CN107312763A - L-type alpha-amylase variants and its production method - Google Patents
L-type alpha-amylase variants and its production method Download PDFInfo
- Publication number
- CN107312763A CN107312763A CN201610817210.9A CN201610817210A CN107312763A CN 107312763 A CN107312763 A CN 107312763A CN 201610817210 A CN201610817210 A CN 201610817210A CN 107312763 A CN107312763 A CN 107312763A
- Authority
- CN
- China
- Prior art keywords
- alpha
- amylase
- amino acid
- amylase variants
- licheniformis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2411—Amylases
- C12N9/2414—Alpha-amylase (3.2.1.1.)
- C12N9/2417—Alpha-amylase (3.2.1.1.) from microbiological source
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01001—Alpha-amylase (3.2.1.1)
Abstract
The invention discloses L-type alpha-amylase variants and its production method.Described the alpha-amylase variants mutation of at least one amino acid residue, increase or deletion in parental generation alpha amylase amino acid sequence are obtained, while having remained in that the alpha amylase of the ability of parental generation hydrolyzing alpha Isosorbide-5-Nitrae glycosidic bond；The two amino acid sequence homology reaches more than 95%；It is preferred that the alpha-amylase variants as shown in SEQ ID NO.4.A series of alpha-amylase variants that the present invention is provided, under the acid conditions of pH 5.0 5.8 and have higher catalytic activity under the conditions of 100 DEG C of high temperature above.The acidproof and heat endurance of these alpha-amylase variants, it is adaptable to starch liquefacation.
Description
Technical field
The invention belongs to enzyme engineering field, it is related to L-type alpha-amylase variants and its production method.
Background technology
In industrial quarters, the hydrolysis of starch is mainly since alpha amylase come, and these derive from the alpha amylase of microorganism
With the synergistic application of other enzymes, such as Pullulanase, carbohydrase and glucose isomerase, can effectively starch-splitting divide greatly
Son, these micromolecular polysaccharides produced or monose have very in industries such as food manufacturing, cereal processing, beer processing, Alcohol Productions
Many applications, it is most important.Alpha amylase is under the jurisdiction of one kind of saccharification enzyme, and its key structural feature is (α/β)8Fold, its
In contain special starch substrates binding site, length is generally no more than 10 sugar monomers, but the combination of many amylase
Site is acted on together, it is possible to multi-point combination is carried out, so as to successfully shear starch polymer.
Alpha amylase can effectively shear α-Isosorbide-5-Nitrae glycosidic bond in starch substrates, so as to quickly reduce the molecule of starch substrates
Amount and viscosity, product are mainly the dextrin of different length.Alpha amylase has different species, the application of these species industrially
Condition is very different according to the sex character of required product.
Alpha amylase (α -1,4-glucan-4-glucanohydrolases, E.C.3.2.1.1) can effectively hydrolysis starch and
α-Isosorbide-5-Nitrae glycosidic bond in other polysaccharide.In view of in raising of the starch in hydrolytic process to enzyme efficiency and reduction production cost
Demand, seek to support the alpha amylase of effective starch liquefacation to turn into the one of academia and industrial quarters in different application field
Individual important R＆D direction.It is main in heat resistance, degrees energy currently with the focus of the technique improvement of the enzyme engineering enzyme
Improvement and liquefaction effect lifting.
Many alpha amylases are found and defined from plant and microorganism commercially valuable, mainly include
B.licheniformis alpha amylases, B.amyloliquefaciens alpha amylases and G.stearothermophilus α form sediment
Powder enzyme, wherein be that template has derivative variant quantity to be most using B.licheniformis α-amylase (L-type), using
It is most extensive.
In the present invention, the need for adapt to industrialized production, we utilize B.licheniformis α-amylase (L
Type) construct a series of new alpha-amylase variants for template, improve the application efficiency of the enzyme, particularly in low pH and
Liquefaction efficiency can match with the mainstream product in the market in the case of reducing addition.
The content of the invention
It is an object of the invention to provide a series of B.licheniformis α-amylase variants, the serial variant can be with
Liquefaction efficiency is improved, and adapts to the demand of industrialized production.Temperature and pH particularly more than 100 DEG C are 5.0-5.8's
Under the conditions of, the enzyme activity and other properties of alpha-amylase variants of the invention can match with the mainstream product in the market.
It is an object of the invention to provide the gene for encoding the alpha-amylase variants.
It is yet another object of the invention to provide the production method of the alpha-amylase variants and application.
The purpose of the present invention can be achieved through the following technical solutions：
A kind of alpha-amylase variants, the mutation of at least one amino acid residue, increasing in parental generation alpha amylase amino acid sequence
Plus or delete obtain, while having remained in that the alpha amylase of the ability of parental generation hydrolyzing alpha-Isosorbide-5-Nitrae glycosidic bond；The two amino acid sequence
Homology reaches more than 95%.
Described parental generation alpha amylase preferably natural alpha amylase, i.e. bacterial alpha amylase, further preferred Bacillus
Subtilis, B.licheniformis, B.amyloliquefaciens, G.stearothermophilus or Bacillus
The alpha amylase of any one in cereus, still more preferably B.licheniformis or G.stearothermophilus
Alpha amylase, most preferably B.licheniformis alpha amylase.
The total length coding gene sequence of described B.licheniformis alpha amylase is shown in SEQ ID NO.1；It is corresponding
Amino acid sequence is shown in SEQ ID NO.2.
Described alpha-amylase variants preferably are selected from any combination of following any one or following three kinds of situations：
(1) amino acid residue of its N- end the 1st to the 2nd is lacked by B.licheniformis parental generation alpha amylase to obtain
Arrive；
(2) increase by 1 to 5 amino acid residue in B.licheniformis parental generation alpha amylase N- ends to obtain；
(3) its -terminal amino acid residue is lacked by B.licheniformis parental generation alpha amylase and is substituted for 2 to 4
Individual other preferred amino acid residues；
(4) increase by 3 to 5 amino acid residues in B.licheniformis parental generation alpha amylase C- ends to obtain.
Described alpha-amylase variants be selected from it is following any one：
(1) increase by two amino acid residues A and N in B.licheniformis parental generation alpha amylase N- ends to obtain；
(2) increase by two amino acid A and N in B.licheniformis alpha amylase N-terminal, and increase by five in C-terminal
Amino acid KTTVS is obtained；
(3) increase by two amino acid A and N in B.licheniformis alpha amylase N-terminal, and increase by three in C-terminal
Amino acid KTT is obtained；
(4) B.licheniformis alpha amylase N- terminal deletion amino acid residue V and to be substituted for 4 amino acid residual
Base AAPF is obtained；
(5) alpha-amylase variants described in pass through first ammonia of alpha amylase N- terminal deletions in B.licheniformis
Base acid residue V is simultaneously substituted for 3 other amino acid residues DGL and obtained.
The amino acid sequence of described alpha-amylase variants is further preferably as shown in SEQ ID NO.4.
The nucleotide coding sequence of described alpha-amylase variants is preferably freely shown in SEQ ID NO.3.
Encode the gene of alpha-amylase variants of the present invention.
Described gene is preferably as shown in SEQ ID NO.3.
Expression vector for expressing alpha-amylase variants of the present invention, wherein being formed sediment containing coding for alpha of the present invention
The gene of powder enzyme variants.
Described expression vector includes main by a promoter sequence that is natural or synthesizing, and one natural or synthetic
The base of ribosome bind site, a natural or synthetic terminator sequence, and coding alpha-amylase variants of the present invention
Because sequence together constitutes an expression component.
A kind of recombinant cell for being used to express alpha-amylase variants of the present invention, wherein including one or more hairs
The gene of bright described coding alpha-amylase variants.
The host cell of recombinant cell preferably is selected from Bacillus bacterial strains, further preferred B.licheniformis or process
Genetic engineering transforms the Bacillus bacterial strains for having inactivated some endogenous proteins；Most preferably inactivated by genetic engineering transformation
AprE and/or Blase B.licheniformis.
A kind of production method of alpha-amylase variants of the present invention, is included in the condition of suitable alpha-amylase variants expression
Under the recombinant cell containing coding alpha-amylase variants gene order is cultivated, and from recombinant cell or its culture supernatant
Alpha-amylase variants are obtained in liquid.
Application of the alpha-amylase variants of the present invention in α -1,4 glycosidic bonds of Polysaccharides；It is preferred that high temperature and/
Or the application under low ph condition in α -1,4 glycosidic bonds of Polysaccharides；Preferably 80 DEG C~110 DEG C of described high temperature, it is further excellent
Select 100 DEG C~110 DEG C；Described low pH preferable ph is 5.0~5.8.
Beneficial effect
A series of alpha-amylase variants that the present invention is provided, with 100 DEG C of high temperature above bars under pH 5.0-5.8 acid conditions
There is higher catalytic activity under part.The acidproof and heat endurance of these alpha-amylase variants, it is adaptable to starch liquefacation.
Brief description of the drawings
Fig. 1 is pYF-tsDE carriers, including the sensitive original paper (having replication activity at 30 DEG C) of temperature, and an erythromycin is determined
Determine gene (ErmC) -- 300 μ g/mL erythromycin can be resistant in E.coli and can be resistant in B.licheniformis
5 μ g/mL erythromycin.The recombinant host cell containing coding alpha-amylase variants nucleotide sequence is filtered out with erythromycin.
Fig. 2 is the schematic diagram of pUC57-KS-erm carriers, and the pYF-tsDE that can be obtained from the carrier in the present invention is carried
Body.
Fig. 3 is the schematic diagram of pYF-tsINT-amy carriers.
Fig. 4 is under the conditions of different injection temperations, amylase liquefaction application compares
Fig. 5 is under different starch slurry concentration, amylase liquefaction application compares
Fig. 6 is that under pH5.0, amylase difference enzyme concentration liquefaction application is compared
Fig. 7 is under the conditions of different concentration of substrate, amylase liquefaction application compares
Fig. 8 is that under condition of different pH, amylase liquefaction application is compared
Fig. 9 is under the conditions of different concentration of substrate, amylase liquefaction application compares
Figure 10 is that under condition of different pH, amylase liquefaction application is compared
Figure 11 is that application of the amylase in corn alcohol liquefaction is compared
The detailed description of the present invention
Unless otherwise prescribed, all technologies and scientific terminology in the present invention have identical implication, be generally understood as
General professional technique.In this application, some explicans are with described in specification.It must be noted that used herein and institute
Attached claim, singulative " one " " this " includes plural form, unless otherwise expressly specified in context.
In the present invention, alpha amylase refers to being capable of the enzyme of α-Isosorbide-5-Nitrae glycosidic bond of Polysaccharides.For example, alpha amylase can be by
Starch Hydrolysis is into dextrin.
In the present invention, parental generation alpha amylase refers to natural alpha amylase.Natural alpha amylase is bacterial alpha amylase, source
Including but not limited to Bacillus subtilis, B.licheniformis, B.amyloliquefaciens,
G.stearothermophilus and Bacillus cereus.
According to a preferred embodiment of the invention, natural alpha amylase is derived from Bacillus strain ----especially
B.licheniformis and G.stearothermophilus.B.licheniformis complete encoding sequence is shown in SEQ ID
NO.1；Corresponding amino acid sequence is shown in SEQ ID NO.2.
In the present invention, term " alpha-amylase variants " refer to it is non-naturally occurring, in the alpha amylase amino acid sequence of parental generation
Available point position carry out the increase of one or several amino acid residues, delete and/or substitute, while having remained in that parental generation hydrolysis
The alpha amylase of the ability of α -1,4 glycosidic bonds.
" liquefaction " generally refers to the process for the polysaccharide of small molecule by carbohydrate breakdown in the present invention.Formed sediment when adding α
When powder enzyme or alpha-amylase variants, " liquefaction " refers in particular to hydrolyze α-Isosorbide-5-Nitrae glycosidic bond of carbohydrate.
In the present invention, " α-Isosorbide-5-Nitrae glycosidic bond ", which refers to, connects the C1 of previous glucose and latter glucose C4
Key, as α-Isosorbide-5-Nitrae glycosidic bond.
The present invention relates to " alpha-amylase variants " that parental generation alpha amylase is done to sequence alterations acquisition.Parental generation alpha amylase is day
Right alpha amylase, especially derives from the natural alpha amylase of bacterium.Embodiments in accordance with the present invention, alpha-amylase variants are by parent
The available point position of the amino acid sequence of the alpha amylase in generation carries out the increase of one or several amino acid residues, deletes and/or replace
Generation, while having remained in that the alpha amylase of the ability of parental generation hydrolyzing alpha-Isosorbide-5-Nitrae glycosidic bond.
The present invention includes a series of alpha-amylase variants.Embodiments in accordance with the present invention, this series of alpha amylase becomes
The homology of the amino acid sequence of body is at least up to 95%, respectively reaches 95%, 96%, 97%, 98%, 99% or 100%.
As illustrative and non-limiting example of the present invention, described alpha-amylase variants be selected from it is following any one：
(1) increase by two amino acid residues A and N in B.licheniformis parental generation alpha amylase N- ends to obtain, ammonia
Base acid sequence is as shown in SEQ ID NO.4；
(2) increase by two amino acid A and N in B.licheniformis alpha amylase N-terminal, and increase by five in C-terminal
Amino acid KTTVS is obtained, and its coding nucleotide sequence is as shown in SEQ ID NO.8；
(3) increase by two amino acid A and N in B.licheniformis alpha amylase N-terminal, and increase by three in C-terminal
Amino acid KTT is obtained, and its coding nucleotide sequence is as shown in SEQ ID NO.9；
(4) B.licheniformis alpha amylase N- terminal deletion amino acid residue V and to be substituted for 4 amino acid residual
Base AAPF is obtained, and its coding nucleotide sequence is as shown in SEQ ID NO.10；
(5) alpha-amylase variants described in pass through first ammonia of alpha amylase N- terminal deletions in B.licheniformis
Base acid residue V is simultaneously substituted for 3 other amino acid residues DGL and obtained, and its coding nucleotide sequence is as shown in SEQ ID NO.11.
Alpha-amylase variants in the present invention maintain the ability of the glycosidic bond of hydrolyzing alpha -1,4.In addition, the property of these alpha amylases
Energy, which is used, above meets demand of industrial production, such as, the raising of liquefaction efficiency, and catalytic activity is stable under acid pH or hot conditions.
Embodiments in accordance with the present invention a, alpha-amylase variants are higher than 100 DEG C in pH 5.0 acid condition or temperature
Condition (especially temperature 100 DEG C -108 DEG C between) under, catalytic activity is stable.The performance of these raisings of alpha-amylase variants
More adapt to the liquefaction reaction of starch industry.Because liquefaction process is usually carried out under low pH and hot conditions on starch industry.
All alpha-amylase variants of the present invention may be used to liquefaction reaction.In a preferred embodiment, alpha amylase becomes
Body derives from parental generation alpha amylase, the especially alpha amylase from B.licheniformis parental generations.Specifically it is being preferable to carry out
In example, alpha-amylase variants amino acid sequence is as shown in SEQ ID NO.4 in sequence table.
According to the present invention, any carbohydrate containing α-Isosorbide-5-Nitrae glycosidic bond may be used to liquefaction reaction.Contain one
Or the carbohydrate of multiple α-Isosorbide-5-Nitrae glycosidic bond includes but are not limited to starch, amylopectin, amylose and dextran.
Many carbohydrate contain α -1,6- glycosidic bonds and α-Isosorbide-5-Nitrae-glycosidic bond, such as, amylopectin." α -1,4- sugar
Glycosidic bond " refers to the key that the C1 of the previous glucose and C4 of latter glucose is connected, as α-Isosorbide-5-Nitrae glycosidic bond.Therefore,
The alpha-amylase variants of the present invention can be used cooperatively with being capable of the Pullulanase of the glycosidic bond of hydrolyzing alpha -1,6 in saccharifying.Energy
The enzyme of enough glycosidic bonds of hydrolyzing alpha -1,4 includes but are not limited to alpha amylase.In a preferred embodiment of the invention, catalytically hydrolyzing alpha-
The enzyme of 1,4 glycosidic bonds is alpha amylase.
Therefore, embodiments in accordance with the present invention, it is with the use of general that further catalysis saccharification reaction, which puies forward efficient method,
Shandong orchid enzyme.In the present invention, " Pullulanase " is the hydrolase for referring to hydrolyzing alpha -1,6 glycosidic bond.
Alpha amylase in the present invention and Pullulanase coordinate in the saccharifying of starch use can improve glucose and
The purity of maltose.In addition, can effectively reduce concentration of substrate using above-mentioned complex enzyme in saccharification reaction, transformation efficiency is improved,
Also there can be higher catalytic activity at the temperature of acid pH or higher, be suitable for the condition of industrial hydrolysis starch.
The invention provides a kind of alpha-amylase variants can under the conditions of the temperature and pH of any suitable industrialized production water
Solve the method that α-Isosorbide-5-Nitrae glycosidic bond carries out saccharification reaction.According to the present invention, liquefaction reaction can be at a high temperature of 80 DEG C to 110 DEG C
Reaction, such as 80 DEG C, 90 DEG C, 100 DEG C, 105 DEG C and 110 DEG C.Saccharification reaction also can pH5.0 to pH5.8 condition of acidic pH
It is lower to carry out, such as pH5.0,5.2,5.4,5.6, and 5.8.
Embodiments in accordance with the present invention, the liquefaction reaction of alpha-amylase variants catalysis is in acid pH and 100 DEG C of temperatures above bars
Catalytic activity is stable under part.
On the other hand, the nucleotide sequence of coding alpha-amylase variants of the expression vector in the present invention comprising a synthesis,
And recombinant host cell contains above-mentioned expression vector.Expression vector contains the different alpha-amylase variants of coding of a synthesis
Nucleotide sequence.Expression vector can be integrated on the genome of host cell.For example, expression vector contains the nucleotides of synthesis
Sequence SEQ ID NO.3.
Expression vector in the present invention preferably includes natural or synthesis a promoter sequence, and one natural or synthetic
Ribosome bind site, a natural or synthetic terminator sequence.These hereditary original papers and the alpha-amylase variants of synthesis are compiled
Code sequence together constitutes an expression component, and expression component constitutes expression vector with carrier framework.For example, expression vector bag
An expression component is included, and expressing component includes following element：One promoter sequence, the ribosome binding site of a synthesis
The nucleotide sequence and a terminator sequence of alpha-amylase variants in point, the coding present invention of a synthesis.Signal sequence can
The secretion of alpha-amylase variants is instructed, signal sequence is introduced into expression vector or expression component, especially signal sequence is introduced
The upstream of initiation codon is more beneficial for the secretion of alpha-amylase variants.
According to the preferred embodiment of the present invention, expression vector is suitably expressed in bacterium, especially Bacillus bacterial strains, more suitable
Expressed preferably in B.licheniformis.In a particularly preferred embodiment, expression vector can be incorporated into Bacillus gene
In group, especially on B.licheniformis genome.Host available for the polynucleotide sequence being incorporated into chromosome
The expression vector of cell, and this expression vector construction method, be that well-known one of Contemporary Biology field is common
Technical ability.
According to embodiments of the present invention, recombinant host cell can be become with genetic engineering transformation comprising one or more alpha amylases
The nucleotide sequence of body gene expression.Any technology is used equally for genetic engineering engineered host cell to include one or more present invention
In alpha-amylase variants coding synthesis nucleotide sequence, for example, chromosomal integration.Contain temperature sensitivity origin and resistance screening
The carrier of mark can be used for integration step.These carriers are integrated by the specific region of Campbell's mechanism and genome, are passed through
Resistance screening obtains recombinant bacterium, and recombinant bacterium removes resistance screening by homologous recombination in subsequent incubation and marked.
According to embodiments of the present invention, recombinant host cell has inactivated some endogenous proteins by genetic engineering transformation.Energy
The endogenous being deactivated includes but is not limited to extracellular protease.The transformation of host cells of restructuring contains alpha-amylase variants expression
Some endogenous proteins are inactivated before or after the nucleotide sequence of gene.Method preferably is become being transferred to alpha amylase
The inactivation of Host Strains external source extracellular proteinase is carried out before the carrier of body expressing gene.
First, B.licheniformis has inactivated some extrinsic protein enzyme genes by transformation.Particularly
B.licheniformis bacterial strains can inactivate some extracellular proteases, such as subtilisin (AprE), glutamic acid-
specific protease(Blase).These genetic engineerings, which are transformed, causes B.licheniformis bacterial strains alpha amylase preferably
The expression and secretion of variant.
The invention provides a kind of production method of alpha-amylase variants.Embodiments in accordance with the present invention, this method is included in
The recombinant host cell containing coding alpha-amylase variants nucleotide sequence is carried out under conditions of suitable alpha-amylase variants expression
Culture, and obtain alpha-amylase variants from recombinant host cell or its supernatant.
All recombinant host cells of the present invention can produce alpha-amylase variants.Recombinant host cell is contained at least
The nucleotide sequence of the coding alpha-amylase variants of one copy.The nucleotide sequence of these coding alpha-amylase variants can be suitable
Alpha-amylase variants are expressed under conditions of preferably.The alpha-amylase variants secreted from recombinant host cell can from recombinant cell or on
It is collected into clear liquid.The method of collection includes but are not limited to filtering, centrifugation etc..
Embodiments in accordance with the present invention, transforming B.licheniformis by genetic engineering by fermenting being capable of high yield α shallow lake
Powder enzyme variants.B.licheniformis transforms the nucleotide sequence for having imported coding alpha-amylase variants by genetic engineering.More
Good, the B.licheniformis in the present invention has eliminated resistance screening gene, environmental sound and the α produced
Amylase variant is particularly suited for food industry.
Following example further illustrates the essence of the present invention in the present invention.It should be appreciated that following example is not limited
The present invention, the scope of the present invention is determined by appended claim.
Embodiment
Embodiment 1:The structure of pYF-tsDE plasmids
PYF-tsDE (Fig. 1) is the E.coli/B.licheniformis shuttle plasmids of a temperature sensitive type.The plasmid is by one
The replication orgin (active at 30 DEG C) of individual responsive to temperature type and erythromycin resistance gene (ErmC) composition, the resistant gene
Resistance in E.coli is 300ug/ml, and the resistance in B.licheniformis is 5ug/ml.At 37 DEG C, on plasmid
Replication orgin inactivation, plasmid is integrated into the specified site of Host Strains genome, screened with ErmC.
The building process of pYF-tsDE plasmids is：By plasmid pUC57-KS-erm, (commission Genscript synthesis, sequence is shown in
CN 104073458A, Fig. 2) use BglII double digestions, recovery purifying 3.8kbp fragment, with T4 ligases (New England
Biolabs) connect certainly, the plasmid cloned is exactly pYF-tsDE.Transformant is bred in E.coli TOP10, and conduct
The skeleton of all genetic manipulations below.
Embodiment 2:The structure of protease-deficient B.licheniformis bacterial strains
As restructuring enzyme product host cell genetic engineering bacterial strain had document report (Widner et al.,
Journal of Industrial Microbiology&Biotechnology,25,204-212,2000).These restructuring
Host cell generally comprises expression of the nucleic acid structure to enzyme of one or more encoding target sequences.In the present invention,
B.licheniformis is used as the recipient bacterium of genetic manipulation.Bacillus conversion can pass through highly developed hand at present
Section reaches, such as competent cell conversion, electricity conversion and protoplast transformation (Young et al., J Bacteriology,
81,823-829,1961；Shigekawa et al.,Biotechniques,6,742-751,1988；Chang et al.,
Molecular General Genetics,168,111-115,1979)。
In the present invention, a single alpha-amylase variants expression cassette, comprising natural or synthesis promoter sequence,
One signal peptide sequence for being screened from bacillus, the ribosome bind site of a synthesis, one comes from
B.licheniformis alpha-amylase variants encoding gene, and a transcription terminator.Such design will greatly enhance place
The secretory volume of the expression of gene and alpha-amylase variants in main bacterial strain.Alpha-amylase variants encoding gene is replaced
Specific site in B.licheniformis cellular genomes is to recombinate to realize by plasmid-mediated single cross-over homologous.
In B.licheniformis, the active secretion to heterologous enzyme of extracellular protease is unfavorable.Confirm
2 kinds of main extracellular proteases：Subtilisin (AprE), glutamic acid-specific protease (Blase),
The extracellular protease activity of big paces is all derived from both protease in B.licheniformis.
In the present invention, in order to obtain the structural integrity of alpha-amylase variants gene expression, above-mentioned two gene is gone out
It is living, use continuity mode Characteristics for Single Staggered Campbell's type mechanism.Concrete operations are as follows：
2.1pYF-tsDE after BglII digestions with CIP processing via being suppressed from connecting；
2.2 gene knockout
(1) in order to obtain each gene delection fragment, using B.lieheniformis genomic DNA as template PCR method
About 500bp homologous sequence is respectively expanded from the gene both sides to be lacked.The monoclonal of bacillus subtilis passes through 98 DEG C, 5 points
It can directly be used after clock pre-degeneration as genomic DNA template in PCR reactions.
Synthesized for the PCR primers reacted by Genscript companies.Primer sequence is as follows：
Amplification Apr gene upstream sequences primer be：
lichApr_F1 TTATTGAGCGGCAGCTTCGACATTGATCAGACCTT
lichApr_R1 CCTTACGGCATTCCTCTCAACAGCGGATCTTCAG
Amplification Apr downstream of gene sequences primer be：
lichApr_F2 CCTGAAGATCCGCTGTTGAGAGGAATGCCGTAAGG
lichApr_R2 ATGATGAGGAAAAAGAGTTTTTGGCTTGGGATGCTGAC
Amplification Blase gene upstream sequences primer be：
blalich_F1 TTATTGTGCGCTGTTTTTCCAGTTGGTCAAATTGTCG
blalich_cR1 CGGACAAGGGTCACCAACGGGACAACTGTTACCATC
Amplification Blase downstream of gene sequences primer be：
blalich_cF2 GATGGTAACAGTTGTCCCGTTGGTGACCCTTGTCC
blalich_R2 CGGCGTTGGTTAGTAAAAAGAGTGTTAAACGAGGTTTGAT
PCR amplification system is 50ul, and response procedures are as follows：
(1) 98 DEG C, 8 minutes of 14580 monoclonal pre-degenerations of bacillus subtilis B.licheniformis；
(2) 96 DEG C, 15 seconds；
(3) 58 DEG C, 15 seconds；
(4) 72 DEG C, 30 seconds；Repeat 2-4 steps 25-30 times；
(5) 72 DEG C, 2 minutes are extended eventually.
PCR primer is pursued progress kits after being detected with 0.8% agarose gel electrophoresis with love.
The target gene of the internal about 400-500bp sequence deletions of 2.3 overlapping PCR methods amplification
Gene internal deletion fragment is obtained with overlapping PCR method (overlap extension PCR, SOE), specifically
Operation is as follows：
(1) each upstream region of gene, downstream PCR fragment and purified in being separately recovered 2.2；
(2) with the upstream and downstream homologous sequence fragment 1 of each target gene:As template after 1 mixed in molar ratio, primer XX- is used
CZ-F1 and XX-CZ-R2 (" XX " represents Apr or Blase) PCR amplifications obtain the AprE genes or Blase bases of internal deletion fragment
Cause.
Above-mentioned fragment is then recombinated into by BglII lines with Clone-EZ Cloning Kits (offer of Genscript companies)
In the pYF-tsDE carriers of property, the recombinant plasmid of acquisition is respectively designated as：PYF-tsDE-Apr and pYF-tsDE-Blase.This
A little recombinant plasmids are temperature sensitive type plasmid, wherein the Apr genes or Blase genes that include lacked for complete genome it is interior
Portion about 400-500bp sequence.
The replacement of iso-allele can not realized by homologous recombination.Method is referring to CN102124112A, it is possible to use
The method of other known homologous recombinations of this area.
2.4 plasmids are converted
Using that will knock out plasmid, to be transformed into method and screening process in B.lieheniformis competent cell as follows for this experiment：
(1) by temperature sensitive type plasmid pYF-tsDE-Apr or pYF-tsDE-Blase convert B.lieheniformis (CICC 22794, in
State microorganism fungus kind storehouse is bought) competent cell；
(2) under conditions of 30 DEG C, used on LB (every liter of 10g containing peptone, yeast extract 5g, sodium chloride 10g) culture medium
Erythromycin (5ug/ml) resistance carrys out screening positive clone bacterial strain；
(2) cultivated under conditions of positive colony bacterial strain being transferred into 37 DEG C again, the temperature-sensitive plasmid is fused to host
On genome.In order that gene is replaced in the site of setting, select several clones and connect while being inoculated in 2 × YT culture mediums
After continuous culture 24 hours again subculture once, whole process subculture 4-5 times (generally requiring 5-7 days).
(3) bacillus subtilis cell of screening erythromycin-sensitive enters performing PCR identification and can put down simultaneously with 1% skim milk LB
The strain that plate observes after hydrolysis, knockout should show the hydrolysis circle being reduced significantly.
Identification PCR primer used：
AprE：Apr-seqF1/Apr-seqR3
Blase：Blase-seqF1/Blase-seqR3
Apr-seqF1：GCCAGGTTGAAGCGGTCTATTCAT
Apr-seqR3：TACGGCCATCCGACCATAATGGAAC
Blase-seqF1：GAAGAGCCGGTCACAATTGC
Blase-seqR3：GGCCGTTAGATGTGACAGCC
Embodiment 3:The construction and integration of alpha-amylase variants bacterial strain
3.1 amylase express framework establishment
The structure of integrated plasmid is using the same method of above-mentioned pYF-tsDE plasmids.In order to which expression cassette is incorporated into design
AmyE sites on genome, the upstream and downstream in the AmyE sites on genome designs 800bp or so homology region, is connected to
One alpha-amylase variants expression cassette both sides.Simultaneously assemble some from first to last the bacterial chromosomal dna fragment of natural selection and
The composition sequence of function, these be all control table reach alpha-amylase variants gene necessary to.
One typical amylase expression cassette has following components composition：One typical alpha-amylase variants expression cassette
It is made up of elements below：One natural or synthesis promoter sequence (SEQ ID NO.5), the ribosomes of a synthesis is combined
Site aaaggagg, an alpha-amylase variants encoding gene for being derived from B.licheniformis (is respectively SEQ ID
NO.3) and one synthesis terminator sequence (SEQ ID NO.6).One strong natural signals for being screened from bacillus subtilis
Sequence (SEQ ID:NO.7 the upstream of alpha-amylase variants encoding gene promoters) is inserted into, the secretion to Enhanced expressing enzyme
Efficiency.Complete alpha-amylase variants expression cassette is inserted to the pYF- of linearisation with Clone-EZ Cloning Kits (Genscript)
BglII sites in tsDE, the temperature sensitive type integrated plasmid finally given is named as pYF-tsINT-amy (Fig. 3).Above-mentioned sequence
Synthesis completed by Genscript companies, by above-mentioned sequence successively it is seamless series connection obtain alpha amylase expression of enzymes frame.This framework
Middle signal peptide sequence is filtered out from bacillus subtilis, can effectively improve the secretion of alpha amylase.
3.2 plasmids are converted
Above-mentioned whole alpha amylase expression cassette (including amyE gene upstream and downstream homologous fragment) is utilized into recombinant technique cyclisation
The pYF-tsDE plasmids (recombination kit is provided by Genscript companies) of BglII linearisations, the temperature sensitive type plasmid life built
Entitled pYF-tsINT-amy.The plasmid is used to convert in the bacillus licheniformis lacked to AprE and Blase protease genes
(CICC22794, Chinese microorganism strain storehouse is bought), the alpha-amylase variants expression cassette of non-resistant mark will replace AmyE.Using
Above-mentioned method, the bacterial strain successfully integrated on alpha-amylase variants encoding gene to B.licheniformis chromosomes forms sediment in blueness
Transparent circle is produced on powder flat board, PCR further verifies that expression cassette is incorporated into the AmyE sites of F-strain.
The B.licheniformis engineered strains of alpha-amylase variants are produced in -80 DEG C of preservations.
According to the method described above, B.licheniformis alpha-amylase variants encoding gene is replaced with into coding for alpha respectively to form sediment
Powder enzyme variants 2, alpha-amylase variants 3, alpha-amylase variants 4, the gene of alpha-amylase variants 5, which can be built, to be obtained expressing alpha amylase
Variant 2, alpha-amylase variants 3, alpha-amylase variants 4, the engineering bacteria of alpha-amylase variants 5.
Embodiment 4:The shake flask fermentation of alpha-amylase variants production
The bacterial colony (containing alpha-amylase variants expression cassette) of an activation is taken, is inoculated into 20ml culture mediums and (contains
Malt syrup 4.0%, peptone 2.0%, dusty yeast 0.1%KH2PO40.6% and corresponding antibiotic) culture arrive logarithmic phase.
1.2ml nutrient solutions are taken to be inoculated into 30ml culture mediums (containing malt syrup 12.0%, peptone 1.0%, dusty yeast 1%KH2PO4
0.2%, MnCl20.003%), 120rpm shaken cultivations 3 days in reciprocal shaker.Respectively at 24 hours, 48 hours and 72 small
When sample 1ml, 1000rpm centrifugations 1min.Supernatant is preserved, SDS-PAGE analyses are done.Alpha-amylase variants molecular weight is about
53kD。
Determine alpha-amylase variants activity, method be the same as Example 6.
Embodiment 5:Alpha-amylase variants substep fed-batch fermentation technique
The line of genetic engineering B.licheniformis bacterial strains and agar by -80 DEG C of freezen protectives obtained in embodiment 3
On inclined-plane, 37 DEG C are stayed overnight renewal cultivation.Agar slant formula is as follows：Peptone 1%, yeast extract 0.5%, NaCl 1%,
Agar powder 2%.
First, several fresh colonies are chosen to cultivate 16 hours in 37 DEG C in the seed flask for filling 50ml culture mediums.Kind
Sub- shaking flask formula：Malt syrup 4.0%, peptone 2.0%, yeast extract 0.1%, KH2PO40.6%., will after 16 hours
All seed fermentation liquid is fully transferred to fill in the 7L stainless steel fermentation tanks of 4L culture mediums in 37 DEG C, mixing speed
350rpm, Ventilation Rate is continuing fermentation 12 hours under conditions of 650L/H.Fermentation tank is formulated：Malt syrup 6.0%, peptone
1.0%, yeast extract 1%, KH2PO40.2%, MnCl20.003%.Then with 5% phosphoric acid control fermentation pH 5.7 ±
0.2 or so, and constantly mended into fermentation tank with speed 0.5L/18hrs with 110 hours after speed 1L/18hrs at first 18 hours
Material.Feed supplement formula is as follows：Malt syrup 48%, peptone 6%, yeast extract 8%.Whole fermentation process continues 140-150
Hour.Collect and at 4 DEG C, 1010krpm, all culture mediums in 30 minutes centrifugation fermentation tanks, the supernatant after centrifugation is used for α starch
Enzyme variants enzyme activity is analyzed.
Embodiment 6:Amylase activity is determined
Amylase activity measure is hundred this outstanding amylase activities (BAU).The definition of 1 BAU unit：In pH6.0,70
Under the conditions of DEG C, the enzyme amount required for 1 minute liquefaction 1mg soluble starch.
Briefly, enzyme activity determination is operated as follows：20ml 20g/L soluble starches solution and 5ml pH6.0 phosphoric acid buffers
Liquid is mixed, and first preheats 8min at 70 DEG C, and then the enzyme liquid added after 1.0ml dilutions, accurate response 5 minutes takes 1ml reaction solutions,
Add in the test tube for filling 0.5ml 0.1mol/L hydrochloric acid solutions and the dilute iodine solutions of 5ml in advance, shake up, and with 0.5ml 0.1mol/L
Hydrochloric acid solution and the dilute iodine solutions of 5ml are blank, under 660nm wavelength, its light absorption value is determined rapidly, is tabled look-up according to absorbance, are obtained
The enzyme activity of test sample.
Embodiment 7:The application of amylase
The present embodiment illustrates the effect of the present invention by taking alpha-amylase variants of the amino acid sequence as shown in SEQ ID NO.4 as an example
Really.Wherein " 8008 mutant 1 " are alpha-amylase variants of the amino acid sequence as shown in SEQ ID NO.4.
Except what is illustrated in addition, 1BAU:The vitality test of amylase is hundred this outstanding amylase units (BAU).One BAU
It is defined as under the conditions of pH6.0,70 DEG C, the enzyme amount required for 1 minute liquefaction 1mg soluble starch.
tDS:Dry per ton
The amylase variant obtained is expressed and separated from Bacillus licheniformis cell carries out first with cornstarch first
Wheel liquefaction test.Test condition：18 Baume degrees (° B é), fully mixing, pH are adjusted with hydrochloric acid to 5.2.Add 0.4kg/tDS's
Amylase, be respectively adopted injection temperation 100,105,108,112,115 DEG C, maintain 5-8min after flash, 95 DEG C maintenance 120min.
DE and iodine examination test are carried out after liquefaction, while noting the flocculation of observation albumen and viscosity situation, using Wild type as control, as a result
It is shown in Table lattice 1 and Fig. 4.
Table 1:Under the conditions of different injection temperations, amylase liquefaction application is compared
As a result show, 8008 mutant 1 are substantially better than wild type, 8008 mutant in the case of different injection temperations,
100th, 105,108 DEG C of liquefaction are excessive, and 112 DEG C of liquefaction are just right, and albumen flocculates, and at 115 DEG C, liquefaction effect still compared with
Good, albumen flocculation is normal, illustrates that amylase variant of the present invention has extraordinary heat resistance, and wild type are not resistant to 115
DEG C high temperature.
Secondly, we are tested by the liquefaction under different starch slurry concentration conditions, determine amylase dense to high substrate
The tolerance of degree.Liquefaction reaction condition is same as above, and injection temperation is 108 DEG C, using Wild type as control, the results are shown in Table 2 Hes
Fig. 5.
Table 2:Under different starch slurry concentration, amylase liquefaction application is compared
| Baume degrees (° B é) | Wild type DE (%) | 8008 mutant 1DE (%) |
| 15 | 15.27 | 18.31 |
| 18 | 15.04 | 18.18 |
| 20 | 14.98 | 18.11 |
| 22 | 12.49 | 16.64 |
As shown in table 2,8008 mutant 1 are substantially better than wild type, and 8008 mutant 1 are in different starch slurry concentration bars
Under part, under the conditions of at concentrations up to 22 ° B é of starch slurry, L-type amylase remains to normal liquefaction, illustrates that amylase variant of the present invention can be with
Carry out underflow liquefaction, effectively save factory cost.
Then, we determine the acid resistance of amylase, while carrying out the liquefaction performance under the conditions of different enzyme concentrations.Liquefaction
Reaction condition is same as above, and pH is 5.0, enzyme concentration is respectively 0.2,0.3,0.4,0.5,0.6kg/tDS, using wild type as
Control, the results are shown in Table 3 and Fig. 6.
Table 3:Under pH5.0, amylase difference enzyme concentration liquefaction application is compared
| Enzyme concentration (kg/tDS) | Wild type DE (%) | 8008 mutant 1DE (%) |
| 0.2 | 8.24 | 11.26 |
| 0.3 | 11.61 | 14.58 |
| 0.4 | 14.98 | 18.29 |
| 0.5 | 15.16 | 18.41 |
| 0.6 | 16.77 | 20.17 |
As shown in table 3,8008 mutant 1 are substantially better than wild type, and 8008 mutant 1 are in low pH, 0.2-0.3kg/
Under the conditions of tDS additions, L-type amylase variant remains to normal liquefaction, illustrates that amylase variant of the present invention has to low pH stronger
Tolerance, while under the conditions of the low enzyme concentrations of 0.2kg/tDS, amylase variant of the present invention remains to normal liquefaction, and this can be effective
Reduce factory's enzyme cost.
In addition, the influence test We conducted amylase to saccharification, while with Wild type amylase, Liquozyme
The obtained liquefier of Supra (being purchased from Novozymes) liquefaction is contrasted, test condition：It is 32% dry (DS), fully mixed
Even, pH is adjusted with hydrochloric acid to 4.3.0.45kg/tDS compounded saccharifying enzymes are added, 200ml reaction reacts 24 and 48 respectively at 60 DEG C
Hour.Sample is used for HPLC analyses after 0.22um membrane filtrations and 100 DEG C of inactivations.It the results are shown in Table 4.
Table 4:Influence of the amylase to saccharification
As shown in table 4, using amylase variant liquefier of the present invention and Wild type liquefiers, amylase of the present invention becomes
Body saccharification result is substantially better than Wild type, while using amylase variant liquefier of the present invention and Liquozyme Supra liquid
Change liquid, both saccharification results are just the same, illustrate that amylase variant of the present invention can apply to starch sugar industry.
In addition, the influence test We conducted amylase to wheaten starch, test condition：22nd, 25,28,30% (W/W)
Different concentration of substrate, fully mixing, pH are adjusted with hydrochloric acid to 5.6.0.4kg/tDS amylase is added, using 91-95 DEG C of maintenance
120min.After liquefaction carry out DE and iodine examination test, while note observation albumen flocculation and viscosity situation, using wild type as pair
According to the results are shown in Table 5 and Fig. 7.
Table 5:Under the conditions of different concentration of substrate, amylase liquefaction application is compared
| Concentration of substrate (%) | Wild type DE (%) | 8008 mutant 1DE (%) |
| 22 | 20.85 | 20.76 |
| 25 | 20.21 | 20.47 |
| 28 | 19.64 | 19.59 |
| 30 | 18.14 | 18.90 |
As a result show, 8008 mutant 1 are similar to wild type results, in the case of different concentration of substrate, 22-25%
Liquefaction is just right, and albumen flocculates, and 28 and 30%, liquefaction effect is still preferable, and albumen flocculation is normal, illustrates the present invention
Amylase variant can carry out underflow liquefaction, effectively save factory cost.
Secondly, we determine the acid resistance of amylase, while carrying out the liquefaction performance under condition of different pH.Liquefaction reaction
Condition is same as above, and pH is respectively 4.8,5.2,5.6,6.0, and enzyme concentration is 0.4kg/tDS, using wild type as control, as a result
It is shown in Table 6 and Fig. 8.
Table 6:Under different pH, amylase liquefaction application is compared
| pH | Wild type DE (%) | 8008 mutant 1DE (%) |
| 4.8 | 8.11 | 14.41 |
| 5.2 | 20.43 | 20.03 |
| 5.6 | 21.77 | 21.41 |
| 6.0 | 21.97 | 21.53 |
As shown in table 6, under the conditions of pH4.8, amylase variant of the present invention remains to normal liquefaction, illustrates amylase of the present invention
Variant has stronger tolerance to low pH, and wild type are not resistant to low pH.
Then, the influence test We conducted amylase to rice, test condition：12nd, 15,18,20 Baume degrees (° B é)
Different concentration of substrate, fully mixing, pH are adjusted with hydrochloric acid to 5.2.Addition 0.4kg/tDS amylase, 108 DEG C of injection temperation,
Maintain to flash after 5-8min, 95 degree of maintenance 120min.After liquefaction carry out DE and iodine examination test, while note observation albumen flocculation and
Viscosity situation, using wild type as control, the results are shown in Table lattice 7 and Fig. 9.
Table 7:Under the conditions of different concentration of substrate, amylase liquefaction application is compared
| Concentration of substrate (° B é) | Wild type DE (%) | 8008 mutant 1DE (%) |
| 12 | 19.53 | 22.15 |
| 15 | 18.87 | 21.48 |
| 18 | 17.06 | 21.05 |
| 20 | 15.72 | 20.24 |
As a result show, 8008 mutant 1 are substantially better than wild type, 8008 mutant in the case of different concentration of substrate,
12-18 ° of B é liquefaction is just right, and albumen flocculates, and in 20 ° of B é, liquefaction effect is still preferable, and albumen flocculation is normal, explanation
Amylase variant of the present invention can carry out underflow liquefaction, effectively save factory cost.
Secondly, we are tested by the liquefaction under the conditions of different starch pH (4.8,5.2,5.4,5.6,5.8), are determined
Tolerance of the amylase to high concentration of substrate.Liquefaction reaction condition is same as above, and injection temperation is 108 DEG C, and enzyme concentration is
0.4kg/tDS, using wild type as control, the results are shown in Table 8 and Figure 10.
Table 8:Under different pH, amylase liquefaction application is compared
| pH | Wild type DE (%) | 8008 mutant 1DE (%) |
| 4.8 | 7.46 | 16.23 |
| 5.2 | 16.89 | 20.64 |
| 5.4 | 17.42 | 21.16 |
| 5.6 | 17.96 | 21.70 |
| 5.8 | 18.44 | 22.24 |
As shown in table 8, under the conditions of pH4.8-5.8, amylase variant of the present invention remains to normal liquefaction, illustrates present invention shallow lake
Powder enzyme variants have stronger tolerance to low pH, and wild type acid resistances are poor.
Finally, because amylase has important application in alcohol industry production, we are also tested for amylase and given birth in alcohol
Liquefaction effect in production, prepares the corn flour (40 mesh) of different material-water ratios, with salt acid for adjusting pH to 5.8, adds 0.145kg/tDS
Amylase.In 95 DEG C of cooking and liquefaction 120min.Reaction terminate after, determination sample DE and viscosity, at the same with Liquozyme Supra
(being purchased from Novozymes) carries out contrast test,.It the results are shown in Table 9 and Figure 11
Table 9:Application of the amylase in corn alcohol liquefaction is compared
| The corn flour of different material-water ratios | DE (%) | Viscosity (mPas) |
| Amylase -1:2 | 12.72 | 1488 |
| Amylase -1:2.3 | 13.03 | 1078 |
| Amylase -1:2.5 | 13.15 | 531 |
| Amylase -1:2.7 | 13.26 | 371 |
| Liquozyme Supra-1:2 | 12.19 | 1702 |
| Liquozyme Supra-1:2.3 | 12.78 | 1114 |
| Liquozyme Supra-1:2,5 | 12.88 | 506 |
| Liquozyme Supra-1:2.7 | 13.32 | 352 |
As shown in table 9, amylase variant of the present invention can reach similar application effect to Liquzoyme Supra.Say
Bright its can apply to corn alcohol industry.
Embodiment 8
According to the method for embodiment 7, alpha-amylase variants 2, alpha-amylase variants 3, alpha-amylase variants 4, α starch have been investigated
The heat resistance and pH tolerances of enzyme variants 5, as a result show, these four amylase variants also have close with alpha-amylase variants 1
Feature, i.e., under pH 5.0-5.8 acid conditions and have higher catalytic activity under the conditions of 100 DEG C of high temperature above.
In summary, according to the experimental result in the present invention, amylase variant of the present invention has preferable heat resistance, pH tolerances
Property, the liquefaction of high concentration starch slurry is can apply to, therefore can apply to starch sugar industry and alcohol industry.
In addition to the embodiments of the invention technical method in the art except applying, the guidance of more too busy to get away inventive concept.
Therefore, the present invention is not limited only to disclosed specific embodiment, more to cover the revised provision in spirit and scope of the invention, in detail
See claim.
Claims (18)
1. a kind of alpha-amylase variants, it is characterised in that at least one amino acid residue in parental generation alpha amylase amino acid sequence
Mutation, increase or deletion are obtained, while having remained in that the alpha amylase of the ability of parental generation hydrolyzing alpha-Isosorbide-5-Nitrae glycosidic bond；The two amino
Acid sequence homology reaches more than 95%.
2. alpha-amylase variants according to claim 1, it is characterised in that described parental generation alpha amylase is bacterial alpha starch
Enzyme, selected from Bacillus subtilis, B.licheniformis, B.amyloliquefaciens,
The alpha amylase of any one in G.stearothermophilus or Bacillus cereus；It is preferred that
B.licheniformis or G.stearothermophilus alpha amylase, further preferred B.licheniformis α forms sediment
Powder enzyme.
3. alpha-amylase variants according to claim 3, it is characterised in that described B.licheniformis alpha amylase
Total length coding gene sequence see SEQ ID NO.1；Corresponding amino acid sequence is shown in SEQ ID NO.2.
4. alpha-amylase variants according to claim 3, it is characterised in that described alpha-amylase variants are selected from following any
A kind of any combination of or following three kinds of situations：
(1) amino acid residue of its N- end the 1st to the 2nd is lacked by B.licheniformis parental generation alpha amylase to obtain；
(2) increase by 1 to 5 amino acid residue in B.licheniformis parental generation alpha amylase N- ends to obtain；
(3) its -terminal amino acid residue is lacked by B.licheniformis parental generation alpha amylase and be substituted for 2 to 4 its
His amino acid residue；Described 2 are to 4 other amino acid residue preferred AN or DGL or AAPF；
(4) increase by 3 to 5 amino acid residues in B.licheniformis parental generation alpha amylase C- ends to obtain；Described
3 to 5 amino acid residues of increase preferably increase amino acid residue KTT or KTTVS.
5. alpha-amylase variants according to claim 3, it is characterised in that described alpha-amylase variants are selected from following any
It is a kind of：
(1) increase by two amino acid residues A and N in B.licheniformis parental generation alpha amylase N- ends to obtain；
(2) increase by two amino acid A and N in B.licheniformis alpha amylase N-terminal, and increase by five amino in C-terminal
Sour KTTVS is obtained；
(3) increase by two amino acid A and N in B.licheniformis alpha amylase N-terminal, and increase by three amino in C-terminal
Sour KTT is obtained；
(4) B.licheniformis alpha amylase N- terminal deletion amino acid residue V and be substituted for 4 amino acid residues
AAPF is obtained；
(5) alpha-amylase variants described in pass through first amino acid of alpha amylase N- terminal deletions in B.licheniformis
Residue V is simultaneously substituted for 3 other amino acid residues DGL and obtained.
6. alpha-amylase variants according to claim 5, it is characterised in that described alpha-amylase variants be
B.licheniformis parental generation alpha amylase N- ends increase by two amino acid residues A and N and obtained, and described alpha amylase
Variant still maintains the ability of the glycosidic bond of parental generation alpha amylase hydrolyzing alpha -1,4.
7. the alpha-amylase variants according to claim 5 or 6, it is characterised in that the amino acid sequence of described alpha-amylase variants
Row are as shown in SEQ ID NO.4 in sequence table.
8. alpha-amylase variants according to claim 7, it is characterised in that the nucleotide coding of described alpha-amylase variants
Sequence is as shown in SEQ ID NO.3 in sequence table.
9. the gene of coding alpha-amylase variants according to any one of claims 1 to 6.
10. gene according to claim 9, it is characterised in that nucleotide sequence is as shown in SEQ ID NO.3 in sequence table.
11. the expression vector for expressing alpha-amylase variants according to any one of claims 1 to 6, it is characterised in that contain
The gene of coding alpha-amylase variants described in claim 9 or 10.
12. expression vector according to claim 11, it is characterised in that described expression vector includes main by a day
Right or synthesis promoter sequence, a natural or synthetic ribosome bind site, a natural or synthetic terminator
Sequence, and the gene order of the coding alpha-amylase variants described in claim 9 together constitute an expression component.
13. a kind of recombinant cell for being used to express alpha-amylase variants according to any one of claims 1 to 6, it is characterised in that
Include the gene of the coding alpha-amylase variants described in claim 9.
14. recombinant cell according to claim 13, it is characterised in that the host cell of recombinant cell is selected from Bacillus
Bacterial strain, preferably B.licheniformis or the Bacillus bacterial strains that some endogenous proteins have been inactivated by genetic engineering transformation.
15. recombinant cell according to claim 14, it is characterised in that the host cell of recombinant cell, which is selected from, passes through gene
The engineered B.licheniformis for having inactivated AprE and/or Blase.
16. a kind of production method of alpha-amylase variants according to any one of claims 1 to 6, it is characterised in that be included in suitable
The recombinant cell containing coding alpha-amylase variants gene is cultivated under conditions of suitable alpha-amylase variants expression, and from restructuring
Alpha-amylase variants are obtained in cell or its culture supernatant.
17. application of the alpha-amylase variants according to any one of claims 1 to 6 in α -1,4 glycosidic bonds of Polysaccharides.
18. application according to claim 17, it is characterised in that described alpha-amylase variants are in high temperature and/or low pH bars
Application under part in α -1,4 glycosidic bonds of Polysaccharides；Preferably 80 DEG C~110 DEG C of described high temperature, further preferred 100 DEG C~
110℃；Described low pH preferable ph is 5.0~5.8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610817210.9A CN107312763B (en) | 2016-09-12 | 2016-09-12 | L-type alpha-amylase variants and its production method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610817210.9A CN107312763B (en) | 2016-09-12 | 2016-09-12 | L-type alpha-amylase variants and its production method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107312763A true CN107312763A (en) | 2017-11-03 |
| CN107312763B CN107312763B (en) | 2019-05-03 |
Family
ID=60184619
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610817210.9A Active CN107312763B (en) | 2016-09-12 | 2016-09-12 | L-type alpha-amylase variants and its production method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107312763B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101668855A (en) * | 2007-03-23 | 2010-03-10 | 丹尼斯科美国公司 | Enhanced amylase production by n-terminal addition to mature amylase protein |
-
2016
- 2016-09-12 CN CN201610817210.9A patent/CN107312763B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101668855A (en) * | 2007-03-23 | 2010-03-10 | 丹尼斯科美国公司 | Enhanced amylase production by n-terminal addition to mature amylase protein |
Non-Patent Citations (3)
| Title |
|---|
| LEE S.等: ""Comparison of starch hydrolysis activity and thermal stability of two Bacillus licheniformis alpha-amylases and insights into engineering alpha-amylase variants active under acidic conditions."", 《J BIOCHEM.》 * |
| YAMABHAI，M.等: ""Genbank序列登录号FJ556804.1"", 《GENBANK》 * |
| YUUKI T.等: ""UniProt-P06278"", 《CHEMBI》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107312763B (en) | 2019-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018129980A1 (en) | Method for efficiently expressing pullulanase in bacillus subtilis and recombinant bacillus subtilis | |
| JP6505240B2 (en) | Method of producing and using truncated pullulanase | |
| CN109321552B (en) | Novel pullulanase, gene thereof, engineering bacteria and preparation method | |
| CN103834629A (en) | Recombinant high-temperature pullulanase and preparation method thereof | |
| CN109182304B (en) | Alpha-amylase gene and application thereof | |
| CN112301012B (en) | Cyclodextrin glucosyltransferase mutant and construction method thereof | |
| CN108699544B (en) | Alpha-amylase variants and uses thereof | |
| CN107312763B (en) | L-type alpha-amylase variants and its production method | |
| CN107326020A (en) | A kind of L-type amylase variant and application | |
| CN107312764A (en) | Alpha-amylase variants | |
| CN101457230B (en) | High efficiency preparation method of high temperature alpha-amylase and mutant thereof | |
| CN116254249A (en) | Construction of recombinant bacterium for expressing chitinase and preparation of high-enzyme activity mutant | |
| CN107345223B (en) | Alpha-amylase variants and its application | |
| CN115197924B (en) | Pullulanase | |
| CN106978409B (en) | Efficient preparation method of alpha-glucosidase | |
| CN107345224A (en) | Amylase application | |
| CN114606216A (en) | Alpha-amylase mutant Q441N/N442H with improved expression level as well as coding gene and application thereof | |
| CN112210544B (en) | Cyclodextrin glucosyltransferase mutant and application thereof | |
| WO2020213604A1 (en) | NOVEL β-AMYLASE AND METHOD FOR UTILIZATION AND PRODUCTION THEREOF | |
| CN116426447A (en) | Oligosaccharide debranching enzyme extracellular expression system and application thereof in hydrolysis of isomaltooligosaccharide | |
| CN114457058A (en) | Mutation improvement method and application of feeding alpha amylase | |
| CN115873772A (en) | Bacillus subtilis recombinant strain for efficiently expressing raw starch alpha-amylase and application thereof | |
| CN117904079A (en) | Alpha-amylase mutant, gene, vector and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |