward primer 1 μ L
Downstream primer 1 μ L
2 times of PCR reagent premixed liquid 25 μ L
ddH2O polishing is to 50 μ L；
Forward primer and downstream primer in above-mentioned reaction system adopt sheep derived material diagnostic primers:
Forward primer ACACAACTTCTACCACAACCC
Downstream primer AAACAATGAGGGTAACGAGGG
2 times of PCR reagent premixed liquids are: Tris-HCl(pH8.3) 20mmol/L, dNTP0.4mmol/L, KCl100mmol/L, MgCl23mmol/L, taq enzyme 0.05U/ μ L；
DNA profiling is substituted for negative control with purified water；
2. PCR response procedures is: 1. denaturation 5 minutes at 95 DEG C；2. degeneration 15 seconds at 95 DEG C；3. anneal 30 seconds at 63 DEG C；4. extend 30 seconds at 72 DEG C；Times of thermal cycle is 40 times；
Pcr amplification is carried out for above three variable concentrations DNA profiling and negative control sample, obtains amplified production；
(4) agarose gel detection
The amplified production 20 μ L taking above-mentioned PCR adds sample-loading buffer (0.01mol/LEDTA, 0.25% bromjophenol blue, 0.25% dimethylbenzene cyanogen, 50% glycerol) 2 μ L, at the agarose gel TAE electrophoresis that mass percent concentration is 1%, voltage 100V, electrophoresis 20min, EB dyes, observing under uviol lamp, its result is shown in Fig. 1。It can be seen that method provided by the invention can detect that its specific band molecular size range is 145bp containing sheep endogenous heparin sodium composition in this sample in figure。
The detection of 3 Ns of source property crude heparin sodium samples of embodiment
(1) STb gene of cattle source property crude heparin sodium is extracted:Weigh cattle source property crude heparin sodium 30mg and be dissolved in the solvent orange 2 A of lmL (100mL water is dissolved with the mixed solution of 2gNaCl and 10g ethanol), be placed in centrifuge tube；30 μ L biomagnetic beads, lid upper tube cap, vibration mixing 10s is added in sample solution；Incubated at room 10min, period every 3min turn upside down and mix 10s, make magnetic bead and nucleic acid fully combine, and brief centrifugation is collected and is attached to tube wall and the liquid of pipe lid；Centrifuge tube is positioned on magnetic frame and stands 1min, when magnetic bead adsorbs completely, carefully suck liquid；Centrifuge tube is taken off from magnetic frame, adds the mixed solution of the PEG of NaCl and 200g that 500 μ L rinsing liquid A(rinsing liquid A are LiCl, 0.5mol of being dissolved with 0.8mol in 1L water, pH7.0), vibration mixing 1min；Centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；Being taken off from magnetic frame by centrifuge tube, adding 500 μ L rinsing liquid B(rinsing liquid B be mass percent concentration is the ethanol of 80%), vibration mixing 1min；Centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；Repeat step-Once；Centrifuge tube is on magnetic frame, and 56 DEG C are dried 10min；Centrifuge tube is taken off from magnetic frame, adds the TE buffer of 20 μ L, 56 DEG C of vibration mixing 5min；Centrifuge tube is positioned on magnetic frame and stands 2min, after magnetic bead adsorbs completely, carefully the DNA obtained is transferred in a new centrifuge tube, obtains the STb gene of crude heparin sodium；
(2), dilution: the STb gene purified water of crude heparin sodium step (1) obtained is diluted to the DNA profiling that concentration is 10000pg/mL, 1000pg/mL, 100pg/mL；
(3) pcr amplification:
1. configuring PCR system, 50 μ L reaction systems are as follows:
DNA profiling 3 μ L
Forward primer 1 μ L
Downstream primer 1 μ L
2 times of PCR reagent premixed liquid 25 μ L
ddH2O polishing is to 50 μ L；
Forward primer and downstream primer in above-mentioned reaction system adopt calf-derived Cyclospora diagnostic primers:
Forward primer: GCCATATACTCTCCTTGGTGACA
Downstream primer: GTAGGCTTGGGAATAGTACGA
2 times of PCR reagent premixed liquids are: Tris-HCl(pH8.3) 20mmol/L, dNTP0.4mmol/L, KCl100mmol/L, MgCl23mmol/L, taq enzyme 0.05U/ μ l；
DNA profiling is substituted for negative control with purified water；
2. PCR response procedures is: 1. denaturation 5 minutes at 95 DEG C；2. degeneration 15 seconds at 95 DEG C；3. anneal 30 seconds at 63 DEG C；4. extend 30 seconds at 72 DEG C；Times of thermal cycle is 40 times；
Pcr amplification is carried out for above three variable concentrations DNA profiling and negative control sample, obtains amplified production；
(4) agarose gel detection
The amplified production 20 μ L taking above-mentioned PCR adds sample-loading buffer (0.01MEDTA, 0.25% bromjophenol blue, 0.25% dimethylbenzene cyanogen, 50% glycerol) 2 μ L, at the agarose gel TAE electrophoresis that mass percent concentration is 1%, voltage 100V, electrophoresis 20min, EB dyes, and observes under uviol lamp, and its result is shown in Fig. 1, it can be seen that method provided by the invention can detect that its specific band molecular size range is 271bp containing cattle endogenous heparin sodium composition in this sample。
Embodiment 4 differentiates whether mixed sheep derived material in pig originality crude heparin sodium
(1) mix sample preparation: mixed by the crude heparin sodium 450mg of the crude heparin sodium 50mg of sheep source property with pig source property, obtain the biased sample containing 10% sheep source heparin sodium；To mix with the crude heparin sodium 450mg of pig source property containing the biased sample 50mg of 10% sheep endogenous heparin sodium, obtain the biased sample containing 1% sheep endogenous heparin sodium；To mix with the crude heparin sodium 450mg of pig source property containing the biased sample 50mg of 1% sheep endogenous heparin sodium, obtain the pig source property crude heparin sodium biased sample containing 0.1% sheep derived material；Needing stirring during mixing, particulate material need to be pressed into powder；
(2) that extracts three concentration respectively mixes STb gene in sample:Weigh the pig source property crude heparin sodium biased sample 30mg containing 10%, 1%, 0.1% sheep derived material that step (1) prepares respectively and be each dissolved in the solvent orange 2 A of lmL (100mL water is dissolved with the mixed solution of 2gNaCl and 10g ethanol), be placed in centrifuge tube；30 μ L biomagnetic beads, lid upper tube cap, vibration mixing 10s is added respectively in sample solution；Incubated at room 10min, period every 3min turn upside down and mix 10s respectively, make magnetic bead and nucleic acid fully combine, and brief centrifugation 1-2s is attached to tube wall and the liquid of pipe lid to collect；Respectively centrifuge tube is positioned on magnetic frame and stands 1min, when magnetic bead adsorbs completely, carefully remove liquid；Respectively centrifuge tube is taken off from magnetic frame, adds the mixed solution of the PEG of NaCl and 200g that 500 μ L rinsing liquid A(rinsing liquid A are LiCl, 0.5mol of being dissolved with 0.8mol in 1L water, pH7.0), vibration mixing 1min；Respectively centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；Being taken off from magnetic frame by centrifuge tube respectively, adding 500 μ L rinsing liquid B(rinsing liquid B be mass percent concentration is the ethanol of 80%), vibration mixing 1min；Respectively centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；Respectively repeat steps-Once；Respectively by centrifuge tube on magnetic frame, 56 DEG C are dried 10min；Respectively centrifuge tube is taken off from magnetic frame, add the TE buffer (EDTA of Tris-HCl and the 1mmol/L of 10mmol/L, pH value is 8.0) of 20 μ L, 56 DEG C of vibration mixing 5min；Respectively centrifuge tube is positioned on magnetic frame and stands 2min, after magnetic bead adsorbs completely, carefully nucleic acid solution is transferred in a new centrifuge tube, obtains the STb gene of three parts of crude heparin sodiums, as the DNA profiling of next step amplification；
(3) pcr amplification:
1. configuring PCR system, 50 μ L reaction systems are as follows:
DNA profiling 3 μ L
Forward primer 1 μ L
Downstream primer 1 μ L
2 times of PCR reagent premixed liquid 25 μ L
ddH2O polishing is to 50 μ L；
Forward primer and downstream primer in above-mentioned reaction system adopt sheep derived material diagnostic primers:
Forward primer ACACAACTTCTACCACAACCC
Downstream primer AAACAATGAGGGTAACGAGGG
2 times of PCR reagent premixed liquids are: Tris-HCl(pH8.3) 20mmol/L, dNTP0.4mmol/L, KCl100mmol/L, MgCl23mmol/L, taq enzyme 0.05U/ μ l；
DNA profiling is substituted for negative control with purified water；
2. PCR response procedures is: 1. denaturation 5 minutes at 95 DEG C；2. degeneration 15 seconds at 95 DEG C；3. anneal 30 seconds at 63 DEG C；4. extend 30 seconds at 72 DEG C；Times of thermal cycle is 40 times；
Pcr amplification is carried out for above three variable concentrations DNA profiling and negative control sample, obtains amplified production；
(4) agarose gel detection
The amplified production 20 μ L taking above-mentioned PCR adds sample-loading buffer (0.01MEDTA, 0.25% bromjophenol blue, 0.25% dimethylbenzene cyanogen, 50% glycerol) 2 μ L, at the agarose gel TAE electrophoresis that mass percent concentration is 1%, voltage 100V, electrophoresis 20min, EB dyes, observing under uviol lamp, its result is shown in Fig. 2。It can be seen that its specific band molecular size range is 145bp in figure, illustrate this crude heparin sodium is mixed with sheep endogenous heparin sodium, even and if product is only mixed with sheep endogenous heparin sodium that mass percent concentration is 0.1% can also by method Accurate Determining provided by the invention and discriminating。
Embodiment 5 present invention compares with the accuracy of the STb gene that comparative example extracts crude heparin sodium
(1) weigh pig source property crude heparin sodium 300mg and be dissolved in the solvent orange 2 A of lmL (100mL contains the aqueous solution of 2gNaCl and 10g ethanol), obtain sample A；Weigh pig source property crude heparin sodium 30mg to be dissolved in lmL pure water simultaneously, obtain sample B；It is respectively placed in two centrifuge tubes, is synchronously performed following operation respectively；
(2) in sample A and sample B, 30 μ L biomagnetic beads are added respectively, lid upper tube cap, vibration mixing 10s；
(3) difference incubated at room 10min, period every 3min turns upside down and mixes 10s, makes magnetic bead and nucleic acid fully combine, and brief centrifugation is collected and is attached to tube wall and the liquid of pipe lid；
(4) centrifuge tube is positioned on magnetic frame and stands 1min, when magnetic bead adsorbs completely, carefully remove liquid；
(5) centrifuge tube is taken off from magnetic frame, adds the mixed solution of the PEG of NaCl and 200g that 500 μ L rinsing liquid A(rinsing liquid A are LiCl, 0.5mol of being dissolved with 0.8mol in 1L water, pH7.0), vibration mixing 1min；
(6) centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；
(7) being taken off from magnetic frame by centrifuge tube, adding 500 μ L rinsing liquid B(rinsing liquid B be mass percent concentration is the ethanol of 80%), vibration mixing 1min；
(8) centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, carefully suck liquid；
(9) step (7)-(8) are repeated once；
(10) centrifuge tube is on magnetic frame, and 56 DEG C are dried 10min；
(11) centrifuge tube is taken off from magnetic frame, add the TE solution (EDTA of Tris-HCl and the 1mmol/L of 10mmol/L, pH value is 8.0) of 20 μ L, 56 DEG C of vibration mixing 5min；
(12) centrifuge tube is positioned on magnetic frame and stands 2min, after magnetic bead adsorbs completely, carefully the nucleic acid solution obtained is transferred in a new centrifuge tube respectively, obtains the STb gene of crude heparin sodium；
(13) STb gene of crude heparin sodium sample A and sample B obtained respectively takes 20 μ L and carries out gel electrophoresis, and result is shown in Fig. 3。As can be seen from Figure 3 crude heparin sodium is dissolved in its DNA finally extracted of the sample A in the special solvent of the present invention (aqueous solution of the ethanol of NaCl and 10% of 2%) and is significantly more than the sample B being dissolved only in water。And through the shading value of ultraviolet spectrophotometer mensuration DNA260nm, with OD260Being equivalent to the DNA of 50 μ g/mL, sample A obtain the concentration of STb gene and be about 0.8 μ g/ μ L, sample B obtains the concentration of STb gene and is about 0.2 μ g/ μ L。Visible, use and method provided by the invention is extracted in crude heparin sodium the quantity of the DNA that STb gene step obtains apparently higher than the DNA quantity of check sample B, and crude product is first dissolved in solvent orange 2 A by the present invention avoids the heparin inhibitory action to PCR, illustrate that adopting method provided by the invention to extract crude heparin sodium to be measured has higher detection sensitivity, can be used for being contaminated with in the property crude heparin sodium of pig source the accurate discriminating of other origin components's products of trace with this。
Above-described embodiment is the present invention preferably embodiment; but embodiments of the present invention are also not restricted by the embodiments; the change made under other any spirit without departing from the present invention and principle, modification, replacement, combination, simplification; all should be the substitute mode of equivalence, be included within protection scope of the present invention。
Claims (5)
1. the method for quick identification in a crude heparin sodium different genera source, it is characterised in that comprise the following steps:
A crude heparin sodium to be measured is dissolved in solvent orange 2 A by (), add biomagnetic beads, extracts the STb gene in crude heparin sodium by paramagnetic particle method, obtains crude heparin sodium STb gene to be measured；Described solvent orange 2 A is dissolved with 2g sodium chloride and 10g ethanol in every 100mL water；Described crude heparin sodium, solvent orange 2 A, biomagnetic beads mass volume ratio be 30mg:1mL:30 μ L；
B () design pig, sheep, calf-derived Cyclospora diagnostic primers are respectively as follows:
Pig derived component diagnostic primers:
Forward primer: ATCTACATGATTCATTACAATTAC,
Downstream primer: CTATGTTTTTGAGTTTTGAGTTCA；
Sheep derived material diagnostic primers:
Forward primer: ACACAACTTCTACCACAACCC,
Downstream primer: AAACAATGAGGGTAACGAGGG；
Calf-derived Cyclospora diagnostic primers:
Forward primer: GCCATATACTCTCCTTGGTGACA,
Downstream primer: GTAGGCTTGGGAATAGTACGA；
C () is using step (a) gained crude heparin sodium STb gene to be measured as DNA profiling, pig that step (b) designs, sheep, calf-derived Cyclospora diagnostic primers is adopted to carry out pcr amplification respectively, its amplification system is: DNA profiling 3 μ L, forward primer 1 μ L, downstream primer 1 μ L, 2 times of concentration PCR reagent premixed liquid 25 μ L, uses ddH2O polishing is to 50 μ L；
PCR response procedures is: denaturation 5min at 95 DEG C；Degeneration 15s at 95 DEG C；Anneal 30s at 63 DEG C；30s is extended at 72 DEG C；Thermal cycle 40 times；Obtain amplified production；
D described amplified production is carried out agarose gel electrophoresis by () respectively, as obtained the specific band that molecular size range is 150bp, then show in this crude heparin sodium to be measured containing pig endogenous heparin sodium composition；As obtained the specific band that molecular size range is 145bp, then show in this crude heparin sodium to be measured containing sheep endogenous heparin sodium composition；As obtained the specific band that molecular size range is 271bp, then show in this crude heparin sodium to be measured containing cattle endogenous heparin sodium composition。
2. the method for quick identification in crude heparin sodium different genera according to claim 1 source, it is characterized in that, comprising the concrete steps that of STb gene in crude heparin sodium is extracted by paramagnetic particle method: be 1. placed in centrifuge tube by the crude heparin sodium solution to be measured adding biomagnetic beads vibration 10s described in step (a), it is placed in incubated at room 10min, vibration；2. centrifuge tube is positioned on magnetic frame and stands 1min, remove liquid；3. centrifuge tube is taken off from magnetic frame, add the rinsing liquid A of 6 times of biomagnetic beads volumes, vibration mixing 1min；4. centrifuge tube is positioned on magnetic frame and stands 1min, remove liquid；5. centrifuge tube is taken off from magnetic frame, add the rinsing liquid B of 6 times of biomagnetic beads volumes, vibration mixing 1min；6. centrifuge tube is positioned on magnetic frame and stands 1min, after magnetic bead adsorbs completely, remove liquid；7. repeat step 5.-6. once；8. being placed on magnetic frame by centrifuge tube again, 56 DEG C are dried 5-10min；9. centrifuge tube is taken off from magnetic frame, add the TE buffer of 20 μ L, 56 DEG C of vibration mixing 5min；10. centrifuge tube is positioned on magnetic frame and stands 2min, after magnetic bead adsorbs completely, separate the DNA obtained and be crude heparin sodium STb gene to be measured。
3. the method for quick identification in crude heparin sodium different genera according to claim 2 source, it is characterised in that described rinsing liquid A is the PEG of NaCl and the 200g of LiCl, the 0.5mol in every 1L water dissolved with 0.8mol, and its pH value is 7.0；Described rinsing liquid B is mass percent concentration is the ethanol of 80%。
4. the method for quick identification in crude heparin sodium different genera according to claim 1 source, it is characterized in that, 2 described in step (c) times concentration PCR reagent premixed liquid refers to: Tris-HCl20mmol/L, dNTP0.4mmol/L, KCl100mmol/L, MgCl23mmol/L, taq enzyme 0.05U/ μ L。
5. the method for quick identification in crude heparin sodium different genera according to claim 1 source, it is characterized in that, amplified production described in step (d) carries out agarose gel electrophoresis respectively specifically comprises the processes of: takes amplified production described in 20 μ L and adds sample-loading buffer 2 μ L, adopting mass percent concentration is the agarose gel electrophoresis of 1%, voltage 100V, electrophoresis 20min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610276657.XA CN105695624B (en) | 2016-04-29 | 2016-04-29 | The method for quick identification in crude heparin sodium different genera source |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610276657.XA CN105695624B (en) | 2016-04-29 | 2016-04-29 | The method for quick identification in crude heparin sodium different genera source |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105695624A true CN105695624A (en) | 2016-06-22 |
| CN105695624B CN105695624B (en) | 2019-04-23 |
Family
ID=56217883
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610276657.XA Active CN105695624B (en) | 2016-04-29 | 2016-04-29 | The method for quick identification in crude heparin sodium different genera source |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105695624B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106442353A (en) * | 2016-09-26 | 2017-02-22 | 南通科技职业学院 | Detection method of pig heparin sodium crude product mixed with ruminant source |
| CN109371105A (en) * | 2018-12-06 | 2019-02-22 | 南通科技职业学院 | A method of extracting genomic DNA from heparin sodium sample |
| CN112080553A (en) * | 2019-06-13 | 2020-12-15 | 苏州融析生物科技有限公司 | qPCR detection method for sheep and pig gene content in crude sheep heparin sodium |
| EP3399034B1 (en) * | 2017-05-05 | 2022-12-28 | Siemens Healthcare Diagnostics Inc. | Device for extracting nucleic acids from biological sample materials with solvent-free reagents |
-
2016
- 2016-04-29 CN CN201610276657.XA patent/CN105695624B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| 向海等: "肝素钠提取原料中牛羊源成分的分子检测方法", 《第十三次全国畜禽遗传标记研讨会论文集 》 * |
| 王自强等: "肝素钠中猪、牛及羊源性成分的PCR检测", 《中国药师》 * |
| 陈川等: "常规PCR 法快速鉴别不同种属来源的粗品肝素钠", 《中国生物制品学杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106442353A (en) * | 2016-09-26 | 2017-02-22 | 南通科技职业学院 | Detection method of pig heparin sodium crude product mixed with ruminant source |
| EP3399034B1 (en) * | 2017-05-05 | 2022-12-28 | Siemens Healthcare Diagnostics Inc. | Device for extracting nucleic acids from biological sample materials with solvent-free reagents |
| CN109371105A (en) * | 2018-12-06 | 2019-02-22 | 南通科技职业学院 | A method of extracting genomic DNA from heparin sodium sample |
| CN109371105B (en) * | 2018-12-06 | 2022-04-05 | 南通麦杰生物科技有限公司 | Method for extracting genome DNA from heparin sodium sample |
| CN112080553A (en) * | 2019-06-13 | 2020-12-15 | 苏州融析生物科技有限公司 | qPCR detection method for sheep and pig gene content in crude sheep heparin sodium |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105695624B (en) | 2019-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102533724B (en) | A kind of cell cracking agent for biological sample amplifying nucleic acid extraction purification | |
| CN105420403B (en) | A kind of real time fluorescence quantifying PCR method for carrying out magnetic bead in a pipe and extracting nucleic acid and amplification | |
| CN102174660B (en) | HBV (hepatitis B virus) fluorescent quantitative PCR (polymerase chain reaction) detection kit | |
| US10415076B2 (en) | High throughput quantification and characterization of foot and mouth disease virus and products thereof | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN105695624A (en) | Rapid identification method for different species of crude heparin sodium | |
| CN102839169B (en) | Kits for extracting enterovirus RNA and corresponding method for extracting and purifying enterovirus RNA | |
| CN105441595B (en) | It is a kind of for detecting the digital pcr absolute quantitation parting detecting reagent of HBV-B/C | |
| CN103642941A (en) | Quantitative detection kit of hepatitis B virus (HBV) nucleic acid | |
| TWI577442B (en) | The method of removing bacterial endotoxin from biological products and the preparation of its biological products method | |
| CN103710338B (en) | DNA extraction kit in a kind of human whole blood white corpuscle | |
| CN104846122A (en) | Nucleic acid detection kit of enterovirus type 71 (EV71) and coxsackievirus type A16 (CA16) (fluorescent polymerase chain reaction (PCR) method) | |
| CN108753767A (en) | A kind of Viral nucleic acid extraction reagent box and extracting method | |
| CN101538619A (en) | Kit for detecting RNA of hepatitis E virus | |
| CN104830996B (en) | A kind of influenza virus detection pre-treating method based on antibody magnetic capture | |
| CN106755584B (en) | A kind of ebb virus's detection kit and detection method | |
| CN103710464B (en) | HCV (Hepatitis c virus) genotype detection kit | |
| CN103184214A (en) | Hepatitis B virus nucleic acid rapid extraction reagent | |
| CN101570798B (en) | Detection kit and detection method for 3 species of food-borne viruses in marine products | |
| CN105420411A (en) | Nucleic acid fluorescence PCR detection kit for universal enterovirus, coxsackievirus A16 and enterovirus 71 | |
| CN102827920A (en) | PCR detection kit for zaocys dhumnades | |
| CN105296676A (en) | Fluorescent quantitative PCR detecting kit for hepatitis E virus and using method of fluorescent quantitative PCR detecting kit | |
| CN107513562A (en) | Detect pseudomonas aeruginosa and ExoU primer, kit and method in water | |
| CN101915850A (en) | Swine fever negative and positive serum reference materials and preparation method thereof | |
| CN103468829A (en) | Hepatitis B virus nucleic acid detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |