CN107356740A - A kind of aptamer of cortisol and the gold label test strip for detecting cortisol - Google Patents
A kind of aptamer of cortisol and the gold label test strip for detecting cortisol Download PDFInfo
- Publication number
- CN107356740A CN107356740A CN201710479899.3A CN201710479899A CN107356740A CN 107356740 A CN107356740 A CN 107356740A CN 201710479899 A CN201710479899 A CN 201710479899A CN 107356740 A CN107356740 A CN 107356740A
- Authority
- CN
- China
- Prior art keywords
- cortisol
- aptamer
- gold
- solution
- gold label
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
- G01N33/559—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody through a gel, e.g. Ouchterlony technique
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Dispersion Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses a kind of aptamer of cortisol and the gold label test strip of detection cortisol, belong to hormone test technical field.The sequence of the aptamer of the present invention is as shown in SEQ ID NO.1, and its complementary probe A sequence is as shown in SEQ ID NO.2.The gold label test strip of the present invention includes mother glass tunica fibrosa, nucleic acid probe gold standard pad, nitrocellulose membrane, water adsorption glass tunica fibrosa and plastics lining board.Adhere to the aptamer of the cortisol of colloid gold label in nucleic acid probe gold standard pad;Being drawn on nitrocellulose membrane has detection line and line of reference, and detection line is divided into by cortisol bovine serum albumin conjugate solution, and line of reference is divided into by the complementary probe solution A for combining the biotin modification of Streptavidin.The present invention can complete the detection of cortisol, as a result accurately and reliably without other supplementary instrument equipment in 10~15 minutes;Sensitivity and specificity are high, and stability is good, and cost is cheap, has a wide range of application.
Description
Technical field
The invention belongs to hormone test technical field, and in particular to the aptamer and detection cortisol of a kind of cortisol
Gold label test strip.
Background technology
Cortisol is a kind of hormone that can be called corticosteroid hormone as caused by human body natural.Somebody by its
Referred to as stress hormone, because the mankind will produce more this hormone when facing notable pressure.It is most obvious during opposing reaction.
Adrenal gland is responsible for secreting cortisol, and caused quantity also has a difference in one day, and human body has in the morning and can more utilize skin
The tendency of matter alcohol.The level of cortisol drastically raises after being got up in daily early morning in 30 minutes, and 30~45 minutes after getting up
Left and right reaches peak, was then gradually reduced in one day, minimum is reached before sleep.
The sodium that may insure to need under normal contents of cortisol in human body is not lost in, and has promotion to improve short-term note
Recall the effect of power.In addition, another function of cortisol, which is to aid in liver, removes toxin.Pressure state lower body needs cortisol
To maintain normal physiological function;If without cortisol.Body will be unable to make pressure effecting reaction, and cortisol is manipulating feelings
Contacted between thread and health, immunocyte and inflammation, blood vessel and blood pressure, and safeguard connective tissue (such as bone, muscle and skin
Skin) etc. have it is especially important the effect of.Under pressure state, cortisol can typically maintain blood pressure stabilization and control excessively hair
It is scorching.People have pressure, those in which bears to repeat the people of pressure, either the nervous people of rhythm of life or go on a diet
People, or people of the sleep less than 8 hours every night, are probably under pressure condition, so that their cortisol for a long time
It is horizontal long-term higher.At this moment the negative effect of cortisol starts to be revealed as the variation of metabolism:Blood glucose rise, appetite increase,
Body weight rises, sexual hypoesthesia and extremely tired etc..Hypercortisolism can cause cushing's syndrome, the result is that body
Increase sharply again, hidrosis, easy bruise, mental handicape.Low cortisol symptom easily causes Addison disease, causes Body weight loss, flesh
Meat pain, emotional instability and it is tired the problems such as.Hypercortisolemic can cause sugar, protein, fat, metabolic disturbance of electrolyte and
A variety of organ function obstacles.Generalized anxiety disorder (Generalized anxiety disorder, GAD) is most common one
Kind anxiety disorder, its lifetime prevalence in adult are estimated as 4.1%~6.6%, and female patient is 2 times of male.It is not
The quality of life, mental health, social function of patient are only had a strong impact on, while can also increase suicide wind with other diseases comorbidity
Danger, it has also become can not be ignored the problem of.Determination of cortisol in the symptom and human body of this anxiety has very big relation.
In biopsychology research, cortisol (rodent is cortisone) is a kind of very important hormone, and it is referred to as " pressure
Hormone ", when human body faces physiology, Psychological stimulation, its secretory volume increases (stress reaction).Reduce pressure and learn relaxation skills
Corticosteroid hormone excessive secretion is helped avoid, often taking exercise can also help to reduce this hormone.
At present, cortisol measure is more using radioimmunology, ELISA, LC-MS methods.Immunization sensitivity is higher,
The trace cortisol being capable of detecting when in hair, but it is higher cross reaction, measurement result to be present.Various commercial immunoreagents
The result difference of box measure is higher, and the cost of kit is also costly.Although LC-MS methods are accurate sensitive, costliness is needed
Instrument, therefore common laboratory is difficult to popularize.Traditional various detection methods, process is complicated, and time-consuming, and cost is high, and can not
Ensure the stability between criticizing.Therefore the cortisol in human body is timely and effectively detected, understands the body of oneself at that time for us
Situation has very important significance, and contributes to us to take next step action to improve the animation of oneself.
The content of the invention
It is an object of the invention to solve problems of the prior art, there is provided a kind of aptamer of cortisol,
The complementary probe of the aptamer, and the gold label test strip for the detection cortisol being made up of the aptamer, probe
And its preparation method.
The purpose of the present invention is achieved through the following technical solutions:
A kind of aptamer of cortisol, its nucleotide sequence are as follows:
5’-GCAGAGGATCATGATGCGGGGTGGAGAATGGGCCGCACTTCGGCTTCACTCTTG
GCAGAAAAGCTT-3’(SEQ ID NO.1)。
Preferably, sulfydryl modification is passed through at 5 ' ends of described aptamer.
It is as follows with the complementary probe A of above-mentioned aptamer complementary pairing, its nucleotide sequence:
5’-AAGCTTTTCTGCCAAGAGTGAAGCCGAAGT-3’(SEQ ID NO.2)。
Preferably, biotin modification is passed through at described complementary probe A 5 ' ends.
A kind of gold label test strip for detecting cortisol, includes mother glass tunica fibrosa, nucleic acid probe gold standard pad, cellulose nitrate
Film, water adsorption glass tunica fibrosa and plastics lining board.Adhere to the core of the cortisol of colloid gold label in described nucleic acid probe gold standard pad
Sour aptamers.Being drawn on described nitrocellulose membrane has detection line and line of reference, and detection line is by cortisol-bovine serum albumin conjugate
Solution is divided into, and line of reference is divided into by the complementary probe solution A for combining the biotin modification of Streptavidin.Mother glass fiber
Film, nucleic acid probe gold standard pad, nitrocellulose membrane, water adsorption glass tunica fibrosa overlap be pasted onto on plastics lining board successively, cellulose nitrate
The line of reference of film is close to water adsorption glass tunica fibrosa one end.
Preferably, method system of the aptamer of the cortisol of described colloid gold label by comprising the following steps
It is standby:Acetate buffer solution and TCEP (three (2- carboxyethyls) phosphines) solution are mixed, then add the cortisol of sulfydryl modification thereto
Aptamer, sulfhydryl activated reaction is carried out, react and add solution of gold nanoparticles after terminating thereto, concussion reaction 0.5~
1.5 hour;Add dATP, 18~25 DEG C of concussion reactions stand 20~40 minutes after 10~30 minutes, then at 2~8 DEG C it is quiet
Put 4~6 hours;It is then centrifuged for, precipitation is the aptamer of the cortisol of colloid gold label, is dissolved with phosphate buffer.
It is furthermore preferred that in this method:The concentration of acetate buffer solution is 0.1~0.6mol/L, pH value 4.0~6.0, the μ L of dosage 1~5;
The concentration of TCEP solution is 1~10mmol/L, the μ L of dosage 1~10;The concentration of the aptamer of the cortisol of sulfydryl modification is 1
~100 μm of ol/L, the μ L of dosage 1~10;The concentration of solution of gold nanoparticles is 6~10OD values (540nm absorbances), gold nano
Particle diameter is 30~40nm, the μ L of dosage 50~100;DATP concentration is 1~10 μm of ol/L, the μ L of dosage 50~100;Phosphoric acid delays
The concentration of fliud flushing is 0.01~0.05mol/L, pH value 7~8, the μ L of dosage 400~600.
Preferably, the complementary probe solution A of the described biotin modification for combining Streptavidin passes through including as follows
It is prepared by the method for step:By the complementary probe solution A and 200 of the biotin modification of 40~80 μ 1~10OD of L values (absorbance)
1~3 hour is stood at 18~30 DEG C after~300 1~5mg/mL of μ L solution of streptavidin mixing, then is added thereto
The phosphate buffer solution of 500~600 μ 0.001~1.000M of L pH value 6.0~8.0.
Above-mentioned gold label test strip, the detection particularly suitable for cortisol in saliva.It is pure and strong by detecting the cortex in saliva
, significant correlation be present using the concentration of cortisol in concentration of cortisol and blood micro in saliva, so as to extrapolate people in degree
The cortisol levels of body, it is a kind of Noninvasive testing scheme, the pressure condition faced available for monitoring people's daily life.
During using above-mentioned gold label test strip, saliva sample is infiltrated or is added drop-wise to mother glass tunica fibrosa, because capillary shows
As saliva sample chromatographs to the opposite end of mother glass tunica fibrosa, and cortisol can fit with the nucleic acid in gold standard pad in chromatography process
Ligand binding simultaneously continues to move together, and when chromatography is to detection line, cortisol-bovine serum albumin conjugate competition binding nucleic acid is fitted
Part, Determination of cortisol is more in saliva, and the color of detection line is more shallow.Aptamer and complementary probe when chromatographing line of reference
A is combined, and collaurum will be adsorbed on line of reference.The depth finally to develop the color is by the way that (gradient concentration standard items are marked in gold with reference colour
Colour developing situation in test strips) contrast concentration with regard to cortisol can be obtained.
The preparation method of above-mentioned gold label test strip, comprises the following steps:Prepare nucleic acid probe gold standard pad, draw have detection line and
The nitrocellulose membrane of line of reference;By mother glass tunica fibrosa, nucleic acid probe gold standard pad, nitrocellulose membrane and water adsorption glass tunica fibrosa
Overlap joint is pasted on plastics lining board successively, and the length of overlapped part between adjacent two paste is preferably 1~3mm, dries encapsulation,
Preserved under the conditions of 4~25 DEG C.
Compared with prior art, the present invention has advantages below and beneficial effect:
(1) this big distinguishing feature of nano-particle specific surface area is applied to the foundation of traditional gold label test strip by the present invention
With corresponding detection method, the colloid gold label test paper based on nucleic acid probe available for live fast super sensitivity detection is established
Bar and related detection method, realize the fast qualitative detection of target detection thing by direct visual perception and pass through test strip
The reduction of upper colour developing degree carries out quantitative detection to target detection thing.Without other supplementary instrument equipment, detection work can be 10
Completed in~15 minutes and obtain testing result.
(2) present invention is the universal colloidal gold mark test paper based on colloid gold label aptamers, only need to be by test strips
Middle aptamers are accordingly replaced, you can realize the detection of other objects.
(3) present invention also has specificity height, and stability is good, has a wide range of application, and cost is cheap, and operate with method is simple
Application easy to spread.It can be applied to the needs such as the ports such as customs, the airport of hospital, family and food security and inspection and quarantine
Field quick detection mechanism.
(4) detection method in the present invention, which need not puncture, takes blood, it is only necessary to takes saliva, sampling is simple, belongs to non-intruding
Formula detects, and detection method is simple, and cost is cheap.
Brief description of the drawings
Fig. 1 is the side structure schematic diagram of the gold label test strip based on colloidal gold labeled monoclonal antibody, sequence number in figure:1 sample glass
Glass tunica fibrosa, 2 nucleic acid probe gold standard pads, 3 nitrocellulose membranes, 4 detection lines, 5 line of reference, 6 water adsorption glass tunica fibrosas, 7 plastic linings
Plate.
Fig. 2 is that the positive testing result of the gold label test strip based on colloidal gold labeled monoclonal antibody judges schematic diagram.
Fig. 3 is gold label test strip to feminine gender, weakly positive, the positive and invalid testing result figure.
Fig. 4 is saliva and the urine sample testing result figure of the cortisol containing various concentrations, wherein, A is that nucleic acid of the present invention is fitted
Part, B are contrast aptamer.
Embodiment
With reference to specific embodiment, the invention will be further described, so that those skilled in the art can be more preferable
Understand the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.
Embodiment 1
(1) synthesis of aptamer and complementary probe
The aptamer of sulfydryl modification is passed through at the end of synthesis 5 ':
5’-SH-GCAGAGGATCATGATGCGGGGTGGAGAATGGGCCGCACTTCGGCTTCACTCT
TGGCAGAAAAGCTT-3’;
The complementary probe A of biotin modification is passed through at the end of synthesis 5 ':
5’-biotin-AAGCTTTTCTGCCAAGAGTGAAGCCGAAGT-3’。
It is below the aptamer and correspondent probe for contrast test:
The aptamer of sulfydryl modification is passed through at 5 ' ends of synthesis contrast:
5’-SH-CAACGAGTCACTGTTTCTGGGTGGAGAATGGGCCGCACTTCGGCTTCACAAC
GAGTCACTGTTTCT-3’;
The complementary probe of biotin modification is passed through at 5 ' ends of synthesis contrast:
5’-biotin-AGAAACAGTGACTCGTTGTGAAGCCGAAGT-3’。
(2) preparation of colloidal gold solution
By the acetate buffer solution and 1.5 μ L 10mM TCEP (three (2- carboxyethyls) phosphines) solution that 1 μ L 0.5M pH are 5.9
Add the aptamer solution of 9 μ L, 100 μM of sulfydryl modifications after mixing thereto again, react 1h at 25 DEG C after well mixed,
The aptamer solution of sulfydryl is activated.
It is 7OD that 100 μ L collaurums (30~40nm of particle diameter) concentration are added into the aptamer solution for having activated sulfydryl
The solution of value, shaken 30 minutes at 25 DEG C, obtain aptamer modified collaurum intermediate solution 1.
85 μ L, 10 μM of dATP solution are added into aptamer modified collaurum intermediate solution 1, are shaken at 25 DEG C
30 minutes are stood after swinging reaction 15 minutes, then 6 hours are stood at 4 DEG C, is obtained molten among aptamer modified collaurum
Liquid 2.
Aptamer modified collaurum intermediate solution 2 is centrifuged 8 minutes under the conditions of 10000 revs/min, discarded
Clear liquid.The sediment obtained with the phosphate buffer dissolving centrifugation that 100 μ L 0.01M pH are 7.4, is obtained aptamer modified
Colloidal gold solution.
(3) preparation of target detection thing nucleic acid probe gold standard pad
Aptamer modified colloidal gold solution is sprayed on glass fibre membrane, obtains target detection thing nucleic acid probe
Gold standard pad.
(4) there is the preparation of the nitrocellulose membrane of detection line and line of reference
The solution of streptavidin of the complementary probe solution A of 50 μ L 10OD biotin modifications and 270 μ L 2mg/mL is mixed
1 hour is stood at 25 DEG C after conjunction, the phosphate buffer solution that 520 μ L 0.01M pH are 7.4 is added thereto and is combined
The complementary probe solution A of the biotin modification of Streptavidin.
The cortisol for being 1mg/mL with concentration on one piece of nitrocellulose membrane-bovine serum albumin conjugate solution and concentration are
The complementary probe solution A of the 2.5mg/mL biotin modification for combining Streptavidin draws the parallel line of two lines, skin respectively
Matter alcohol-bovine serum albumin conjugate solution line is used as detection line (T lines), the complementary probe of the biotin modification of Streptavidin
Solution A is scribed ss line of reference (C lines).
(5) preparation of gold label test strip
As shown in figure 1, by mother glass tunica fibrosa 1, target detection thing nucleic acid probe gold standard pad 2, draw have the and of detection line 4
6 five kinds of pastes of nitrocellulose membrane 3 and water adsorption glass tunica fibrosa of line of reference 5 paste on plastics lining board 7 successively respectively;It is adjacent
The length of lap between paste is 2mm, obtains the gold label test strip based on nucleic acid probe, dries and encapsulates, 4~25 DEG C
Under the conditions of preserve.
In use, the end of mother glass tunica fibrosa 1 of gold label test strip is inserted into saliva sample to be detected, set simultaneously
A blank control group is put, the testing result that detects by an unaided eye is taken out after waiting 10 minutes.If the detection line 4 on nitrocellulose membrane 3
Developed the color simultaneously with line of reference 5 and show that testing result is effective;Compared with the detection line of blank control group, if detection group
Detection line lighter shows to contain object cortisol-specif antigen in detected sample, develops the color and get over the bright test sample to be checked of superficial
Cortisol-specif antigen concentration is higher in product, is positive findings;If only detection line develops the color and line of reference does not develop the color, show
Testing result is invalid.
How the content of cortisol in detection sample to be judged by the testing result of the gold label test strip of the present invention,
It is the important component of detection method, the basis for estimation schematic diagram of testing result is referring to Fig. 2:It is successively from left to right in Fig. 2
Feminine gender, weakly positive, positive and invalid testing result schematic diagram.Wherein, sequence number 1 is mother glass tunica fibrosa, and length is
18mm;Sequence number 2 is nucleic acid probe gold standard pad, length 4mm;Sequence number 3 is nitrocellulose membrane, length 20mm;Sequence number 6 is water suction
Glass fibre membrane, length 18mm, sequence number 4 are detection line, width 1mm, and sequence number 5 is line of reference, width 1mm.Arrow in figure
Head represents liquid capillarity direction.
Feminine gender, weakly positive, positive and invalid detection material object result photo are from left to right corresponding in turn to referring to Fig. 3
Feminine gender, weakly positive, the positive in Fig. 2 and invalid.Feminine gender is that concentration of cortisol is 0nM;The weakly positive concentration of saliva detection is 10
~20nM, the positive concentration of saliva detection is 20~50nM;The weakly positive concentration of urine detection is 50~150nM, urine detection
Positive concentration be 150~200nM.The result of multiplicating experiment is consistent, shows that the ELISA test strip result of the present invention is accurate
Reliably.
Embodiment 2
Prepared according to the method described in embodiment 1, use gold label test strip.Take respectively containing 0nM, 10nM, 15nM,
The saliva sample of 20nM, 50nM cortisol is detected, and testing result is shown on the left of Fig. 4 A, and the colour developing of T lines is from by force to weak, detection
Concentration range:0~50nM;The urine sample respectively containing 0nM, 50nM, 100nM, 150nM, 200nM cortisol is taken to be examined
Survey, shown on the right side of Fig. 4 A, T lines develop the color from by force to weak, the concentration range of detection testing result:0~200nM.
Fig. 4 B are the result of contrast test (using contrast aptamer, the contrast probe in embodiment 1), take and contain respectively
The saliva sample for having 0nM, 10nM, 15nM, 20nM, 50nM cortisol is detected, and testing result is shown on the left of Fig. 4 B, T lines
Colour developing is overall very weak;Take the urine sample respectively containing 0nM, 50nM, 100nM, 150nM, 200nM cortisol to be detected, examine
Result is surveyed shown on the right side of Fig. 4 B, the colour developing of T lines is overall very weak.Saliva and urine sample testing result shown in Fig. 4 B are tied with Fig. 4 A
Fruit compares, and shows used by contrast test aptamer with the compatibility of cortisol not as the nucleic acid of the present invention is adapted to
Body.
Embodiment described above is only to absolutely prove preferred embodiment that is of the invention and being lifted, protection model of the invention
Enclose not limited to this.The equivalent substitute or conversion that those skilled in the art are made on the basis of the present invention, in the present invention
Protection domain within.
SEQUENCE LISTING
<110>China surveys Kang Nuo(Wuhan)Bio tech ltd
<120>A kind of aptamer of cortisol and the gold label test strip for detecting cortisol
<130> 1
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 66
<212> DNA
<213> Artificial
<220>
<223>The aptamer of cortisol
<400> 1
gcagaggatc atgatgcggg gtggagaatg ggccgcactt cggcttcact cttggcagaa 60
aagctt 66
<210> 2
<211> 30
<212> DNA
<213> Artificial
<220>
<223>Complementary probe A
<400> 2
aagcttttct gccaagagtg aagccgaagt 30
<210> 3
<211> 66
<212> DNA
<213> Artificial
<220>
<223>Contrast aptamer
<400> 3
caacgagtca ctgtttctgg gtggagaatg ggccgcactt cggcttcaca acgagtcact 60
gtttct 66
<210> 4
<211> 30
<212> DNA
<213> Artificial
<220>
<223>Contrast complementary probe
<400> 4
agaaacagtg actcgttgtg aagccgaagt 30
Claims (10)
- A kind of 1. aptamer of cortisol, it is characterised in that:Nucleotide sequence is as shown in SEQ ID NO.1.
- 2. aptamer according to claim 1, it is characterised in that:Sulfydryl modification is passed through at 5 ' ends.
- A kind of 3. complementary probe A of aptamer complementary pairing with described in claim 1, it is characterised in that:Nucleotides sequence Row are as shown in SEQ ID NO.2.
- 4. complementary probe A according to claim 3, it is characterised in that:Biotin modification is passed through at 5 ' ends.
- A kind of 5. gold label test strip for detecting cortisol, it is characterised in that:Include mother glass tunica fibrosa, nucleic acid probe gold mark Pad, nitrocellulose membrane, water adsorption glass tunica fibrosa and plastics lining board;Adhere to colloid gold label in described nucleic acid probe gold standard pad The aptamer of cortisol;Being drawn on described nitrocellulose membrane has detection line and line of reference, and detection line is by cortisol-cow's serum Protein conjugate solution is divided into, and line of reference is divided into by the complementary probe solution A for combining the biotin modification of Streptavidin;Sample Product glass fibre membrane, nucleic acid probe gold standard pad, nitrocellulose membrane, water adsorption glass tunica fibrosa overlap be pasted onto plastics lining board successively On, the line of reference of nitrocellulose membrane is close to water adsorption glass tunica fibrosa one end.
- 6. gold label test strip according to claim 5, it is characterised in that:The nucleic acid of the cortisol of described colloid gold label Aptamers are prepared by a method comprising the following steps:Acetate buffer solution and TCEP solution are mixed, then add right thereto It is required that the aptamer described in 2, carries out sulfhydryl activated reaction, reaction adds solution of gold nanoparticles thereto after terminating, and shakes Swing reaction 0.5~1.5 hour;DATP is added, 18~25 DEG C of concussion reactions stand 20~40 minutes after 10~30 minutes, then 4~6 hours are stood at 2~8 DEG C;It is then centrifuged for, precipitation is the aptamer of the cortisol of colloid gold label.
- 7. gold label test strip according to claim 6, it is characterised in that:In described method, the concentration of acetate buffer solution For 0.1~0.6mol/L, pH value 4.0~6.0, the μ L of dosage 1~5;The concentration of TCEP solution is 1~10mmol/L, dosage 1~10 μL;The concentration of aptamer is 1~100 μm of ol/L, the μ L of dosage 1~10;The concentration of solution of gold nanoparticles is 6~10OD Value, gold nanometer particle grain size is 30~40nm, the μ L of dosage 50~100;DATP concentration is 1~10 μm of ol/L, dosage 50~100 μL。
- 8. gold label test strip according to claim 5, it is characterised in that:The described biotin for combining Streptavidin The complementary probe solution A of modification is prepared by a method comprising the following steps:By 40~80 μ L 1~10OD values claims 4 institutes The complementary probe solution A and 200~300 1~5mg/mL of μ L solution of streptavidin stated are stood after mixing at 18~30 DEG C 1~3 hour, then the phosphate buffer solution of 500~600 μ 0.001~1.000M of L pH value 6.0~8.0 is added thereto.
- 9. the preparation method of any described gold label test strip of claim 5~8, it is characterised in that:Comprise the following steps:Prepare Nucleic acid probe gold standard pad, draw the nitrocellulose membrane for having detection line and line of reference;By mother glass tunica fibrosa, nucleic acid probe gold mark Pad, nitrocellulose membrane and water adsorption glass tunica fibrosa overlap paste on plastics lining board successively.
- 10. preparation method according to claim 9, it is characterised in that:Length of overlapped part between adjacent two paste For 1~3mm.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710479899.3A CN107356740A (en) | 2017-06-22 | 2017-06-22 | A kind of aptamer of cortisol and the gold label test strip for detecting cortisol |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710479899.3A CN107356740A (en) | 2017-06-22 | 2017-06-22 | A kind of aptamer of cortisol and the gold label test strip for detecting cortisol |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107356740A true CN107356740A (en) | 2017-11-17 |
Family
ID=60273752
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710479899.3A Pending CN107356740A (en) | 2017-06-22 | 2017-06-22 | A kind of aptamer of cortisol and the gold label test strip for detecting cortisol |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107356740A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108294766A (en) * | 2018-01-31 | 2018-07-20 | 华测康诺(武汉)生物科技有限公司 | A kind of Portable psychology pressure detecting instrument |
CN111398587A (en) * | 2020-04-02 | 2020-07-10 | 安徽科技学院 | Colloidal gold lateral chromatography test strip for detecting cervical cancer and preparation method thereof |
CN111979247A (en) * | 2020-05-11 | 2020-11-24 | 广东省药品检验所(广东省药品质量研究所、广东省口岸药品检验所) | Aptamer of beclomethasone as well as screening method and application thereof |
CN117629923A (en) * | 2022-08-19 | 2024-03-01 | 南开大学 | Quantitative test method for pressure and depression markers of multiple signal outputs and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102660547A (en) * | 2012-05-17 | 2012-09-12 | 中国人民解放军军事医学科学院基础医学研究所 | Cortisol hormone aptamer and application thereof |
CN103983774A (en) * | 2014-06-03 | 2014-08-13 | 合肥工业大学 | Probe capable of specifically identifying bisphenol A nucleic acid aptamer and test strip detection application of probe |
-
2017
- 2017-06-22 CN CN201710479899.3A patent/CN107356740A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102660547A (en) * | 2012-05-17 | 2012-09-12 | 中国人民解放军军事医学科学院基础医学研究所 | Cortisol hormone aptamer and application thereof |
CN103983774A (en) * | 2014-06-03 | 2014-08-13 | 合肥工业大学 | Probe capable of specifically identifying bisphenol A nucleic acid aptamer and test strip detection application of probe |
Non-Patent Citations (1)
Title |
---|
AZRUL SYAFIQ ZAINOL ABIDIN ET AL: "Current and Potential Developments of Cortisol Aptasensing towards Point-of-Care Diagnostics (POTC)", 《SENSORS》 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108294766A (en) * | 2018-01-31 | 2018-07-20 | 华测康诺(武汉)生物科技有限公司 | A kind of Portable psychology pressure detecting instrument |
CN111398587A (en) * | 2020-04-02 | 2020-07-10 | 安徽科技学院 | Colloidal gold lateral chromatography test strip for detecting cervical cancer and preparation method thereof |
CN111398587B (en) * | 2020-04-02 | 2023-02-28 | 安徽科技学院 | Colloidal gold lateral chromatography test strip for detecting cervical cancer and preparation method thereof |
CN111979247A (en) * | 2020-05-11 | 2020-11-24 | 广东省药品检验所(广东省药品质量研究所、广东省口岸药品检验所) | Aptamer of beclomethasone as well as screening method and application thereof |
CN117629923A (en) * | 2022-08-19 | 2024-03-01 | 南开大学 | Quantitative test method for pressure and depression markers of multiple signal outputs and application thereof |
CN117629923B (en) * | 2022-08-19 | 2024-08-23 | 南开大学 | Quantitative test method for pressure and depression markers of multiple signal outputs and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107356740A (en) | A kind of aptamer of cortisol and the gold label test strip for detecting cortisol | |
Lac | Saliva assays in clinical and research biology | |
Ellison | Human salivary steroids: methodological considerations and applications in physical anthropology | |
CN102298055B (en) | Human blood H-FABP nano-gold labeled test paper and preparation method thereof | |
CN1888906B (en) | Clenbuterol hydrochloride-Ractopamine dual union detection card and method for processing detected samples thereof | |
CN105092861A (en) | Immunofluorescence chromatography test paper for CRP (C-reaction protein)/SAA (Serum amyloid A protein) quantitative combined detection and preparation method of immunofluorescence chromatography test paper | |
CN102297966A (en) | Progesterone semi-quantitative determining colloidal gold test paper and preparation method thereof | |
CN108254550A (en) | Detect time-resolved fluoroimmunoassay chromatograph test strip, kit of CK-MB and preparation method thereof | |
CN101025415A (en) | Test paper for detecting uric acid content range in urine | |
CN105572393B (en) | The aptamer and detection gold label test strip of a kind of estradiol based in saliva | |
CN102288753A (en) | Quadruple colloidal gold immunochromatography testing strip for rapid detection of residual tetracycline, chlortetracycline, oxytetracycline and doxycycline and preparation method of same | |
CN204964521U (en) | CRPSAA ration jointly detects immunofluorescence chromatography test paper | |
CN103018452A (en) | Salbutamol drug detection colloidal gold test paper card and detection method | |
FI20196004A1 (en) | Device and method for detecting of brain injury in a subject | |
CN102590508A (en) | Immunochromatographic strip for detecting viscerotropic leishmania infection and diagnosing kala-azar | |
CN203350261U (en) | Test paper card for quickly detecting dexamethasone | |
Kirchner et al. | Dietary influences on the hydration and acid–base status of experimentally dehydrated dairy calves | |
CN102213723A (en) | Doxycycline detection kit and preparation method thereof | |
CN203148947U (en) | Cyproheptadine immunochromatography rapid test paper card | |
CN110488004A (en) | A kind of 25-hydroxy-vitamin D kit and its preparation method and application for detecting peripheral blood | |
US20120034641A1 (en) | Biological information acquisition method | |
CN103884846A (en) | Detection method for biological activity of liraglutide | |
CN202362306U (en) | Tricyclic antidepressant colloid gold detection kit | |
Maw et al. | The relation of growth hormone to altered carbohydrate metabolism in women taking oral contraceptives | |
Laudenslager et al. | Saliva as a medium for assessing cortisol and other compounds in nonhuman primates: collection, assay, and examples |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171117 |