CN110343785B - Kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13a - Google Patents
Kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13a Download PDFInfo
- Publication number
- CN110343785B CN110343785B CN201910716750.1A CN201910716750A CN110343785B CN 110343785 B CN110343785 B CN 110343785B CN 201910716750 A CN201910716750 A CN 201910716750A CN 110343785 B CN110343785 B CN 110343785B
- Authority
- CN
- China
- Prior art keywords
- hepatitis
- virus
- kit
- cas13a
- closed circular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Communicable Diseases (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13 a. The invention provides a kit for detecting hepatitis B virus covalent closed circular DNA, which contains Cas13a protein and crRNA or a complex formed by the Cas13a protein and the crRNA; the crRNA includes an anchor sequence for binding to Cas13a protein and a guide sequence targeting a hepatitis b virus covalently closed circular DNA trans-notch region target sequence; the target sequence of the covalent closed circular DNA cross-notch region of the hepatitis B virus is shown as SEQ ID No.4. The invention adopts PCR technology and CRISPR-Cas13a technology to detect HBV cccDNA, and the novel HBV cccDNA detection kit developed by the method has the characteristics of strong specificity and high sensitivity, and has very important clinical application prospect and development value.
Description
Technical Field
The invention relates to the field of virus detection, in particular to a kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13 a.
Background
The global HBV chronic infection patients are about 2.57 hundred million people, and the decompensated liver cirrhosis, liver failure and liver cancer caused by HBV infection lead to death of about 90 ten thousand people, and the overall carrying rate of the people in China is 6.1 percent, which accounts for about 1/3 of the world. The key factor of chronic hepatitis B difficult to cure is HBV cccDNA which is not completely cleared, is a template for synthesizing all RNA and progeny viruses generated by virus replication, can exist continuously and stably in the nuclei of liver cells, and no existing antiviral drug can clear cccDNA at present, so the existence of HBV cccDNA is considered to be the most main cause of hepatitis recurrence after HBV infection chronicity and HBV resistance treatment stopping, and the regulatory mechanism for analyzing cccDNA is recognized by domestic and foreign specialities as an important scientific problem which needs to be preferentially solved in a chronic hepatitis B cure strategy. Therefore, the detection of HBV cccDNA has important significance in the aspects of deeply researching HBV pathogenic mechanism, evaluating the curative effect of the drug of the patient with hepatitis B and the like.
The level of HBV cccDNA in the liver of a patient is extremely low, and each liver cell has only about 5-50 copies, so that high requirements are put on the sensitivity of detection technology. The high homology of the double-stranded DNA (rcDNA) molecule of hepatitis B virus and ccc DNA sequence requires the detection technology to have high specificity. Current HBV cccDNA common detection techniques include: (1) southern blot hybridization: the method has the advantages of accurate qualitative detection, complicated operation, low sensitivity, inaccurate quantification, and large sample amount, so that the method has fewer clinical applications. (2) Nested or selective Polymerase Chain Reaction (PCR): the detection sensitivity is better, but false positives are caused by the need for multiple amplifications and re-amplification of the PCR product. (3) Real-time fluorescent quantitative PCR method: the specificity of the detection method is further improved than that of the selective PCR, the nonspecific amplification possibly generated by the background of high rcDNA can be eliminated, the sensitivity is also obviously improved, but the existence of the nonspecific amplification of the rcDNA cannot be completely eliminated. (4) Microdroplet digital PCR (ddPCR) method. The ddPCR method is able to detect cccDNA in serum, single cells and FFPE tumor tissue. Compared with Southern blot and other methods, the sensitivity of cccDNA detection is improved, but the cost is high, and the method is not favorable for wide popularization.
In 2017, a report Zhang Feng laboratory establishes a trace nucleic acid detection technology with sensitivity reaching single base by using a CRISPR-Cas13 detection technology and a recombinase polymerase amplification technology, and the technology has the advantages of low detection cost, high detection speed and the like.
Disclosure of Invention
The invention aims to solve the problems in the prior art, and provides a novel detection method of HBV cccDNA, which has high stability, strong specificity and high sensitivity, and can realize early detection of hepatitis B and effective monitoring of drug efficacy, thereby laying a solid foundation for improving the problems of hepatitis B patients in the aspects of treatment efficacy, drug monitoring and the like and for individuation treatment of hepatitis B.
In a first aspect, the invention claims a kit for detecting hepatitis b virus covalently closed circular DNA.
The invention discloses a kit for detecting hepatitis B virus covalently closed circular DNA, which contains Cas13a protein and crRNA or a complex formed by the Cas13a protein and the crRNA.
The crRNA includes an anchor sequence for binding to Cas13a protein and a guide sequence targeting a hepatitis b virus covalently closed circular DNA trans-notch region target sequence;
the target sequence of the covalent closed circular DNA cross-notch region of the hepatitis B virus is shown as SEQ ID No.4.
Further, the sequence of the crRNA is specifically shown in SEQ ID No. 1. Positions 1-39 of SEQ ID No.1 are the anchoring sequence for binding to Cas13a protein; positions 40-67 are guide sequences targeting the HBV cccDNA cross-notch target sequence.
Further, the Cas13a protein may specifically be an LwCas13a protein.
Further, the kit can also comprise a primer pair for specifically amplifying the hepatitis B virus covalent closed circular DNA; the primer pair can be specifically a primer pair consisting of two single-stranded DNAs shown in SEQ ID No.2 and SEQ ID No. 3.
Further, the kit can also contain a report RNA; the reporter RNA is an RNA molecule with a signal reporting function, and can report a positive signal and be detected when the RNA sequence in the reporter RNA is degraded.
Wherein the positive signal may be a fluorescent signal.
In a specific embodiment of the present invention, the reporter RNA is RNaseAlert TM QC System v2, in particular Invitrogen TM Company product, cat number 4479769.
Further, the kit may further comprise all or part of the following: ecoR I enzyme, ATP dependent DNase (PSAD enzyme) that does not degrade the plasmid, T7 transcriptase, NTP, RNase inhibitor, RNase-free water, PCR amplification buffer, transcription and CRISPR-Cas13a detection reaction buffer.
In a specific embodiment of the present invention, the PCR amplification buffer is specifically a product of Beijing Bomaide Gene technology Co., ltd., product No. MT211-02.
In a specific embodiment of the invention, the transcription and CRISPR-Cas13a detection reaction buffer is specifically 10×buffer, and the formulation is as follows: 400mM Tris-HCl,600mM sodium chloride, 60mM MgCl 2 。
Further, the kit may further comprise a readable carrier on which the method described in the third aspect is recorded.
In a second aspect, the invention claims any of the following:
(A1) The crRNA described in the first aspect above;
(A2) The Cas13a protein and crRNA described in the first aspect above, or a complex formed by both.
In a third aspect, the invention claims a method for detecting hepatitis b virus covalently closed circular DNA.
The method for detecting the covalent closed circular DNA of the hepatitis B virus, which is claimed by the invention, can comprise the following steps:
(a1) The method comprises the steps of extracting total DNA from a sample to be detected, digesting non-closed linear DNA by EcoRI enzyme digestion and adding ATP dependent DNase which does not degrade plasmids (EcoRI enzyme is used for cutting circular DNA containing the enzyme cutting sites in an extracted genome into linear DNA, then removing interference in subsequent PCR by PSAD digestion, and the HBVcccDNA has no EcoRI enzyme cutting sites, so that the HBVcccDNA in the extracted genome can be kept, and the step aims at making the purity of the HBVcccDNA higher and removing non-specific interference);
(a2) Taking the sample treated in the step (a 1) as a template, and carrying out PCR amplification by adopting a primer pair consisting of two single-stranded DNA shown in SEQ ID No.2 and SEQ ID No.3 to obtain a PCR product;
(a3) A transcription and CRISPR-Cas13a detection system was formulated containing the following components: the PCR product obtained in step (a 2), the Cas13a protein described in the first aspect supra, the crRNA described in the first aspect supra, the report RNA, NTP, T transcriptase described in the first aspect supra, an rnase inhibitor, rnase-free water, the transcription described in the first aspect supra, and the CRISPR-Cas13a assay reaction buffer; reacting; detecting a positive signal, and judging whether the sample to be detected contains the covalent closed circular DNA of the hepatitis B virus according to the existence of the positive signal; and/or judging how much hepatitis B virus covalent closed circular DNA is contained in the sample to be tested according to the intensity of the positive signal.
If positive signals exist, judging that the sample to be detected contains or is candidate to contain the covalent closed circular DNA of the hepatitis B virus; and if the positive signal does not exist, judging that the sample to be tested does not contain or the candidate does not contain the covalent closed circular DNA of the hepatitis B virus.
The stronger the positive signal is, the higher the content of the hepatitis B virus covalent closed circular DNA contained in the sample to be detected is; the weaker the positive signal is, the lower the content of the hepatitis B virus covalent closed circular DNA contained in the sample to be tested is.
Further, in step (a 2), the reaction conditions for performing the PCR amplification may be: pre-denaturation at 95℃for 10min; cycling for 30 times at 95 ℃ for 30s,60 ℃ for 30s and 72 ℃ for 30 s; extending at 72℃for 10min.
Further, in step (a 3), the reaction conditions may be: the positive signal was detected every 2min at 37℃for 30 times.
Further, the sample to be tested may be liver tissue, whole blood or cells, etc.
The method for detecting the covalent closed circular DNA of the hepatitis B virus provided by the invention can be a non-disease diagnosis and treatment method and also can be a disease diagnosis and treatment method. Wherein, the non-disease diagnosis and treatment method can detect whether and how much hepatitis B virus is covalently closed in cells before and after the drug is used, for example, when screening the hepatitis B control drug at the cellular level.
In a fourth aspect, the invention claims any of the following applications:
(I) Use of a substance according to the second aspect of the present disclosure for the preparation of a kit according to the first aspect of the present disclosure;
(II) use of a kit as described in the first aspect hereinbefore or a substance as described in the second aspect hereinbefore for detecting hepatitis b virus covalently closed circular DNA or for preparing a product for detecting hepatitis b virus covalently closed circular DNA;
(III) use of a kit as described in the first aspect hereinbefore or a substance as described in the second aspect hereinbefore or a method as described in the third aspect hereinbefore for the study of HBV pathogenesis or for the manufacture of a product for the study of HBV pathogenesis;
(IV) use of a kit as described in the first aspect hereinbefore or a substance as described in the second aspect hereinbefore or a method as described in the third aspect hereinbefore for screening for a hepatitis b drug or for the preparation of a product for screening for a hepatitis b drug;
(V) use of a kit as described in the first aspect hereinbefore or a substance as described in the second aspect hereinbefore or a method as described in the third aspect hereinbefore for assessing the efficacy of a medicament in a patient suffering from hepatitis b or for preparing a product for assessing the efficacy of a medicament in a patient suffering from hepatitis b.
The invention uses HBV cccDNA detection as an access point, adopts a method for detecting HBV cccDNA by combining PCR technology with CRISPR-Cas13a technology, and develops a novel HBV cccDNA detection kit by the method. The kit can simultaneously improve the specificity and sensitivity of HBV cccDNA detection, and has very important clinical application prospect and development value.
Drawings
FIG. 1 is a schematic diagram of a trans-notch primer.
FIG. 2 shows the results of PCR amplification and sequencing verification of the designed cccDNA primers. Lanes 1-6 are all negative controls, and lane 7 is a negative control, after the genome of the positive sample is extracted, the product is identified by electrophoresis after the HBVcccDNA primer amplification.
Fig. 3 is a graph showing PSAD digestion efficacy verification. Lanes 1-7 show that the digestion effect was verified by PCR after PSAD digestion of the genome extracted from the sample to be tested, if only the gene of HBV surface antigen could be amplified, but the A1AT gene located on the chromosome could not be amplified, indicating that the linear DNA had been completely digested by PSAD.
FIG. 4 is a ddPCR amplification plot of a microdroplet scatter plot.
FIG. 5 is a screen of HBV cccDNA crRNA sequences.
FIG. 6 shows the results of primer amplification before and after PSAD digestion. 1 and 2 represent two positive specimens, and the result of the amplification of HBVcccDNA and HBVrcDNA primers by taking the pre-digestion and post-digestion PSAD as templates indicates that the amplification products of rcDNA are reduced after PSAD digestion, thus indicating that the PSAD digests linear DNA, the amplification products are reduced, and the PSAD digestion effect is good.
FIG. 7 shows sensitivity detection of CRISPR-cas13a reaction system. The PCR-negative control is the negative control designed from the beginning of the PCR step (water was used as template for PCR amplification) and the CRISPR-negative control is the negative control added during transcription and CRISPR detection (water replaces PCR amplification product).
Detailed Description
The experimental methods used in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Example 1 detection of hepatitis B Virus covalently closed circular DNA based on PCR-CRISPR-cas13a
The basic principle of the method for detecting the covalent closed ring DNA (HBV cccDNA) of the hepatitis B virus based on the PCR-CRISPR-cas13a provided by the invention is as follows: the HBV cccDNA is firstly amplified by a polymerase amplification technology, then transcribed into single-stranded RNA, then CRRNA of CRISPR is specifically combined with a target fragment, and finally Cas13a is utilized to cleave the active report RNA with fluorescent signals, and the HBV cccDNA is detected by the fluorescent signals.
1. PCR amplification of HBV cccDNA specific DNA fragment
1. PCR amplification primer (cccDNA primer)
(1) Specific PCR primer F aiming at upstream of positive strand gap of hepatitis B virus genome:
5’-GGGGCGCACCTCTCTTTA-3’(SEQ ID No.2)；
the nucleic acid sequence is 18 bases in length and is complementary with the negative strand;
(2) Specific PCR primer R aiming at the downstream of the negative strand notch of the hepatitis B virus genome is connected with T7 sequence:
5’-AATTCTAATACGACTCACTATAGGGAGGCACAGCTTGGAGGC-3' (SEQ ID No.3, underlined is the T7 sequence);
the nucleic acid sequence is 42 bases in length.
The amplified fragment length of the two primers is 320 bases.
The schematic diagram of the gap-crossing primer for PCR amplification provided by the invention is shown in figure 1.
2. Related reagents
The genome extraction kit in the study is a Tiangen company product, and the DNA purification and recovery kit, 2 xTaq mix (product number MT 211-02) and ddH 2 O is Bomaide company product.
3. Preparation and detection method of standard substance
Extracting liver tissue genome of HBV infected patient with high virus load, digesting linear DNA by PSAD after EcoRI digestion (EcoRI enzyme is used for cutting circular DNA containing the digestion site in the extracted genome into linear DNA, then digesting by PSAD to remove interference in subsequent PCR, and the HBVcccDNA has no EcoRI digestion site, so that the HBVcccDNA can be preserved, the step aims to make the purity of the HBVcccDNA in the extracted genome higher and remove non-specific interference), amplifying cccDNA genome by PCR, and carrying out sequencing verification results after electrophoresis identification are shown in figure 2. As can be seen from the figure, the numbers 1-6 are all negative controls (water is used as a template) of products obtained by extracting genomes from liver tissue positive samples and then carrying out HBVcccDNA primer amplification.
And (3) taking the PSAD product as a template, and simultaneously amplifying an A1AT gene and an S gene of HBV surface antigen on a cell chromosome, wherein the S gene and the S gene are respectively used as a negative control and a positive control for detecting the PSAD digestion effect. Wherein, the primers adopted for amplifying the A1AT gene are 5'-TTCCCTGGTCTGAATGTGTG-3' and 5'-ACTGTCCCAGGTCAGTGGTG-3'; primers used for amplifying the S gene of HBV surface antigen were 5'-TCACAATACCGCAGAGTC-3' and 5'-ACATCCAGCGATAACCAG-3'. As a result, as shown in FIG. 3, the sample No. 1-7 was taken to extract genome from the sample to be tested and PSAD digested, and the digestion effect was verified by PCR, if only HBV surface antigen gene could be amplified, but A1AT gene located on chromosome could not be amplified, indicating that the linear DNA was completely digested by PSAD.
Microdroplet digital PCR was used as a standard for quantification of liver tissue extracted genomic PSAD digests from HBV infected patients with high viral load. ddPCR amplification plot microdroplet scatter plot is shown in FIG. 4. From the figure, it can be seen that the abscissa represents the number of droplets, the ordinate represents the fluorescence intensity, the negative droplets are shown in gray, the positive droplets are shown in blue, and the HBVcccDNA concentration is calculated with a poisson distribution 95% confidence.
4. PCR amplification detection
PCR reaction system: 2. Mu.l of DNA template (standard) (negative control group for the reaction using water as template) 10. Mu.l of 2 XTaq mix, 1. Mu.l of each of the upstream and downstream cccDNA primers (10. Mu.M) and water was added to 20. Mu.l.
PCR reaction conditions: the pre-denaturation at 95 ℃ for 10min, the pre-denaturation at 95 ℃ for 30s, the pre-denaturation at 60 ℃ for 30s, and the pre-denaturation at 72 ℃ for 10min are circulated for 30 times.
After the PCR was completed, 5. Mu.l of the PCR product was subjected to agarose electrophoresis.
2. CRISPR-Cas13a detection
1. Synthesis of crRNA
Designing a primer of crRNA, wherein the 5 'end of the crRNA is provided with a 39nt repeated sequence, the sequence can be combined with LwCas13a protein, a single-stranded DNA sequence is designed as an amplification template, the sequence comprises the repeated sequence and a target sequence, an upstream primer is designed to comprise a T7 sequence and a 20nt repeated sequence, and a downstream primer is designed to be a reverse complementary sequence of about 20nt at the 3' end of the target sequence, wherein the sequence is as follows:
T7-F：5’-TAATACGACTCACTATAGGGGATTTAGACTACCCCAA-3’；
HBV-F：5’-GGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACAACTTTTTCACCT CTGCCTAATC ATCTC-3’；
R：5’-GAGAT GA TTAGG CAG AGGTG-3’；
PCR reaction system: mu. l T7-F, 2. Mu.l HBV-F, 2. Mu. l R, 25. Mu.l 2 XTaq mix, add water to 50. Mu.l.
PCR reaction conditions: the pre-denaturation at 95℃for 5min, at 95℃for 30s, at 60℃for 30s, at 72℃for 15s, and the cycle was repeated 38 times, and the extension at 72℃for 10min.
And (5) recycling the glue recycling kit. crRNA was transcribed using T7Quick High Yield RNA Synthesis kit. The crRNA obtained was purified using Agencourt RNAClean XP magnetic beads.
The sequence of the finally obtained crRNA is as follows:
5'-GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAACUUUUUCACCUCUGCCUAAUCAUCUC-3' (SEQ ID No.1, anchor sequence for binding to Cas13a protein at positions 1-39; guide sequence targeting HBV cccDNA trans-notch target sequence at positions 40-68).
The target sequence of HBV cccDNA crossing notch region corresponding to crRNA shown in SEQ ID No.1 is specifically SEQ ID No.4.
2. PCR product transcription and CRISPR-Cas13a detection
The PCR product is transcribed into RNA under the action of T7 enzyme, crRNA carries Cas13 protein recognition target sequence RNA, cas13 protein is activated, report RNA is cut, and fluorescent signal is released.
Related reagents: the Cas13a protein was obtained for laboratory purification (specific procedure is as follows). The report RNA is RNaseAlert TM QC System v2, in particular Invitrogen TM Company product, cat number 4479769. 10 Xbuffer is prepared in laboratory: 400mM Tris-HCl,600mM sodium chloride, 60mM MgCl 2 。
The LwCas13a expression plasmid is Addgene company (ID: 90097) product, the plasmid is transformed into DE3 component cell Competent cells according to instructions, single colony inoculation is selected, shaking culture is carried out at 37 ℃ overnight, after sequencing identification is correct, culture medium is added for expansion culture, when the OD 600=0.6 is reached, isopropyl thiogalactoside with the final concentration of 500 mu M is added, protein expression is induced by 16h culture at 18 ℃, bacterial cells are collected by centrifugation at 4 ℃ and 5200g for 15min, lysate is added, ultrasonic disruption is carried out for 5s, 10s are stopped, ultrasonic time is 1.5h, bacterial liquid is clarified after the end, bacterial liquid is put into a centrifuge tube, centrifugation is carried out for 10min at 12000rpm and 4 ℃, imidazole is added into the collected supernatant, and a filter membrane with the final concentration of 10mM and 0.22 mu M is filtered. After the nickel column was equilibrated, the target protein was eluted by the lysed bacterial solution using 100mM, 200mM, 300mM, and 500mM imidazole in this order. The target protein obtained above was put into a dialysis bag, sealed, and put into 500ml of SUMO buffer solution (30 mM Tris-HCl,500mM sodium chloride, 1mM dithiothreitol, 0.15% NP-40), and dialyzed with stirring at 4℃for about 1 hour, and the solution was changed once and 3 times. The protein obtained after the completion of dialysis was subjected to SUMO cleavage (1000. Mu.g of protein, 2. Mu.l of SUMO enzyme, 20. Mu.l of cleavage buffer, soy Co., ltd., cat. No. P2070). And (3) carrying out ion column purification on the enzyme-digested product, after balancing the ion exchange column, eluting by adopting 200mM, 500mM, 1M sodium chloride and 0.5M sodium hydroxide in sequence, and reserving samples on each eluting peak, thereby obtaining the purified Cas13a protein after electrophoresis identification.
The reaction system: mu.l of the PCR product obtained in step one (PCR reaction) (water was used instead of PCR product as a negative control group for the reaction in this step), 1. Mu.l of Cas13a protein, 2.5. Mu.l of NTPmix, 0.4. Mu. l T7 transcriptase, 1. Mu.l of RNase inhibitor, 1. Mu.l of crRNA, 1.6. Mu.l of reporter RNA, 2.5. Mu.l of 10 Xbuffer, and RNase-free water were added to 25. Mu.l.
Reaction conditions: the detection reaction condition is 37 ℃, one cycle is carried out every 2min, the fluorescence value is read, and the cycle is carried out for 30 times.
Comparative example: three HBV cccDNA crrnas were designed in total during the experiment, specifically as follows:
crRNA1：5’-GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCACCUCUGCCUAAUCAUCUCUUUGUUCA-3’；
crRNA2：5’-GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAACUUUUUCACCUCUGCCUAAUCAUCUC-3’(SEQ ID No.1)；
crRNA3：5’-GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUUUUCACCUCUGCCUAAUCAUCUCUUGU-3’。
the operation is carried out according to the step 2. The results are shown in FIG. 5. As can be seen from the graph, since crRNA is not added in the negative control group, the fluorescence signal in the system is kept basically unchanged within the range of 447830 +/-34102, the fluorescence signal of crRNA-1 is kept at 467694 +/-6712, the difference from the negative control is small, the fluorescence signal of crRNA-3 is increased from 497296a.u. to 674538a.u., 1.5 times that of the negative control, and the fluorescence signal of crRNA-2 is increased from 484515a.u. to 1253694a.u., 2.8 times that of the negative control. The results show that: the detection group of crRNA-2 shows stronger fluorescence signal after identifying target nucleic acid, and the fluorescence signal is always strongest after the reaction starts, and finally, crRNA2 (SEQ ID No. 1) is selected as crRNA for detecting HBV cccDNA.
Example 2 sensitivity, specificity and stability experiments of the method of the invention
1. Specificity verification
The identified HBV cccDNA positive samples are used as templates for amplification, and samples before and after PSAD enzyme digestion are respectively amplified by using cccDNA primers and rcDNA primers (the distribution diagram of the primers on HBV genome is shown as figure 1).
Wherein, the cccDNA primer is the primer shown as SEQ ID No.2 and SEQ ID No.3 in the step one of the example 1. The rcDNA primers were 5'-GTTGCCCGTTTGTCCTCTAATTC-3' and 5'-GGAGGGATACATAGAGGTTCCTTGA-3'.
The results suggest that there was substantially no change in the amount of HBV cccDNA before and after PSAD enzymatic digestion, while the amount of HBV rcDNA was significantly reduced after PSAD (fig. 6), demonstrating that the cccDNA primers designed in the present invention had good specificity.
2. Sensitivity detection
The identified HBVcccDNA positive clone is quantified by ddPCR and then is used as a standard substance (namely the standard substance prepared in the step one) 10 4 The copy/. Mu.l was diluted to 1 copy/. Mu.l in a gradient, the negative control was water (PCR-negative control), and the template was detected by the method of the present invention (see example 1), and agarose gel electrophoresis was performed after PCR amplification, which revealed that the electrophoresis band after PCR amplification showed negative when 100 copy/. Mu.l was contained in the template. All PCR products, after being detected by CRISPR-Cas13a using the method of the invention (with reference to example 1), showed that at 1 copy/. Mu.l, the fluorescence values of all PCR products and negative control can be significantly different when detected for 20min, suggesting that the method of the invention has good sensitivity and can be lowTo 1 copy/. Mu.l (FIG. 7).
3. Stability test
By adopting the method, the gradient diluted standard (i.e. the standard prepared in the step one) is taken as a sample, each sample is subjected to 6 repeated experiments (performed according to the example 1), and no significant difference (p < 0.05) exists in the group. The 6 samples from clinical sources were tested 4 times repeatedly (see example 1) and there was no significant difference between the groups (p < 0.05), indicating that the method of the invention is better in stability and reproducibility.
<110> affiliated Beijing you an Hospital of university of capital medical science
<120> PCR-CRISPR-cas13 a-based kit for detecting covalently closed circular DNA of hepatitis B virus
<130> GNCLN191631
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 67
<212> RNA
<213> Artificial sequence
<400> 1
ggggauuuag acuaccccaa aaacgaaggg gacuaaaaca acuuuuucac cucugccuaa 60
ucaucuc 67
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence
<400> 2
ggggcgcacc tctcttta 18
<210> 3
<211> 42
<212> DNA
<213> Artificial sequence
<400> 3
aattctaata cgactcacta tagggaggca cagcttggag gc 42
<210> 4
<211> 28
<212> DNA
<213> Artificial sequence
<400> 4
aactttttca cctctgccta atcatctc 28
Claims (11)
1. A kit for detecting a hepatitis b virus covalently closed circular DNA, comprising a Cas13a protein and a crRNA, or a complex formed by the Cas13a protein and the crRNA;
the crRNA includes an anchor sequence for binding to Cas13a protein and a guide sequence targeting a hepatitis b virus covalently closed circular DNA trans-notch region target sequence;
the target sequence of the covalent closed circular DNA trans-notch region of the hepatitis B virus is shown as SEQ ID No. 4;
the sequence of the crRNA is shown as SEQ ID No. 1;
the kit also contains a primer pair for specifically amplifying the hepatitis B virus covalent closed circular DNA; the primer pair consists of two single-stranded DNA shown in SEQ ID No.2 and SEQ ID No. 3;
the kit also comprises the following components: t7 transcriptase, NTP, rnase inhibitor, rnase-free water, ecoR I enzyme, ATP-dependent dnase that does not degrade plasmids, reporter RNA, transcription, and CRISPR-Cas13a assay reaction buffer; the transcription and CRISPR-Cas13a detection reaction buffer is 10 Xbuffer, and comprises the following components: 400mM Tris-HCl,600mM sodium chloride, 60mM MgCl 2 。
2. The kit of claim 1, wherein: the Cas13a protein is an LwCas13a protein.
3. Kit according to claim 1 or 2, characterized in that: the reporter RNA is an RNA molecule with a signal reporting function, and can report a positive signal and be detected when the RNA sequence in the reporter RNA is degraded.
4. A kit according to claim 3, wherein: the positive signal is a fluorescent signal.
5. A non-disease diagnostic method for detecting covalently closed circular DNA of hepatitis b virus comprising the steps of:
(a1) The total DNA extracted from the sample to be detected is digested by EcoRI, and then ATP dependent DNase which does not degrade the plasmid is added to digest the non-closed linear DNA;
(a2) Taking the sample treated in the step (a 1) as a template, and carrying out PCR amplification by adopting a primer pair consisting of two single-stranded DNA shown in SEQ ID No.2 and SEQ ID No.3 to obtain a PCR product;
(a3) Preparing a transcription and CRISPR-Cas13a detection system: PCR products obtained in step (a 2), cas13a protein as defined in claim 1, crRNA as defined in claim 1, reporter RNA as defined in claim 1, T7 transcriptase as defined in claim 1, NTP, rnase inhibitor, rnase-free water, transcription and CRISPR-Cas13a assay reaction buffer; reacting; detecting a positive signal, and judging whether the sample to be detected contains the covalent closed circular DNA of the hepatitis B virus according to the existence of the positive signal; and/or judging how much hepatitis B virus covalent closed circular DNA is contained in the sample to be tested according to the intensity of the positive signal.
6. The method according to claim 5, wherein: in step (a 2), the reaction conditions for performing the PCR amplification are: pre-denaturation at 95℃for 10min; cycling for 30 times at 95 ℃ for 30s,60 ℃ for 30s and 72 ℃ for 30 s; extending at 72℃for 10min.
7. The method according to claim 5, wherein: in step (a 3), the reaction conditions are: the positive signal was detected every 2min at 37℃for 30 times.
8. Use of the kit of any one of claims 1-4 for the preparation of a product for detecting covalently closed circular DNA of hepatitis b virus.
9. Use of a kit according to any one of claims 1-4 for the preparation of a product for studying the pathogenic mechanism of HBV.
10. Use of the kit of any one of claims 1-4 for the preparation of a product for screening for a hepatitis b drug.
11. Use of a kit according to any one of claims 1 to 4 for the manufacture of a product for assessing the efficacy of a medicament for patients with hepatitis b.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910716750.1A CN110343785B (en) | 2019-08-05 | 2019-08-05 | Kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13a |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910716750.1A CN110343785B (en) | 2019-08-05 | 2019-08-05 | Kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13a |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110343785A CN110343785A (en) | 2019-10-18 |
| CN110343785B true CN110343785B (en) | 2023-05-02 |
Family
ID=68183971
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910716750.1A Active CN110343785B (en) | 2019-08-05 | 2019-08-05 | Kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13a |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110343785B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111197098B (en) * | 2020-02-20 | 2023-08-22 | 首都医科大学附属北京胸科医院 | Method for detecting mycobacterium tuberculosis from sputum |
| CN113493855B (en) * | 2020-03-19 | 2023-12-26 | 首都医科大学附属北京佑安医院 | Kit for detecting HBV cccDNA based on RAA-CRISPR-cas13a |
| CN112359146A (en) * | 2020-11-30 | 2021-02-12 | 浙江大学 | Kit for rapidly detecting hepatitis B virus gene and detection method thereof |
| CN114959108A (en) * | 2021-02-23 | 2022-08-30 | 首都医科大学附属北京佑安医院 | Kit for detecting HBV cccDNA based on RCA-PCR-CRISPR-cas13a |
| CN113667668B (en) * | 2021-08-04 | 2024-01-09 | 郑州大学 | HBV detection based on CRISPR/Cas system |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967522A (en) * | 2009-07-27 | 2011-02-09 | 北京索奥生物医药科技有限公司 | Method for performing two-color fluorescence polymerase chain reaction (PCR) detection on hepatitis B virus covalently closed circular (ccc) DNA, and application of kit |
| CN104630386A (en) * | 2015-02-03 | 2015-05-20 | 重庆医科大学附属第二医院 | Qualitative and absolute quantification kit for detecting hepatitis B virus cccDNA |
| CN108048466A (en) * | 2017-12-21 | 2018-05-18 | 嘉兴市第医院 | The crRNA and system of CRISPR-Cas13a systemic characteristics targeting people's RSPO2 genes and application |
| CN108841958A (en) * | 2018-07-03 | 2018-11-20 | 武汉博杰生物医学科技有限公司 | A kind of crRNA and its detection method of detection EGFR gene exon 2 1L858 mutation |
| CN110066865A (en) * | 2019-04-30 | 2019-07-30 | 常州桐树生物科技有限公司 | A kind of detection method and probe of the nucleic acid specific fragment based on CRISPR-Cas13a |
-
2019
- 2019-08-05 CN CN201910716750.1A patent/CN110343785B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967522A (en) * | 2009-07-27 | 2011-02-09 | 北京索奥生物医药科技有限公司 | Method for performing two-color fluorescence polymerase chain reaction (PCR) detection on hepatitis B virus covalently closed circular (ccc) DNA, and application of kit |
| CN104630386A (en) * | 2015-02-03 | 2015-05-20 | 重庆医科大学附属第二医院 | Qualitative and absolute quantification kit for detecting hepatitis B virus cccDNA |
| CN108048466A (en) * | 2017-12-21 | 2018-05-18 | 嘉兴市第医院 | The crRNA and system of CRISPR-Cas13a systemic characteristics targeting people's RSPO2 genes and application |
| CN108841958A (en) * | 2018-07-03 | 2018-11-20 | 武汉博杰生物医学科技有限公司 | A kind of crRNA and its detection method of detection EGFR gene exon 2 1L858 mutation |
| CN110066865A (en) * | 2019-04-30 | 2019-07-30 | 常州桐树生物科技有限公司 | A kind of detection method and probe of the nucleic acid specific fragment based on CRISPR-Cas13a |
Non-Patent Citations (3)
| Title |
|---|
| 《CRISPR/Cas系统在抗病毒研究中的应用》;于楠楠等;《中国生物化学与分子生物学报》;20190420;第35卷(第4期);第393-398页 * |
| 《Nucleic acid detection with CRISPR-Cas13a/C2c2》;Jonathan S Gootenberg等;《Science》;20170413;第356卷(第6336期);第438-442页 * |
| 《Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection》;Alexandra East-Seletsky等;《Nature》;20160926;第538卷(第7624期);第270-273页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110343785A (en) | 2019-10-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110343785B (en) | Kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13a | |
| CN108048466B (en) | CRRNA of CRISPR-Cas13a system specific targeting human RSPO2 gene, system and application | |
| CN108192956B (en) | Cas9 nuclease-based DNA detection and analysis method and application thereof | |
| US20180080021A1 (en) | Simultaneous sequencing of rna and dna from the same sample | |
| Huijsmans et al. | Comparative analysis of four methods to extract DNA from paraffin-embedded tissues: effect on downstream molecular applications | |
| CN107058623B (en) | High-sensitivity and specific blood HBV pgRNA fluorescent quantitative PCR detection system and detection method | |
| AU2008289447B2 (en) | Methods of using miRNA for detection of in vivo cell death | |
| CN112375847B (en) | Hepatitis B virus genotyping detection method based on CRISPR/Cas13a system | |
| US10161005B2 (en) | Method for detecting telomerase via washing-free anchored-extension and telomeric-binding amplification, and kit | |
| CN108192965B (en) | Method for detecting heterogeneity of mitochondrial genome A3243G locus | |
| CN115058543B (en) | Primer group and kit for identifying Delta variant strain and Omicron variant strain | |
| CN104024426A (en) | Tracing method and detection kit for test sample in next-generation sequencing technique of dna | |
| CN114107567A (en) | Virus nucleic acid mutation detection method and application | |
| TW201139687A (en) | Nucleic acid detection | |
| CN117210437A (en) | Enzyme identification of two gene editing tools and application of enzyme identification in nucleic acid detection | |
| CN115323075B (en) | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit | |
| CN115896316A (en) | Tuberculosis detection method | |
| CN114350854B (en) | Method for detecting SARS-CoV-269-70del locus based on RAA-CRISPR | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof | |
| WO2011022970A1 (en) | Sequencing primers for direct sequencing nucleic acid pcr products and method for sequencing by using the same | |
| US20170191061A1 (en) | Blocking hepatitis c virus infection associated liver tumor development with hcv-specific antisense rna | |
| CN113355399A (en) | Rapid detection method for coronavirus nucleic acid based on CRISPR system and colloidal gold detection strip and application thereof | |
| CN112094860A (en) | CTCF-ETO2 blood disease fusion gene and detection primer and application thereof | |
| CN117344061B (en) | Method, kit, primer and probe for simultaneously detecting five human viruses EBV, HBV, HCV, HIV, HPV and application of method | |
| CN110241255B (en) | Detection material and kit for HBV miR-3 fluorescence quantitative PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |