CN107312798B - CRISPR/Cas9 recombinant lentiviral vector containing gRNA sequence of specific targeting CCR5 gene and application - Google Patents
CRISPR/Cas9 recombinant lentiviral vector containing gRNA sequence of specific targeting CCR5 gene and application Download PDFInfo
- Publication number
- CN107312798B CN107312798B CN201710457591.9A CN201710457591A CN107312798B CN 107312798 B CN107312798 B CN 107312798B CN 201710457591 A CN201710457591 A CN 201710457591A CN 107312798 B CN107312798 B CN 107312798B
- Authority
- CN
- China
- Prior art keywords
- ccr5
- cells
- crispr
- gene
- cas9
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Abstract
The invention discloses a CRISPR/Cas9 recombinant lentiviral vector containing a gRNA sequence of a specific targeting CCR5 gene and application thereof. The lentivirus obtained by constructing the CRISPR/Cas9 recombinant lentivirus vector containing the gRNA sequence of the delta 32 region of the specific targeting CCR5 gene can introduce a CCR5 specific CRISPR/Cas9 system into cells, generate double-strand break at a specific site of the CCR5 gene, introduce random mutation at the break site after being repaired by a non-homologous recombination end-combined repairing mode, and the mutation rate is as high as about 90%. Since the grnas are in non-homologous regions of CCR5 and CCR2, the off-target efficiency of the two grnas was detected to be less than 0.2%. The HIV infection efficiency of the cells modified by the recombinant lentivirus is obviously reduced. The system is rapid, simple and cheap in construction, and is suitable for AIDS gene therapy.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to a method for specifically knocking out a human CCR5 gene by CRISPR/SaCas9 and a gRNA for specifically targeting a CCR5 gene.
Background
Human Immunodeficiency Virus (HIV) belongs to the family of retroviruses of the lentivirus genus and can cause infection by the HIV virus and acquired immunodeficiency syndrome (AIDS). AIDS is a state of progressive failure of the human immune system, causing life-threatening opportunistic infections and cancer, and if left untreated, has an average survival time of only about 9 to 11 years after HIV infection, and depends on the HIV subtype of infection. Since the first clinical discovery of AIDS in 1981, an increasing number of people have been tested for HIV infection, which has remained a global public health problem over the past 30 years. At present, about 3400 ten thousand people are infected with HIV, and in 2014, 120 thousand people die globally from diseases caused by HIV infection. Although anti-retroviral drug therapy can control the virus so that patients can enjoy health and a longer life span, there is currently no effective way to cure HIV infection. Therefore, there is a need to develop new AIDS therapies, and gene therapies emerging recently have promising prospects, and many groups have made relevant studies.
In 1996, the CCR5 co-receptor that is deleted from the cell surface was first considered as a method to protect against HIV infection, and then several methods have been used to develop new HIV therapeutics targeting CCR 5. methods to down-regulate or inhibit the expression of CCR5 gene include ribozymes (Zinc-finger nucleare, CCR 18 n), transcription activator-like effector nucleases (transcription activator-like effectors) and zf codon 18, zf, etc.), which are difficult to be used to protect against HIV infection in humans, and thus, the CCR 9634 gene knockout technology has been found to be more effective in HIV infection, and the CCR 9634 gene knockout technology has been found to be more effective in HIV infection, thus, the CCR 9-CD 18 gene can be expected to be used in humans.
The CRISPR/Cas system is developed from an adaptive immune system of bacteria and archaea for resisting foreign viruses or plasmids and comprises three different types, wherein the DNA endonuclease Cas9 of the CRISPR/Cas system of Type II only has one subunit, has the simplest structure and is most widely applied. In addition to the Cas9 protein, the system includes two short crisprrnas (crRNAs) and trans-activating crRNAs (tracrRNA). The mature crRNA-tracrRNA complex can guide the Cas9 protein to a target sequence through base complementary pairing, and specifically cut a DNA double strand near PAM (promoter adjacent motif) to form DSB (double strand break). DSB can be repaired in two ways, one is Non-Homologous recombination End Joining (Non-Homologous Joining NHEJ) DNA Repair mode, and the other is Homologous recombination Repair (Homology Directed Repair HDR) mode. The NHEJ repair may result in base insertions or deletions resulting in frame shift mutations or may also result in stop codons, all of which alter the open reading frame of the gene of interest; the HDR approach requires a template fragment homologous to the cleaved fragment to repair the DSB by copying the sequence of the homologous fragment used as a template into the target gene, so that the specific gene fragment can be introduced into the target gene by using the repair method.
The CRISPR/Cas system has the characteristics of simplicity in operation, higher cutting efficiency and the like, and is considered to have better application prospect. The development of some high-efficiency gRNAs which target CCR5 gene and have lower off-target efficiency is very important for the CRISPR/Cas9 system to fully play a role, and has greater application value.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides a CRISPR/Cas9 recombinant lentiviral vector containing a gRNA sequence specifically targeting CCR5 gene, which can effectively mutate CCR5 gene and inhibit the expression thereof, thereby inhibiting the infection of HIV on cells.
In order to achieve the above purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a CRISPR/Cas9 recombinant lentiviral vector containing a gRNA sequence specifically targeting a CCR5 gene, wherein the CRISPR/Cas9 recombinant lentiviral vector is obtained by digesting a lentiviral vector lentilCRISPR v2(AddgeneiD:52961) with BsmBI and recombining a gRNA sequence of the specific targeting CCR5 gene connected with a BsmBI cohesive end, the gRNA sequence of the specific targeting CCR5 gene is shown as SEQ ID NO.1 or 2, and the target sequence is positioned in a delta 32 region of a CCR5 gene and in a non-homologous region of CCR5 and CCR 2.
In a second aspect, the invention provides a lentivirus comprising the CRISPR/Cas9 recombinant lentiviral vector of the first aspect.
In a third aspect, the invention provides an application of the CRISPR/Cas9 recombinant lentiviral vector in the first aspect in preparation of a CCR5 mutation inducing reagent.
In a fourth aspect, the invention provides the use of the CRISPR/Cas9 recombinant lentiviral vector of the first aspect in the preparation of a medicament for the treatment and/or prevention of HIV infection.
The technical scheme of the invention is realized by the following specific embodiments:
firstly, designing and constructing a high-efficiency gRNA targeting CCR5 gene in a human genome and a target site sequence thereof.
The gene sequence of CCR5 was found in Genebank, and gRNAs were designed by evaluating the higher scoring target sites on the CCR5 sequence using the Crispr design tool and the gRNA design rules, which included: 1) whether PAM (NGG) exists downstream of the sequence, 2) the target site can not be identical or similar to the human genome sequence, and the off-target efficiency is low (figure 1);
according to the designed gRNA, CACC is added to the 5 'end of the gRNA to obtain a forward oligonucleotide sequence, AAAC is added to the 5' end of the complementary strand of the gRNA to obtain a reverse oligonucleotide sequence, the forward and reverse oligonucleotide sequences are respectively synthesized, and then the synthesized sequences are denatured and annealed to obtain a double-stranded DNA fragment with BsmBI cohesive ends as follows:
forward direction: 5' -CACCNNNNNNNNNNNNNNNNNNNN
And (3) reversing: NNNNNNNNNNNNNNNNNNNNCAAA-5'
Connecting the double-stranded DNA fragment with a lentilCRISPR v2 vector cut by BsmBI enzyme; and transforming the ligation product into escherichia coli JM109 competent cells, coating the competent cells on an LB plate with ampicillin resistance, screening positive colonies, extracting positive colony plasmids, analyzing and sequencing the positive colony plasmids, and determining that the gRNA expression vector is successfully constructed (named lentiCRISPRv2-CCR5 gRNA).
And secondly, screening the gRNA for guiding the CRISPR/Cas9 system to efficiently mutate the specific site of the CCR5 gene and determining the mutation efficiency.
The mutation efficiency of the gRNA on the CCR5 gene is analyzed and detected in a 293T cell line, and 2 effective gRNAs (named as T7 and T8 respectively) are screened, and the corresponding DNA sequences of the effective gRNAs are shown in SEQ ID NO.1 or 2.
The constructed lentiCRISPR v2-CCR5gRNA plasmid was co-transfected with plasmids psPAX2 and pMD2.G, respectively, to package lentiviruses in 293T cells, and as controls were co-transfected with gRNAs specifically targeting the knockout of green fluorescent protein and effective CCR5-gRNA3 (the target site of which is located at base 260-279 of exon 3 of the CCR5 gene) which had been published by the Wuhan virus institute of university research with plasmids psPAX2 and pMD2. G. Collecting culture supernatant after 72 hr to obtain lentivirus, filtering with 0.45 μm filter membrane, packaging, and freezing at-80 deg.C.
TZM-bl cells are infected by lentivirus, 0.8 mu g/ml puromycin is added to kill uninfected cells after 24 hours, the solution is changed every 24 hours, the genome of the cells is extracted after 72 hours, and the mutation efficiency of the CRISPR/Cas9 system under the guidance of gRNA to the CCR5 gene is detected through a T7E1 experiment. The results of the experimental group and the control group are compared, and the CCR5-gRNA7 and CCR5-gRNA8 which are screened out have different mutation effects on the CCR5 gene (FIG. 1B). And the PCR products were subjected to high throughput sequencing, and it was found that CCR5-gRNA7 and CCR5-gRNA8 had mutation efficiencies of 93.6% and 88.8% respectively for specific sites of the CCR5 gene (FIG. 1C).
Thirdly, in order to detect the inhibition of the designed and constructed gRNA on the expression of CCR5 co-receptor, the treated cells were incubated with APC-labeled CCR5 antibody, and the expression level of CCR5 co-receptor on the cell surface was detected by flow cytometry, and as can be seen from the results, the expression level of CCR5 on the cell surface treated by CRISPR/Cas9 system guided by gRNA specific to CCR5 was significantly lower than that of the negative control group (fig. 2).
Fourthly, in order to further detect the influence of the gRNA system on HIV virus infected cells, the inhibition effect of the system on HIV virus infection is detected through flow cytometry by utilizing the characteristic that Ghost-R5 cells can be activated to express EGFP after being infected by the HIV virus. In this experiment, the negative control was replaced with lentiCRISPR v2 empty vector without gRNA construction, cells treated with CRISPR/Cas9 system were infected with HIV-1 virus (CCR5 tropism) with MOI of 1 and 0.1, and then the EGFP expression rate of the cells was examined by flow cytometry, and it was seen that the infection efficiency of HIV by the CCR5 specific CRISPR/Cas9 system treated cells was significantly lower than that of the control group (fig. 3).
Fifthly, the most possible three off-target sites corresponding to each gRNA are respectively selected, corresponding target fragments are amplified from the proposed cell genome, the mutation efficiency of the target fragments is detected through a T7E1 experiment, the mutation sites of CCR5-gRNA7 are used as positive controls, and as can be seen from figure 4, the designed gRNA does not cause mutation on the off-target sites.
Sequencing verification shows that the gRNA expression vector constructed by the invention is successfully constructed. Through cell tests and detection, the brand-new and high-efficiency gRNAT7 and gRNAT8CRISPR/Cas9 systems can effectively mutate CCR5 gene and inhibit the expression thereof, and inhibit the infection of HIV on cells. The final 2 grnas screened are as in table 1:
target sequences corresponding to gRNAT7 and gRNAT8 screened in Table 1
Compared with the prior art, the invention has the following beneficial effects:
1. the mutant region is in the delta 32 region of CCR5 gene: the CRISPR/Cas9 recombinant lentivirus obtained by constructing a CRISPR/Cas9 recombinant lentivirus vector containing a gRNA sequence of a delta 32 region of a specific targeting CCR5 gene can introduce a CCR5 specific CRISPR/Cas9 system into cells, Cas9 can generate double-strand break at a specific site of a CCR5 gene under the guide of two designed gRNAs, random mutation is introduced into the break site after the repair by non-homologous recombination end combination, and the mutation rate is as high as about 90%. Since the CCR5 delta 32 mutant is a naturally-occurring mutant form, the 32bp deletion gene expression of the CCR5 gene has no functional CCR5 protein, and can prevent HIV infection, so that the HIV infection efficiency of cells modified by the recombinant lentivirus is obviously reduced. Compared with RNAi (ribonucleic acid interference), Knockdown, ZFN (zero transfer negative) and TALEN (transcription activator-like effector nuclease) technologies, the method has higher efficiency of inhibiting the HIV infected cells, and the system is quick, simple and cheap to construct and is suitable for AIDS gene therapy.
2. Low miss ratio: since CCR5 and CCR2 have very high homology, the designed gRNA is very easy to generate off-target, so we fully considered the problem of off-target efficiency when designing grnas specifically targeting CCR5, and grnas were designed in non-homologous regions of CCR5 and CCR2, and the off-target efficiency of CCR5-gRNA7 and CCR5-gRNA8 was detected to be less than 0.2%.
Drawings
FIG. 1 shows the mutation efficiency of CRISPR/Cas9 targeting specific sites of CCR5 gene on the gene.
The results show that the gRNA designed by us can effectively guide Cas9 to generate mutation at a specific site of CCR5 gene. A: the position of the designed gRNA on the CCR5 gene; b: the ability of CCR5-gRNA7 and CCR5-gRNA8 to induce mutations in the CCR5 gene was tested in a T7E1 assay in TZM-bl cells; c deep sequencing detects mutant types induced by CCR5-gRNA7 and CCR5-gRNA 8.
Fig. 2 shows the inhibition of CCR5 co-receptor expression by flow cytometry detection of the constructed CRISPR/Cas9 system.
The results show that the constructed CRISPR/Cas9 system inhibits CCR5 expression to different degrees in two types of cell lines (TZM-bl and Ghost-CCR 5).
FIG. 3 is a graph of the inhibitory effect of the CCR5 specific CRISPR/Cas9 system on HIV-1(CCR5 tropism) virus infection in Ghost-CCR5 cells.
The results show that gRNA can effectively inhibit the infection of Ghost-CCR5 cells by HIV-1(CCR5 tropism).
Fig. 4 is a graph of the off-target efficiency of grnas in TZM-bl cells tested with T7E1 experiments and deep sequencing.
A: CCR5-gRNA7 and CCR5-gRNA8 cannot detect the off-target efficiency on the most possible three off-target sites, which indicates that the off-target efficiency of the gRNA designed by the inventor is very low and is lower than the detection level of a T7E1 experiment; b: deep sequencing of CCR5-gRNA7 and CCR5-gRNA8 detected very low off-target efficiencies, less than 0.2%, at their most likely two off-target sites. The sequence segment of poly-T downstream of the second off-target site of CCR5-gRNA8 detected more mutations, which was likely due to inaccurate measurements of more than ten T's linked together. The results of deep sequencing can also indicate that the off-target efficiency of the two gRNAs designed by us is low.
Fig. 5 is a graph of the efficiency of the gRNA-guided CRISPR/Cas9 system designed by us to mutate and inhibit expression of the CCR5 gene in Jurkat T cells.
The results show that the gRNA-guided CRISPR/Cas9 system designed by us can effectively cause mutation of CCR5 gene and inhibit expression of CCR5 protein, and finally inhibit infection efficiency of HIV-1(CCR5 tropism) on Jurkat T cells. A: the ability of CCR5-gRNA7 and CCR5-gRNA8 to induce mutations in the CCR5 gene was tested in a T7E1 assay in Jurkat T cells; b: sequencing and detecting mutant types induced by CCR5-gRNA7 and CCR5-gRNA 8; c: western blot experiment detects the efficiency of CRISPR/Cas9 system guided by gRNA7 and gRNA8 for inhibiting CCR5 protein expression; d: the inhibitory effect of Jurkat T cells engineered by our constructed CRISPR/Cas9 system on HIV-1(CCR5 tropism) virus infection was tested by ELISA.
Detailed Description
The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way. Example 1 design and Synthesis of gRNA sequence targeting CCR5 Gene sequence and construction of eukaryotic expression vector
1. Selection and design of gRNAs targeting CCR5 gene sequence
Using the sequence of the human CCR5 gene as a reference sequence, a highly scored target site on the sequence of the CCR5 gene is found by a Crispr design tool on Crispr. mit. edu, and the sequence of the target site is in the form of 5 '- (20N) -NGG 3' or 5 '-CCN (20N) -3'. Meanwhile, human genome sequences are compared, gRNAs with high homology with the human genome sequences are excluded, the genome sequences of CCR5 and CCR2 are compared, and gRNA sequences targeting the homologous regions of the two genes are excluded. Given that the naturally occurring CCR5- Δ 32 mutant can fail HIV virus infection of T cells, we finally selected two unreported gRNA sequences and targets that target the Δ 32 region of the CCR5 gene (fig. 1).
2. Synthesis of gRNA oligonucleotide sequence targeting CCR5 gene sequence and construction of eukaryotic expression vector
According to the selected gRNA, a forward oligonucleotide sequence was obtained by adding CACC to the 5 'end of the selected gRNA, a reverse oligonucleotide sequence was obtained by adding AAAC to the 5' end of the complementary strand, the forward and reverse oligonucleotide sequences were synthesized, respectively, and then the synthesized sequences were denatured and annealed to obtain a double-stranded DNA fragment having a BsmBI cohesive end as follows:
forward direction: 5' -CACCNNNNNNNNNNNNNNNNNNNN
And (3) reversing: NNNNNNNNNNNNNNNNNNNNCAAA-5'
The denaturation and annealing system comprises:
2 μ l of Forward oligonucleotide chain (50 μ M)
2 μ l reverse oligonucleotide strand (50 μ M)
The following procedure was run in a PCR instrument: 4min at 90 ℃; 10min at 70 ℃; at 37 ℃ for 20 min; at 25 ℃ for 20 min.
The annealed double-stranded oligonucleotide chain contains a cohesive end of BsmBI, and is directly connected with a lentiCRISPR v2 vector cut by BsmBI (NEB) enzyme, so that the lentiCRISPR v2-gRNA recombinant plasmid can be obtained.
Enzyme digestion system:
the plasmid after enzyme digestion is directly recovered by a gel recovery kit.
A connection system:
the ligation product obtained in the above step is transformed into JM109 competent cells, and plated on Amp+And (3) selecting positive clone inoculation bacteria, shaking the bacteria at 37 ℃ overnight, extracting plasmids by a plasmid extraction kit, and performing sequencing identification to obtain lentiCRISPR v2-gRNA plasmids.
Example 2 verification of mutations in CCR5 gene specific sites by the CRISPR/Cas9 system guided by grnas of the invention in TZM-bl cells.
Firstly, 293T cells are transfected by a constructed gRNA/Cas 9 co-expression plasmid and helper plasmids psPAX2 and pMD2.G, a fresh culture medium is replaced after 24 hours, then culture supernatant is collected after 48 hours, and the culture supernatant is frozen and stored at minus 80 ℃ for later use after being filtered by a 0.45-micron filter membrane.
In order to verify whether the gRNA-guided CRISPR/Cas9 system designed in the invention can generate mutation on a specific site of CCR5, TZM-bl cells are infected by the constructed lentivirus, the cells are changed into a fresh culture medium after 12 hours of infection, 0.8 mu g/ml puromycin is added after 24 hours to kill the uninfected cells, the solution is changed every 24 hours, and the genomic DNA of the cells is extracted after 72 hours. And amplifying a target fragment from the extracted genome by using a Primer CCR5-Primer of CCR5 through PCR, carrying out denaturation annealing on a PCR product, carrying out enzyme digestion on the PCR product by using T7 endonuclease, and carrying out electrophoresis on the enzyme-digested product by using 1.5% agarose gel. In addition, a corresponding primer is used for amplifying a gene fragment with about 200bp of the mutation site from the genome, and the mutant type in the PCR product is detected through deep sequencing. From the experimental results, we can see that two gRNAs (the nucleotide sequences of the corresponding target sequences are shown as SEQ ID No.1 or 2) have certain mutation efficiency on the CCR5 gene (FIG. 1B), and the deep sequencing result shows that the main mutation types are deletion mutations (FIG. 1C), and the mutation efficiency is as high as 93.6% and 88.8% respectively. The gRNA designed by the inventor can effectively generate mutation at a target site of a CCR5 gene sequence. The specific experimental steps are as follows:
1. packaging lentiviruses
a. 293T cells were seeded in DMEM medium containing 10% FBS, penicilin (100U/ml) and streptomycin (100. mu.g/ml);
b. cells were plated in 10cm dishes one day before transfection and transfection was performed by waiting to 70% -80% density.
c. lentiCRISPR v 2-gRNA: psPAX 2: dissolving plasmid DNA in opti-MEM at a ratio of pMD2. G2: 1:1, mixing, and adding NeofectTMMixing, standing at room temperature for 15-30min, and preparing transfection complex;
d. adding the transfection compound into a cell culture medium, and gently and uniformly mixing;
e. after further culturing for 24 hours, changing to a fresh culture medium, and collecting supernatant after 48 hours;
f. the supernatant was filtered through a 0.45 μm filter and stored at-80 ℃ until use.
2. Lentivirus infection of TZM-bl cells or Ghost-CCR5 cells
a. TZM-bl cells were seeded in DMEM medium containing 10% FBS, penicillin (100U/ml) and streptomycin (100. mu.g/ml); Ghost-CCR5 cells were seeded in DMEM medium containing 10% FBS, penicillin (100U/ml), streptomycin (100. mu.g/ml), G418 (500. mu.g/ml) and hygromycin (100. mu.g/ml);
b. spreading the cells in a 6-well plate one day before infection, and infecting when the density is 70% -80%;
c. the cell culture medium was removed, prepared lentivirus (MOI ═ 1.0) was added, and polybrene was added at 0.8 μ g/ml;
d. after 12 hours of infection, lentiviruses were removed, replaced with fresh medium for 24 hours, and uninfected cells were killed by addition of 0.8. mu.g/ml puromycin (Ghost-CCR5 cells omit this step), and the solution was changed every 24 hours;
3. T7E1 experiment for detecting mutation efficiency of CCR5 gene
a. After 72 hours, basically all uninfected cells are killed, and genome DNA of the cells is extracted, wherein the used kit is a Tiangen cell blood tissue genome extraction kit (DP304), and the method is carried out according to the manufacturer's instructions;
b. the CCR5 gene fragment is amplified through PCR, and the forward primer of CCR5 is as follows: ATGGATTATCAAGTGTCAAGTCCAA, the reverse primer is: TCACAAGCCCACAGATATTTCCTGC, respectively;
the PCR system was as follows:
cycling of PCR reactions
c. The target fragment obtained by PCR was recovered using a gel recovery kit (D2500) from OMEGA. The concrete method is carried out according to the test method provided by the company.
d. Annealing the target segment.
e. T7E1 enzyme cleavage
To the annealed product was added 0.5. mu. l T7E1 and water bath at 37 ℃ for 50 min. Detection by 1.5% agarose gel electrophoresis.
4. Deep sequencing for detecting mutant types
a. DNA fragments of about 200bp near the target site are amplified by PCR, and forward primers corresponding to the target sites of CCR5-gRNA7 and CCR5-gRNA8 are as follows: ATGATTGTTTATTTTCTCTTCTGGG, the reverse primer is: CGACAAAGGCATAGATGATGGGG, respectively;
b. the PCR system was as described in 3 above;
c. the target fragment obtained by PCR was recovered using a gel recovery kit (D2500) from OMEGA. The concrete method is carried out according to a test method provided by a company;
d. the recovered target fragment was subjected to sequencing by the company (the Anno gene).
Example 3 inhibition of CCR5 co-receptor expression by gRNA designed and constructed
Virus infection experiments as in example 2, after 72 hours, CCR5 co-receptor expression on the surfaces of TZM-bl cells and Ghost-CCR5 cells was detected by flow cytometry, and as can be seen from fig. 2, the CRISPR/Cas9 system can effectively inhibit CCR5 co-receptor expression under the guidance of CCR5-gRNA7 and CCR5-gRNA8 designed by us, particularly in TZM-bl cells, by the following specific steps:
a. the medium was discarded and the cells were washed once with PBS;
b. add 200. mu.l of 0.25% pancreatin cells, after which 300. mu.l of serum-containing medium is added to stop the pancreatin digestion;
c. adding PBS to 1ml, repeatedly blowing and beating cells until the cells are dispersed into single cells;
d. transfer the cell suspension to a 1.5ml EP tube and pellet the cells by centrifugation (1,500g,5 min); washing with PBS for 1-2 times, and repeating the above centrifugation step;
e. cell concentration was adjusted to about 1 × 10 with PBS7/ml；
f. Transferring 100 μ l cell suspension (1 × 106/100 μ l) to a new 1.5ml EP tube, adding 5 μ l of APC-labeled CCR5 antibody, mixing, and incubating at 4 deg.C in the dark for 30 min;
g. adding 1ml PBS, centrifuging for 5min at 1,500g, and washing for 2 times;
h. discarding the supernatant, adding 0.5ml of PBS containing 1% paraformaldehyde, and resuspending the cells;
i. transferring the cell suspension to a flow detection tube, and detecting on a machine.
Example 4 detection of inhibition of gRNA of the present invention against HIV-1(CCR5 tropism) viral infection
After the slow virus infects Ghost-CCR5 cells, the treated cells are infected by HIV viruses with different titers, and after 48 hours, the GFP positive rate of the cells is detected by flow, and the result shows that the GFP positive rate of the cells treated by the CRISPR/Cas9 system after being infected by the HIV viruses is obviously lower than that of a control group (figure 3), which indicates that the CRISPT/Cas9 system guided by the gRNA designed by the inventor can obviously inhibit the infection of the HIV viruses on the cells containing CCR5 co-receptor. The method comprises the following specific steps:
1. preparation of infectious HIV-1 Virus
a. Laying 293T cells on a 10cm cell culture dish, wherein the confluence degree of the cells during the next day of transfection is 70-80%;
b. 10. mu.g of pYU2 plasmid (HIV-1 infectious clone) was transfected with neofect in the same manner as in example 2; after 24 hours, the medium was changed and cultured for another 48 hours to collect the supernatant (containing virus).
c. Filtering the virus solution with 0.45 μm filter membrane, subpackaging, and freezing at-80 deg.C for use.
2. HIV-1(CCR5 tropism) virus titer assay
a. Ghost-CCR5 cells were plated on 12-well cell culture dishes one day before the experiment (2.5 × 10)4/A hole);
b. preparing 10-fold concentration gradient virus diluent (using culture medium as diluent, the final volume is 0.5ml), replacing the old culture medium, adding polybrene to the final concentration of 8 mug/ml, culturing at 37 ℃ for 4h, and replacing with 1ml fresh culture medium;
c. 48h after infection, the cells were washed with PBS and then trypsinized with 300. mu.l of pancreatin (incubation at 37 ℃ for no more than 5 min); adding 1ml of culture medium containing serum to terminate the pancreatin digestion reaction, and blowing and beating cells until the cells are uniformly dispersed; transfer the cell suspension to a 1.5ml EP tube and pellet the cells by centrifugation (1,500g,5 min); resuspend the cells with PBS and centrifuge again; finally resuspend the cells with 1ml of 4% paraformaldehyde solution (fixative); at this point the virus has been inactivated by paraformaldehyde;
d. the cell suspension was removed from the P3 laboratory and left on ice (or 4 ℃) for at least 1 h; centrifuging to precipitate cells (1,500g,5min), and discarding the supernatant; resuspend cells in 200. mu.l PBS;
e. flow assay GFP + cell ratio;
f. calculation of HIV virus titer (infectious units): cells with a GFP + positivity in one well between 1% and 10% were selected for calculation of viral infectious units. Specifically, assuming that the GFP positive ratio of the infected sample containing 10 μ l of the virus stock is p%, the HIV virus titer (IU/ml) is p% x (2.5x 10)4) x (1000. mu.l/10. mu.l). (Note: 1%<p％<10％)。
3. The methods for HIV-1(CCR5 tropic) virus infection of Ghost-CCR5 cells and for flow cytometry for GFP + cell rates were as described in example 4, steps 1 and 2.
Example 5 detection of the efficiency of the gRNA of the present invention in directing the CRISPR/Cas9 system to generate mutations in non-target genes (off-target efficiency)
The cell treatment method was the same as 2 in example 2, gene fragments of off-target sites corresponding to CCR5-gRNA3, CCR5-gRNA7 and CCR5-gRNA8 were amplified from the extracted TZM-bl cell genome by PCR, and then the mutation efficiency of these off-target sites was tested by T7E1 experiment, and the target site of CCR5-gRNA7 was used as a positive control, and further, gene fragments corresponding to the first two off-target sites of CCR5-gRNA7 and CCR5-gRNA8 were subjected to deep sequencing after PCR amplification, and the method was the same as 2. As shown in fig. 4A, the positive control can be cut by T7 endonuclease, but the DNA fragment of the off-target site that we amplified cannot be cut, indicating that the off-target efficiency of the gRNA we designed is lower than the lower detection limit of the T7E1 experiment; the off-target efficiency detected by deep sequencing was less than 0.2% (fig. 4B), and downstream of the second off-target site of CCR5-gRNA8 resulted in some sequencing errors due to excessive T repeats, but mutations at the off-target site were only 10, so that the off-target efficiencies of CCR5-gRNA7 and CCR5-gRNA8 were considered to be less than 0.2%.
TABLE 1 off-target site sequences corresponding to each gRNA
TABLE 2 PCR primers for each off-target site
Example 6 detection of the efficiency of mutation of CCR5 gene by gRNAs designed by us, the efficiency of inhibition of CCR5 protein expression and the efficiency of inhibition of infection of this cell by HIV-1 in Jurkat T cells
Jurkat T cells are suspension cells and are not easily transfected, so we infected Jurkat T cells after concentrating packaged lentivirus with PEG8000 and killed uninfected cells with puromycin. The mutation efficiency of the CRISPR/Cas9 system on the CCR5 gene was then tested by T7E1 experiments and sequencing, and the results showed that CCR5-gRNA7 and CCR5-gRNA8 were able to effectively guide the CRISPR/Cas9 system to target the CCR5 gene and mutate it in Jurkat T cells (fig. 5A, B); western blot detection of inhibition efficiency of the CRISPR/Cas9 system on CCR5 protein expression, and as can be seen from FIG. 5C, CCR5-gRNA7 and CCR5-gRNA8 can inhibit expression of CCR5 protein to different degrees compared with GFP-gRNA; the amount of HIV-1(CCR5 tropism) p24 antigen was measured by ELISA and it can be seen from FIG. 5D that the efficiency of HIV-1 infection of Jurkat T cells engineered with the CRISPR/Cas9 system was reduced, so we designed gRNAs that could inhibit HIV-1(CCR5 tropism) infection of cells in Jurkat T cells. The specific implementation steps are as follows:
1. lentiviral packaging and concentration
The lentivirus packaging method is the same as example 2, and the concentration method is as follows:
a. preparing 5 × PEG8000NaCl, NaCl 8.766g, PEG 800050 g and 200ml MilliQ water, sterilizing at 121 deg.C, and storing at 4 deg.C;
b. filtering the packaged lentivirus supernatant with a 0.45-micron filter head, and then adding 5 × PEG8000NaCl mother liquor;
c. mixing once every 20-30 minutes for 3-5 times, and standing at 4 deg.C overnight;
d. centrifuging at 4000g for 20 minutes at 4 ℃;
e. the supernatant was discarded, the tube was left to stand for 1-2 minutes, the residual liquid was aspirated, and an appropriate amount of RPMI 1640 (containing 10% FBS, 100U/ml penicillin and 100. mu.g/ml streptomycin) medium was added to dissolve the precipitate, which was then dispensed into 1.5ml EP tubes and stored at-80 ℃ for further use.
2. Lentiviral infection of Jurkat T cells
a. Jurkat T cells were seeded in RPMI 1640 medium containing 10% FBS, penicilin (100U/ml) and streptomycin (100. mu.g/ml);
b. jurkat T cells were seeded into 6-well plates the day before infection and the cells were grown to approximately 1 × 105Adding 100 mu l of frozen lentivirus and 8 mu g/ml polybrene per ml;
c. after 2 days of infection, 2 mu g/ml puromycin is added to kill uninfected cells, the solution is changed once every day, the cells are collected into a 15ml centrifuge tube during solution change, centrifugation is carried out for 5 minutes at 800 rpm, supernatant is discarded, new culture medium containing puromycin is added to resuspend the cells, the uninfected cells are basically killed after 3 days, and the subsequent detection experiment can be carried out.
3. T7E1 and sequencing for detecting mutation efficiency of CCR5 gene
Taking 500 mu l of lentivirus infected Jurkat T cells, extracting genome DNA, amplifying a gene fragment of about 1kb by PCR with a primer specific to CCR5, detecting the mutation efficiency of the fragment by a T7E1 experiment, wherein the specific method is the same as the example 2, or connecting the amplified gene fragment to a PLB carrier, transforming and plating the gene fragment, selecting 10 monoclonal bacteria to send to a company for sequencing, and the specific implementation steps are as follows:
a. the PCR primers and method are the same as those in T7E1 experiment;
b. connecting the PCR amplification product with a linearized PLB vector (TIANGEN BIOTECH Beijing), and performing specific operation according to a product instruction;
a connection system:
c. the ligated product was transformed into JM109 competent cells, and the transformed cells were plated on ampicillin-resistant LB plates, cultured at 37 ℃ for 12 hours, and then selected from monoclonal colonies and sequenced.
4. Western blot detection of expression quantity of CCR5 protein in Jurket T cells
a. Taking 1ml of lentivirus infected Jurkat T cells, centrifuging for 1 minute at 13200g, removing supernatant, adding 100 mu l of RIPA lysate (containing cocktail and PMSF), vortexing, shaking uniformly, and placing on ice;
b. shaking every 10 minutes, putting on ice after shaking, and shaking for 3 times;
c. adding 25 μ l of 5 × loading, mixing, decocting in boiling water for 5min, and storing at-20 deg.C;
d. preparing SDS gel with continuous concentration gradient, and after sample loading, running for 1 hour and 20 minutes at 25 mA;
e. cutting off the redundant part without the sample on the glue after the glue running is finished, and installing a rotary membrane system according to the following structure: negative pole-sponge-three layers of filter paper-glue-membrane-two layers of filter paper-sponge-positive pole;
f. placing the film transfer system in an ice-water mixture, and transferring for 1 hour and 20 minutes at 100V;
g. washing the transferred membrane once by TBST, and shaking for 5 minutes by a low-speed shaking table;
h. sealing with 5% skimmed milk (prepared by TBST) at room temperature for 1-2 hr;
i. primary antibody incubation, placing at normal temperature for incubation for 3 hours;
j. washing the membrane with TBST for 3 times, 10 minutes each time;
k. incubating the secondary antibody for 1-2 hours at normal temperature;
l, washing the membrane for 3 times by TBST, and each time for 10 minutes;
m, blotted dry TBST on the membrane with filter paper, and pre-mixed ECL substrate is added to the membrane and exposed. 5. ELISA for detecting content of p24 antigen
The engineered Jurkat T cells were infected with MOI 1.0 HIV-1(CCR5 tropic) virus, after 8 hours of infection, the virus was washed off by PBS 3 times, and then the infected cells were cultured in fresh 1640 medium, after 3 days the cell culture supernatant was collected, 1% Triton-X100 was added, and the p24 antigen content in the supernatant was measured by ELISA kit.
SEQUENCE LISTING
<110> Wuhan university
<120> CRISPR/Cas9 recombinant lentiviral vector containing gRNA sequence of specific targeting CCR5 gene and application
<160>6
<170>PatentIn version 3.3
<210>1
<211>20
<212>DNA
<213> Artificial sequence
<400>1
<210>2
<211>20
<212>DNA
<213> Artificial sequence
<400>2
<210>3
<211>25
<212>DNA
<213> Artificial sequence
<400>3
atggattatc aagtgtcaag tccaa 25
<210>4
<211>25
<212>DNA
<213> Artificial sequence
<400>4
tcacaagccc acagatattt cctgc 25
<210>5
<211>25
<212>DNA
<213> Artificial sequence
<400>5
atgattgttt attttctctt ctggg 25
<210>6
<211>23
<212>DNA
<213> Artificial sequence
<400>6
cgacaaaggc atagatgatg ggg 23
Claims (4)
1. A CRISPR/Cas9 recombinant lentiviral vector containing a gRNA sequence specifically targeting CCR5 gene is characterized in that the recombinant lentiviral vector is used by lentil CRISPR v2(Addge ID:52961)BsmBIAfter the enzyme digestion, a band is ligatedBsmBIThe gRNA sequence of the sticky end specifically targeting CCR5 gene is recombined, the gRNA sequence of the CCR5 gene is shown as SEQ ID NO.1 or 2, and the target sequence of the gRNA sequence of the CCR5 gene is positioned in the delta 32 region of CCR5 gene and is in a non-homologous region of CCR5 and CCR 2.
2. A lentivirus comprising the CRISPR/Cas9 recombinant lentiviral vector of claim 1.
3. Use of a recombinant lentiviral vector comprising the CRISPR/Cas9 of claim 1 in the preparation of a reagent for inducing CCR5 mutation.
4. Use of a recombinant lentiviral vector comprising the CRISPR/Cas9 of claim 1 in the preparation of a medicament for the treatment and/or prevention of HIV infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710457591.9A CN107312798B (en) | 2017-06-16 | 2017-06-16 | CRISPR/Cas9 recombinant lentiviral vector containing gRNA sequence of specific targeting CCR5 gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710457591.9A CN107312798B (en) | 2017-06-16 | 2017-06-16 | CRISPR/Cas9 recombinant lentiviral vector containing gRNA sequence of specific targeting CCR5 gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107312798A CN107312798A (en) | 2017-11-03 |
| CN107312798B true CN107312798B (en) | 2020-06-23 |
Family
ID=60183454
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710457591.9A Active CN107312798B (en) | 2017-06-16 | 2017-06-16 | CRISPR/Cas9 recombinant lentiviral vector containing gRNA sequence of specific targeting CCR5 gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107312798B (en) |
Families Citing this family (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6261500B2 (en) | 2011-07-22 | 2018-01-17 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| WO2016022363A2 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
| US20190225955A1 (en) | 2015-10-23 | 2019-07-25 | President And Fellows Of Harvard College | Evolved cas9 proteins for gene editing |
| KR102547316B1 (en) | 2016-08-03 | 2023-06-23 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Adenosine nucleobase editing agents and uses thereof |
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR20240007715A (en) | 2016-10-14 | 2024-01-16 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Aav delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| EP3592777A1 (en) | 2017-03-10 | 2020-01-15 | President and Fellows of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| WO2019023680A1 (en) | 2017-07-28 | 2019-01-31 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace) |
| WO2019139645A2 (en) | 2017-08-30 | 2019-07-18 | President And Fellows Of Harvard College | High efficiency base editors comprising gam |
| CN109402116A (en) * | 2017-09-30 | 2019-03-01 | 广东赤萌医疗科技有限公司 | A kind of gRNA, gRNA composition and CRISPR-Cas9 system and application thereof for knocking out CCR5 gene |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CA3130488A1 (en) | 2019-03-19 | 2020-09-24 | David R. Liu | Methods and compositions for editing nucleotide sequences |
| GB2614813A (en) | 2020-05-08 | 2023-07-19 | Harvard College | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN111808820A (en) * | 2020-06-01 | 2020-10-23 | 贵州省种畜禽种质测定中心 | Method for constructing MyoD1 gene knockout MDBK cell line based on CRISPRCAS9 technology |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104480144A (en) * | 2014-12-12 | 2015-04-01 | 武汉大学 | CRISPR/Cas9 recombinant lentiviral vector for human immunodeficiency virus gene therapy and lentivirus of CRISPR/Cas9 recombinant lentiviral vector |
| CN105331609A (en) * | 2015-10-20 | 2016-02-17 | 芜湖医诺生物技术有限公司 | Human CCR5 gene target sequence identified by neisseria meningitidis CRISPR-Cas9 system, sgRNA and application of target sequence and sgRNA |
| CN105567738A (en) * | 2016-01-18 | 2016-05-11 | 南开大学 | Method for inducing CCR5-delta32 deletion with genome editing technology CRISPR-Cas9 |
| CN105567688A (en) * | 2016-01-27 | 2016-05-11 | 武汉大学 | CRISPR/SaCas9 system for gene therapy of AIDS |
| WO2016183236A1 (en) * | 2015-05-11 | 2016-11-17 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating hiv infection and aids |
| CN106801056A (en) * | 2017-01-24 | 2017-06-06 | 中国科学院广州生物医药与健康研究院 | The slow virus carrier and application of a kind of sgRNA and its structure |
-
2017
- 2017-06-16 CN CN201710457591.9A patent/CN107312798B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104480144A (en) * | 2014-12-12 | 2015-04-01 | 武汉大学 | CRISPR/Cas9 recombinant lentiviral vector for human immunodeficiency virus gene therapy and lentivirus of CRISPR/Cas9 recombinant lentiviral vector |
| WO2016183236A1 (en) * | 2015-05-11 | 2016-11-17 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating hiv infection and aids |
| CN105331609A (en) * | 2015-10-20 | 2016-02-17 | 芜湖医诺生物技术有限公司 | Human CCR5 gene target sequence identified by neisseria meningitidis CRISPR-Cas9 system, sgRNA and application of target sequence and sgRNA |
| CN105567738A (en) * | 2016-01-18 | 2016-05-11 | 南开大学 | Method for inducing CCR5-delta32 deletion with genome editing technology CRISPR-Cas9 |
| CN105567688A (en) * | 2016-01-27 | 2016-05-11 | 武汉大学 | CRISPR/SaCas9 system for gene therapy of AIDS |
| CN106801056A (en) * | 2017-01-24 | 2017-06-06 | 中国科学院广州生物医药与健康研究院 | The slow virus carrier and application of a kind of sgRNA and its structure |
Non-Patent Citations (2)
| Title |
|---|
| CRISPR/Cas9 基因组编辑技术在HIV-1感染治疗中的应用进展;韩英伦 李庆伟;《遗传》;20151204;第38卷(第1期);第9-16页 * |
| Seamless modification of wild-type induced pluripotent stem cells to the natural CCR5Δ32 mutation confers resistance to HIV infection;Lin Ye等;《PNAs》;20140429;第111卷(第26期);第9591-959页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107312798A (en) | 2017-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107312798B (en) | CRISPR/Cas9 recombinant lentiviral vector containing gRNA sequence of specific targeting CCR5 gene and application | |
| KR102553518B1 (en) | Methods and compositions for RNA-guided treatment of HIV infection | |
| CN104480144B (en) | CRISPR/Cas9 recombinant lentiviral vector for human immunodeficiency virus gene therapy and lentivirus of CRISPR/Cas9 recombinant lentiviral vector | |
| Kaushik et al. | A cellular restriction dictates the permissivity of nondividing monocytes/macrophages to lentivirus and gammaretrovirus infection | |
| Yin et al. | CRISPR/Cas9 inhibits multiple steps of HIV-1 infection | |
| Antzin-Anduetza et al. | Increasing the CpG dinucleotide abundance in the HIV-1 genomic RNA inhibits viral replication | |
| EP3356521A2 (en) | Methods and compositions for rna-guided treatment of hiv infection | |
| Brinzevich et al. | HIV-1 interacts with human endogenous retrovirus K (HML-2) envelopes derived from human primary lymphocytes | |
| Guenzel et al. | Recruitment of the nuclear form of uracil DNA glycosylase into virus particles participates in the full infectivity of HIV-1 | |
| Noviello et al. | Second-site compensatory mutations of HIV-1 capsid mutations | |
| Vabret et al. | Large-scale nucleotide optimization of simian immunodeficiency virus reduces its capacity to stimulate type I interferon in vitro | |
| Lainé et al. | In vitro and in vivo cleavage of HIV-1 RNA by new SOFA-HDV ribozymes and their potential to inhibit viral replication | |
| Specht et al. | Counteraction of HLA-C-mediated immune control of HIV-1 by Nef | |
| CN108103094B (en) | Expression vector for targeted inhibition of HIV-1 proviral expression and preparation method and application thereof | |
| Reddy et al. | Comparative analyses of human immunodeficiency virus type 1 (HIV-1) and HIV-2 Vif mutants | |
| WO2012118092A1 (en) | Fusion protein | |
| Fan et al. | CRISPR-Cas12b enables a highly efficient attack on HIV proviral DNA in T cell cultures | |
| Nguyen et al. | Efficient Inhibition of HIV Using CRISPR/Cas13d Nuclease System. Viruses 2021, 13, 1850 | |
| US9023648B2 (en) | Method of transducing non-dividing myeloid cells utilizing chimeric murine leukemia viruses containing Vpx | |
| Liang et al. | Two retroviruses packaged in one cell line can combined inhibit the replication of HIV-1 in TZM-bl cells | |
| CN116804211A (en) | MALT1 stable transfer cell line for promoting replication of porcine virus and construction method thereof | |
| Bella | Gene editing technologies based on Crispr-Cas9 system for the treatment of HIV: studies in vitro and in vivo | |
| CN111349620A (en) | Recombinant HIV (human immunodeficiency virus) defective virus and preparation method thereof | |
| Fallarino | Anti HIV-1 gene therapy approach combining multiple siRNAs with the membrane-anchored fusion inhibitor C-peptide maC46 | |
| Güner | Entry of the Human Pegivirus (HPgV) Into Jurkat Cells and the Expression Level of ULK-1 in TMEM55B Knocked-down MDA-MB-231 Cells: A Thesis in Two Parts |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |