CN107345223B - Alpha-amylase variants and its application - Google Patents
Alpha-amylase variants and its application Download PDFInfo
- Publication number
- CN107345223B CN107345223B CN201610816934.1A CN201610816934A CN107345223B CN 107345223 B CN107345223 B CN 107345223B CN 201610816934 A CN201610816934 A CN 201610816934A CN 107345223 B CN107345223 B CN 107345223B
- Authority
- CN
- China
- Prior art keywords
- alpha
- amylase
- amylase variants
- gene
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2411—Amylases
- C12N9/2414—Alpha-amylase (3.2.1.1.)
- C12N9/2417—Alpha-amylase (3.2.1.1.) from microbiological source
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01001—Alpha-amylase (3.2.1.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses alpha-amylase variants and its applications.The alpha-amylase variants increase by two additional amino acid A and N by the alpha amylase N-terminal in B.licheniformis, and increase by five additional amino acid KTTVS in C-terminal and obtain, while having still maintained parental generation hydrolyzing alpha-Isosorbide-5-Nitrae glycosidic bond ability；It is preferred that the alpha-amylase variants as shown in SEQ ID NO.4.A series of alpha-amylase variants provided by the invention under pH 5.0-5.8 acid condition and have higher catalytic activity under 100 DEG C or more hot conditions.The acidproof and thermal stability of these alpha-amylase variants is suitable for starch liquefacation.
Description
Technical field
The invention belongs to enzyme engineering fields, are related to alpha-amylase variants and its application.
Background technique
In industry, mainly since alpha amylase come, these derive from the alpha amylase of microorganism for the hydrolysis of starch
With the synergistic application of other enzymes, such as Pullulanase, carbohydrase and glucose isomerase, can effectively starch-splitting divide greatly
Son, these micromolecular polysaccharides generated or monosaccharide have very in industries such as food manufacturing, cereal processing, beer processing, Alcohol Productions
It applies more, it is most important.Alpha amylase is under the jurisdiction of one kind of saccharification enzyme, its key structural feature is (α/β)8It folds,
In contain special starch substrates binding site, length is generally no more than 10 sugar monomers, but the combination of many amylase
Site acts on together, so that it may multi-point combination is carried out, to successfully shear starch polymer.
Alpha amylase can effectively shear α-Isosorbide-5-Nitrae glycosidic bond in starch substrates, to quickly reduce the molecule of starch substrates
Amount and viscosity, product are mainly the dextrin of different length.Alpha amylase has different types, the application of these types industrially
Condition is very different according to the sex character of required product.
Alpha amylase (α -1,4-glucan-4-glucanohydrolases, E.C.3.2.1.1) can effectively hydrolyze starch and
α-Isosorbide-5-Nitrae glycosidic bond in other polysaccharide.Production cost is improved and reduced to enzyme efficiency in hydrolytic process in view of in starch
Demand, seek the alpha amylase of effective starch liquefacation can be supported to have become the one of academia and industry in different application field
A important R&D direction.Currently with the focus of the technique improvement of the enzyme engineering enzyme mainly in heat resistance, degrees energy
Improvement and liquefaction effect promotion.
It is commercially valuable that many alpha amylases are found and defined from plant and microorganism, mainly include
B.licheniformis alpha amylase, B.amyloliquefaciens alpha amylase and G.stearothermophilus α starch
Enzyme, wherein being that have derivative variant quantity be at most, using also most wide to template with B.licheniformis α-amylase (L-type)
It is general.
It in the present invention, is the needs for adapting to industrialized production, we utilize B.licheniformis α-amylase (L
Type) be that template constructs a series of new alpha-amylase variants, improve the application efficiency of the enzyme, especially in low pH and
Liquefaction efficiency can match with the mainstream product in the market in the case where reducing additive amount.
Summary of the invention
The object of the present invention is to provide a series of B.licheniformis α-amylase (L-type) variants, the series variants
Liquefaction efficiency can be improved, and adapt to the demand of industrialized production.Especially 100 DEG C or more temperature and pH be 5.0-
Under conditions of 5.8, the enzyme activity of alpha-amylase variants of the invention and other properties can match with the mainstream product in the market.
The object of the present invention is to provide the genes for encoding the alpha-amylase variants.
It is yet another object of the invention to provide the production method of the alpha-amylase variants and applications.
The purpose of the present invention can be achieved through the following technical solutions:
A kind of alpha-amylase variants, the alpha-amylase variants pass through the alpha amylase N-terminal increasing in B.licheniformis
Add two additional amino acid A and N, and increases by five additional amino acid KTTVS in C-terminal and obtain, while still maintaining
The ability of -1,4 glycosidic bond of parental generation hydrolyzing alpha；The two amino acid sequence homology reaches 95% or more.
The preferably natural alpha amylase of the parental generation alpha amylase, i.e. bacterial alpha amylase, further preferred Bacillus
Subtilis, B.licheniformis, B.amyloliquefaciens, G.stearothermophilus or Bacillus
The alpha amylase of any one in cereus, still more preferably B.licheniformis or G.stearothermophilus
Alpha amylase, the most preferably alpha amylase of B.licheniformis.
The overall length coding gene sequence of the alpha amylase of the B.licheniformis is shown in SEQ ID NO.1；It is corresponding
Amino acid sequence is shown in SEQ ID NO.2.
The amino acid sequence of the alpha-amylase variants is further preferably as shown in SEQ ID NO.4.
The nucleotide coding sequence of the alpha-amylase variants is preferably freely shown in SEQ ID NO.3.
Encode the gene of alpha-amylase variants of the present invention.
The gene is preferably as shown in SEQ ID NO.3.
For expressing the expression vector of alpha-amylase variants of the present invention, wherein forming sediment containing coding for alpha of the present invention
The gene of powder enzyme variants.
The expression vector includes mainly by a promoter sequence that is natural or synthesizing, and one natural or synthetic
Ribosome bind site, the base of a natural or synthetic terminator sequence and coding alpha-amylase variants of the present invention
Because sequence constitutes an expression component together.
It is a kind of for expressing the recombinant cell of alpha-amylase variants of the present invention, wherein including this one or more hair
The gene of the bright coding alpha-amylase variants.
The host cell of recombinant cell preferably is selected from Bacillus bacterial strain, further preferred B.licheniformis or process
The Bacillus bacterial strain for having inactivated some endogenous proteins is transformed in genetic engineering；Most preferably inactivated by genetic engineering transformation
The B.licheniformis of AprE and/or Blase.
A kind of production method of alpha-amylase variants of the present invention, including being suitable for the condition of alpha-amylase variants expression
Under the recombinant cell containing coding alpha-amylase variants gene order is cultivated, and from recombinant cell or its culture supernatant
Alpha-amylase variants are obtained in liquid.
Application of the alpha-amylase variants of the present invention in α -1,4 glycosidic bond of Polysaccharides；It is preferred that high temperature and/
Or the application under low ph condition in α -1,4 glycosidic bond of Polysaccharides；It is preferably 80 DEG C~110 DEG C of the high temperature, further excellent
Select 100 DEG C~110 DEG C；The low pH preferable ph is 5.0~5.8.
Beneficial effect
A series of alpha-amylase variants provided by the invention, under pH 5.0-5.8 acid condition and 100 DEG C or more high temperature items
There is higher catalytic activity under part.The acidproof and thermal stability of these alpha-amylase variants is suitable for starch liquefacation.
Detailed description of the invention
Fig. 1 is pYF-tsDE carrier, including a temperature sensitivity original part (having replication activity at 30 DEG C), an erythromycin are determined
Determine gene (ErmC) -- it can be resistant to the erythromycin of 300 μ g/mL in E.coli and can be resistant in B.licheniformis
The erythromycin of 5 μ g/mL.The recombinant host cell containing coding alpha-amylase variants nucleotide sequence is filtered out with erythromycin.
Fig. 2 is the schematic diagram of pUC57-KS-erm carrier, and the pYF-tsDE that can be obtained in the present invention from the carrier is carried
Body.
Fig. 3 is the schematic diagram of pYF-tsINT-amy carrier.
Fig. 4 is under the conditions of different injection temperations, amylase liquefaction application compares.
Fig. 5 is under different starch slurry concentration, and amylase liquefaction application is compared.
Fig. 6 is at pH5.0, and the liquefaction application of amylase difference enzyme concentration is compared.
Fig. 7 is under the conditions of different concentration of substrate, amylase liquefaction application compares.
Fig. 8 is under condition of different pH, and amylase liquefaction application is compared.
Fig. 9 is under the conditions of different concentration of substrate, amylase liquefaction application compares.
Figure 10 is under condition of different pH, and amylase liquefaction application is compared.
Figure 11 is that application of the amylase in corn alcohol liquefaction is compared.
Detailed description of the invention
Unless otherwise prescribed, all technical and scientific terms having the same meaning in the present invention, is generally understood as
General professional technique.In this application, certain explicans are the same as described in specification.It must be noted that used herein and institute
Attached claim, singular "one" " this " includes plural form, unless otherwise expressly specified in context.
In the present invention, alpha amylase refers to the α-Isosorbide-5-Nitrae glycosidic bond enzyme for capableing of Polysaccharides.For example, alpha amylase can incite somebody to action
Starch Hydrolysis is at dextrin.
In the present invention, parental generation alpha amylase refers to natural alpha amylase.Natural alpha amylase is bacterial alpha amylase, source
Including but not limited to Bacillus subtilis, B.licheniformis, B.amyloliquefaciens,
G.stearothermophilus and Bacillus cereus.
Preferred embodiment in accordance with the present invention, natural alpha amylase are derived from Bacillus strain ----especially
B.licheniformis and G.stearothermophilus.The complete encoding sequence of B.licheniformis is shown in SEQ ID
NO.1；Corresponding amino acid sequence is shown in SEQ ID NO.2.
In the present invention, term " alpha-amylase variants " refer to it is non-naturally occurring, in the alpha amylase amino acid sequence of parental generation
Effective point carry out the increase, deletion and/or substitution of one or several amino acid residues, while having still maintained parental generation hydrolysis
The alpha amylase of the ability of α -1,4 glycosidic bond.
" liquefaction " is generally referred to the process for the polysaccharide that carbohydrate breakdown is small molecule in the present invention.It forms sediment when α is added
When powder enzyme or alpha-amylase variants, " liquefaction " refers in particular to α-Isosorbide-5-Nitrae glycosidic bond of hydrolysis carbohydrate.
In the present invention, " α-Isosorbide-5-Nitrae glycosidic bond ", which refers to, connects the C1 of previous glucose and the C4 of the latter glucose
Key, as α-Isosorbide-5-Nitrae glycosidic bond.
The present invention relates to " alpha-amylase variants " that parental generation alpha amylase is done to sequence alterations acquisition.Parental generation alpha amylase is day
Right alpha amylase especially derives from the natural alpha amylase of bacterium.According to an embodiment of the invention, alpha-amylase variants refer to parent
Effective point of the alpha amylase amino acid sequence in generation carries out the increase, deletion and/or substitution of one or several amino acid residues,
The alpha amylase of the ability of -1,4 glycosidic bond of parental generation hydrolyzing alpha has been still maintained simultaneously.
The present invention includes a series of alpha-amylase variants.According to an embodiment of the invention, this series of alpha amylase becomes
The homology of the amino acid sequence of body is at least up to 95%, respectively reaches 95%, 96%, 97%, 98%, 99% or 100%.
As illustrative and non-limiting example of the present invention, alpha-amylase variants are the parental generations by B.licheniformis
Alpha amylase increases by two amino acid residue AN in its end N-, and its end C- increases by 5 amino acid residues on this basis
KTTVS and obtain, see SEQ ID NO.4.
Alpha-amylase variants in the present invention maintain the ability of -1,4 glycosidic bond of hydrolyzing alpha.In addition, the property of these alpha amylases
It can use and above meet demand of industrial production, for example, catalytic activity is stablized under the raising of liquefaction efficiency, acid pH or hot conditions.
According to an embodiment of the invention, acid condition or temperature of the alpha-amylase variants in pH 5.0 are higher than 100 DEG C
Condition (especially temperature is between 100 DEG C -108 DEG C) under, catalytic activity stablize.The performance of these raisings of alpha-amylase variants
More adapt to the liquefaction reaction of starch industry.Because liquefaction process is usually carried out at low pH and hot conditions on starch industry.
All alpha-amylase variants of the invention may be used to liquefaction reaction.In a preferred embodiment, alpha amylase becomes
Body derives from parental generation alpha amylase, especially derives from the alpha amylase of B.licheniformis parental generation.Specifically it is being preferably implemented
In example, alpha-amylase variants amino acid sequence is as shown in SEQ ID NO.4 in sequence table.
According to the present invention, any to may be used to liquefaction reaction containing α-Isosorbide-5-Nitrae glycosidic bond carbohydrate.Contain one
Or multiple α-Isosorbide-5-Nitrae glycosidic bond carbohydrate includes but are not limited to starch, amylopectin, amylose and dextran.
Many carbohydrate contain α -1,6- glycosidic bond and α-Isosorbide-5-Nitrae-glycosidic bond, for example, amylopectin." α -1,4- sugar
Glycosidic bond " refers to the key that the C1 of previous glucose and the C4 of the latter glucose are connected, as α-Isosorbide-5-Nitrae glycosidic bond.Therefore,
Alpha-amylase variants of the invention can be used cooperatively in saccharifying with the Pullulanase for capableing of -1,6 glycosidic bond of hydrolyzing alpha.Energy
The enzyme of enough -1,4 glycosidic bonds of hydrolyzing alpha includes but are not limited to alpha amylase.In a preferred embodiment of the invention, catalytically hydrolyzing alpha-
The enzyme of 1,4 glycosidic bonds is alpha amylase.
Therefore, according to an embodiment of the invention, the method that further catalysis saccharification reaction improves efficiency is with the use of general
Shandong orchid enzyme.In the present invention, " Pullulanase " is the hydrolase for referring to hydrolyzing alpha -1,6 glycosidic bond.
Alpha amylase in the present invention and Pullulanase cooperate in the saccharifying of starch using can be improved glucose and
The purity of maltose.In addition, concentration of substrate can be effectively reduced using above-mentioned complex enzyme in saccharification reaction, transformation efficiency is improved,
Can also there be higher catalytic activity at acid pH or higher temperature, be suitable for industrially hydrolyzing the condition of starch.
The present invention provides a kind of alpha-amylase variants to be lauched in the temperature and pH condition of any suitable industrialized production
The method that solution α-Isosorbide-5-Nitrae glycosidic bond carries out saccharification reaction.According to the present invention, liquefaction reaction can be at a high temperature of 80 DEG C to 110 DEG C
Reaction, such as 80 DEG C, 90 DEG C, 100 DEG C, 105 DEG C and 110 DEG C.Saccharification reaction also can be in the condition of acidic pH of pH5.0 to pH5.8
Lower progress, such as pH5.0,5.2,5.4,5.6 and 5.8.
According to an embodiment of the invention, the liquefaction reaction of alpha-amylase variants catalysis is in acid pH and 100 DEG C of temperatures above items
Catalytic activity is stablized under part.
On the other hand, the expression vector in the present invention includes the nucleotide sequence of the coding alpha-amylase variants an of synthesis,
And recombinant host cell contains above-mentioned expression vector.Expression vector contains the nucleosides of the coding alpha-amylase variants an of synthesis
Acid sequence.Expression vector can be integrated on the genome of host cell.For example, expression vector contains the nucleotide sequence of synthesis
SEQ ID NO.3。
Expression vector in the present invention preferably includes natural or synthesis a promoter sequence, and one natural or synthetic
Ribosome bind site, a natural or synthetic terminator sequence.These hereditary original parts and the alpha-amylase variants of synthesis are compiled
Code sequence constitutes an expression component together, and expression component and carrier framework constitute expression vector.For example, expression vector packet
An expression component is included, and expressing component includes element below: a promoter sequence, the ribosome binding site of a synthesis
Point, the nucleotide sequence and a terminator sequence for encoding alpha-amylase variants in the present invention of a synthesis.Signal sequence can
Signal sequence is introduced expression vector or expression component, especially introduces signal sequence by the secretion for instructing alpha-amylase variants
The upstream of initiation codon is more advantageous to the secretion of alpha-amylase variants.
Preferred embodiment according to the present invention, expression vector are suitable for expressing in bacterium, especially Bacillus bacterial strain, more suitable
Preferably expressed in B.licheniformis.In a particularly preferred embodiment, expression vector can be integrated into the gene of Bacillus
In group, especially on the genome of B.licheniformis.It can be used for being integrated into the host of the polynucleotide sequence in chromosome
The construction method of the expression vector of cell and this expression vector is that well-known one of Contemporary Biology field is common
Technical ability.
According to embodiments of the present invention, recombinant host cell can be transformed with genetic engineering and be become comprising one or more alpha amylases
The nucleic acid sequence of body gene expression.It includes one or more present invention that any technology, which is used equally for genetic engineering engineered host cell,
In alpha-amylase variants coding synthesis nucleic acid sequence, for example, chromosomal integration.Contain temperature sensitivity origin and resistance screening
The carrier of label can be used for integration step.These carriers are integrated by the specific region of Campbell's mechanism and genome, are passed through
Resistance screening obtains recombinant bacterium, and recombinant bacterium removes resistance screening label by homologous recombination in subsequent incubation.
According to embodiments of the present invention, recombinant host cell has inactivated some endogenous proteins by genetic engineering transformation.Energy
The endogenous being deactivated includes but is not limited to extracellular protease.The transformation of host cells of recombination contains alpha-amylase variants expression
Some endogenous proteins are inactivated before or after the nucleic acid sequence of gene.Method preferably is become being transferred to alpha amylase
The inactivation of host strain external source extracellular proteinase is carried out before the carrier of body expressing gene.
Firstly, B.licheniformis has inactivated some extrinsic protein enzyme genes by transformation.Especially
B.licheniformis bacterial strain can inactivate some extracellular proteases, such as subtilisin (AprE), glutamic acid-
specific protease(Blase).These genetic engineerings are transformed so that B.licheniformis bacterial strain alpha amylase preferably
The expression and secretion of variant.
The present invention provides a kind of production methods of alpha-amylase variants.According to an embodiment of the invention, this method is included in
It is suitable for being carried out under conditions of alpha-amylase variants are expressed to the recombinant host cell containing coding alpha-amylase variants nucleotide sequence
Culture, and alpha-amylase variants are obtained from recombinant host cell or its supernatant.
All recombinant host cells of the invention can produce alpha-amylase variants.Recombinant host cell contains at least
The nucleotide sequence of the coding alpha-amylase variants of one copy.The nucleotide sequence of these coding alpha-amylase variants can be suitable
Alpha-amylase variants are expressed under conditions of preferably.From the alpha-amylase variants secreted in recombinant host cell can from recombinant cell or on
It is collected into clear liquid.The method of collection includes but are not limited to filter, centrifugation etc..
It being capable of the shallow lake high yield α according to an embodiment of the invention, B.licheniformis is transformed by genetic engineering by fermentation
Powder enzyme variants.B.licheniformis has imported the nucleotide sequence of coding alpha-amylase variants by genetic engineering transformation.More
Good, the B.licheniformis in the present invention has eliminated resistance screening gene, environmental sound and the α produced
Amylase variant is particularly suited for food industry.
Following example further illustrates essence of the invention in the present invention.It should be appreciated that following example does not limit
The present invention, the scope of the present invention are determined by the attached claims.
Specific embodiment
The building of embodiment 1:pYF-tsDE plasmid
PYF-tsDE (Fig. 1) is the E.coli/B.licheniformis shuttle plasmid an of temperature sensitive type.The plasmid is by one
The replication orgin (active at 30 DEG C) of a responsive to temperature type and erythromycin resistance gene (ErmC) composition, the resistant gene
Resistance in E.coli is 300ug/ml, and the resistance in B.licheniformis is 5ug/ml.At 37 DEG C, on plasmid
Replication orgin inactivation, plasmid is integrated into the specified site of host strain genome, screened with ErmC.
The building process of pYF-tsDE plasmid are as follows: (commission Genscript synthesis, sequence are shown in by plasmid pUC57-KS-erm
CN104073458A, Fig. 2) use BglII double digestion, the segment of recovery purifying 3.8kbp, with T4 ligase (New England
Biolabs) connect certainly, the plasmid cloned is exactly pYF-tsDE.Transformant is bred in E.coli TOP10, and conduct
The skeleton of all genetic manipulations below.
Embodiment 2: the building of protease-deficient B.licheniformis bacterial strain
As recombination enzyme product host cell genetic engineering bacterial strain had document report (Widner et al.,
Journal of Industrial Microbiology&Biotechnology,25,204-212,2000).These recombinations
Host cell generally comprises expression of the nucleic acid structure of one or more encoding target sequences to enzyme.In the present invention,
B.licheniformis is used as the recipient bacterium of genetic manipulation.The conversion of Bacillus can pass through highly developed hand at present
Section reaches, if competent cell converts, electrotransformation and protoplast transformation (Young et al., J Bacteriology,
81,823-829,1961；Shigekawa et al.,Biotechniques,6,742-751,1988；Chang et al.,
Molecular General Genetics,168,111-115,1979)。
In the present invention, an individual alpha-amylase variants expression cassette, comprising naturally or synthesis promoter sequence,
One signal peptide sequence screened from bacillus, one synthesis ribosome bind site, one from
The alpha-amylase variants encoding gene of B.licheniformis and a transcription terminator.Such design will greatly enhance place
The secretory volume of the expression of gene and alpha-amylase variants in main bacterial strain.Alpha-amylase variants encoding gene is replaced
Specific site in B.licheniformis cellular genome is realized by plasmid-mediated single cross-over homologous recombination.
In B.licheniformis, the activity of extracellular protease is unfavorable to the secretion of heterologous enzyme.It has confirmed
2 kinds of main extracellular proteases: subtilisin (AprE), glutamic acid-specific protease (Blase),
The extracellular protease activity of big paces is all derived from both protease in B.licheniformis.
In the present invention, in order to obtain the structural integrity of alpha-amylase variants gene expression, above-mentioned two gene is gone out
It is living, using continuity mode Characteristics for Single Staggered Campbell's type mechanism.Concrete operations are as follows:
2.1pYF-tsDE after BglII digestion with CIP processing via being inhibited from connecting；
2.2 gene knockout
(1) in order to obtain each gene delection segment, using B.lieheniformis genomic DNA as the method for template PCR
The homologous sequence of about 500bp is respectively expanded from the gene two sides to be lacked.The monoclonal of bacillus subtilis passes through 98 DEG C, 5 points
It can be used as genomic DNA template after clock initial denaturation directly to use in PCR reaction.
Primer for PCR reaction is synthesized by Genscript company.Primer sequence is as follows:
Expand the primer of Apr gene upstream sequence are as follows:
lichApr_F1 TTATTGAGCGGCAGCTTCGACATTGATCAGACCTT
lichApr_R1 CCTTACGGCATTCCTCTCAACAGCGGATCTTCAG
Expand the primer of Apr downstream of gene sequence are as follows:
lichApr_F2 CCTGAAGATCCGCTGTTGAGAGGAATGCCGTAAGG
lichApr_R2 ATGATGAGGAAAAAGAGTTTTTGGCTTGGGATGCTGAC
Expand the primer of Blase gene upstream sequence are as follows:
blalich_F1 TTATTGTGCGCTGTTTTTCCAGTTGGTCAAATTGTCG
blalich_cR1 CGGACAAGGGTCACCAACGGGACAACTGTTACCATC
Expand the primer of Blase downstream of gene sequence are as follows:
blalich_cF2 GATGGTAACAGTTGTCCCGTTGGTGACCCTTGTCC
blalich_R2 CGGCGTTGGTTAGTAAAAAGAGTGTTAAACGAGGTTTGAT
PCR amplification system is 50ul, and response procedures are as follows:
(1) 98 DEG C, 8 minutes of 14580 monoclonal initial denaturation of bacillus subtilis B.licheniformis；
(2) 96 DEG C, 15 seconds；
(3) 58 DEG C, 15 seconds；
(4) 72 DEG C, 30 seconds；It repeats 2-4 step 25-30 times；
(5) extend 72 DEG C, 2 minutes eventually.
PCR product detected with 0.8% agarose gel electrophoresis after with liking to pursue progress kits.
2.3 overlapping PCR method expands the target gene of internal about 400-500bp sequence deletion
Gene internal deletion fragment is obtained with overlapping PCR method (overlap extension PCR, SOE), specifically
It operates as follows:
(1) each upstream region of gene in 2.2, downstream PCR segment is separately recovered and purifies；
(2) using after the upstream and downstream homologous sequence segment 1:1 molar ratio mixing of each target gene as template, with primer XX-
CZ-F1 and XX-CZ-R2 (" XX " represents Apr or Blase) PCR amplification obtain the AprE gene or Blase base of internal deletion fragment
Cause.
Above-mentioned segment is then recombinated with Clone-EZ Cloning Kit (offer of Genscript company) by BglII line
In the pYF-tsDE carrier of property, the recombinant plasmid of acquisition is respectively designated as: pYF-tsDE-Apr and pYF-tsDE-Blase.This
A little recombinant plasmids are temperature sensitive type plasmid, and Apr gene or Blase gene wherein included have lacked interior for complete genome
The sequence of portion about 400-500bp.
The replacement of iso-allele can not be realized by homologous recombination.Method is referring to CN102124112A, it is possible to use
The method of other well known homologous recombinations of this field.
The conversion of 2.4 plasmids
Using that will knock out plasmid, to be transformed into method and screening process in B.lieheniformis competent cell as follows for this experiment:
(1) by temperature sensitive type plasmid pYF-tsDE-Apr or pYF-tsDE-Blase convert B.lieheniformis (CICC 22794, in
State microorganism fungus kind library is bought) competent cell；
(2) it under conditions of 30 DEG C, is used on LB (every liter of 10g containing peptone, yeast extract 5g, sodium chloride 10g) culture medium
Erythromycin (5ug/ml) resistance carrys out screening positive clone bacterial strain；
(2) positive colony bacterial strain is transferred under conditions of 37 DEG C again and is cultivated, the temperature-sensitive plasmid is enable to be fused to host
On genome.In order to replace gene in the site of setting, selects several clones while being inoculated in 2 × YT culture medium and connect
Subculture is primary again after continuous culture 24 hours, and whole process subculture 4-5 times (generally requiring 5-7 days).
(3) bacillus subtilis cell for screening erythromycin-sensitive, which carries out PCR identification, to be put down simultaneously with 1% skim milk LB
Plate observes hydrolysis, and the strain after knockout should show the hydrolysis circle being reduced significantly.
Identify PCR primer used:
AprE:Apr-seqF1/Apr-seqR3
Blase:Blase-seqF1/Blase-seqR3
Apr-seqF1:GCCAGGTTGAAGCGGTCTATTCAT
Apr-seqR3:TACGGCCATCCGACCATAATGGAAC
Blase-seqF1:GAAGAGCCGGTCACAATTGC
Blase-seqR3:GGCCGTTAGATGTGACAGCC
Embodiment 3: the construction and integration of alpha-amylase variants bacterial strain
3.1 amylase express framework establishment
The building of integrated plasmid uses the same method of above-mentioned pYF-tsDE plasmid.In order to which expression cassette is integrated into design
The site AmyE on genome, the homology region of the upstream and downstream design 800bp in the site AmyE in the genome or so, is connected to
One alpha-amylase variants expression cassette two sides.Simultaneously assemble some from first to last natural selections bacterial chromosomal dna segment and
The composition sequence of function, these are all necessary to control expression alpha-amylase variants gene.
One typical amylase expression cassette has following components composition: a typical alpha-amylase variants expression cassette
Be made of following elements: natural or synthesis a promoter sequence (SEQ ID NO.5), the ribosomes of a synthesis combine
Site aaaggagg, one is derived from alpha-amylase variants encoding gene (the respectively SEQ ID of B.licheniformis
NO.3) and one synthesis termination sequence (SEQ ID NO.6).One strong natural signals screened from bacillus subtilis
Sequence (SEQ ID:NO.7) is inserted into the upstream of alpha-amylase variants encoding gene promoters, the secretion to Enhanced expressing enzyme
Efficiency.The pYF- for being linearized the insertion of complete alpha-amylase variants expression cassette with Clone-EZ Cloning Kit (Genscript)
The site BglII in tsDE, finally obtained temperature sensitive type integrated plasmid are named as pYF-tsINT-amy (Fig. 3).Above-mentioned sequence
Synthesis completed by Genscript company, by above-mentioned sequence successively it is seamless series connection obtain alpha amylase expression of enzymes frame.This frame
Middle signal peptide sequence is filtered out from bacillus subtilis, and the secretion of alpha amylase can be effectively improved.
The conversion of 3.2 plasmids
Above-mentioned entire alpha amylase expression cassette (including amyE gene upstream and downstream homologous fragment) is cyclized using recombinant technique
The pYF-tsDE plasmid (recombination kit is provided by Genscript company) of BglII linearisation, the temperature sensitive type plasmid life built
Entitled pYF-tsINT-amy.The plasmid is used to convert in the bacillus licheniformis lacked to AprE and Blase protease gene
The alpha-amylase variants expression cassette of (CICC22794, Chinese microorganism strain library are bought), non-resistant label will replace AmyE.Using
Above-mentioned method, the bacterial strain successfully integrated on alpha-amylase variants encoding gene to B.licheniformis chromosome form sediment in blue
Transparent circle is generated on powder plate, PCR further verifies the site AmyE that expression cassette is incorporated into F-strain.
The B.licheniformis engineered strain for producing alpha-amylase variants is saved at -80 DEG C.
Embodiment 4: the shake flask fermentation of alpha-amylase variants production
The bacterial colony (containing alpha-amylase variants expression cassette) for taking an activation, is inoculated into 20ml culture medium and (contains
Malt syrup 4.0%, peptone 2.0%, yeast powder 0.1%KH2PO40.6% and corresponding antibiotic) culture arrive logarithmic phase.
1.2ml culture solution is taken to be inoculated into 30ml culture medium (containing malt syrup 12.0%, peptone 1.0%, yeast powder 1%KH2PO4
0.2%, MnCl20.003%), 120rpm shaken cultivation 3 days in reciprocal shaker.Respectively at 24 hours, 48 hours and 72 small
When sample 1ml, 1000rpm is centrifuged 1min.Supernatant is saved, SDS-PAGE analysis is done.Alpha-amylase variants molecular weight is about
53kD。
Alpha-amylase variants activity is measured, method is the same as embodiment 6.
Embodiment 5: alpha-amylase variants substep fed-batch fermentation technique
The scribing line of genetic engineering B.licheniformis bacterial strain and agar by -80 DEG C of freezen protectives obtained in embodiment 3
On inclined-plane, 37 DEG C of overnight renewal cultivations.Agar slant formula is as follows: peptone 1%, yeast extract 0.5%, NaCl 1%,
Agar powder 2%.
It is cultivated 16 hours in the seed flask for filling 50ml culture medium in 37 DEG C firstly, choosing several fresh colonies.Kind
Sub- shaking flask formula: malt syrup 4.0%, peptone 2.0%, yeast extract 0.1%, KH2PO40.6%.It, will after 16 hours
All seed fermentation liquid is fully transferred to fill in the 7L stainless steel fermentation tank of 4L culture medium in 37 DEG C, mixing speed
350rpm, Ventilation Rate are continuing fermentation 12 hours under conditions of 650L/H.Fermentor formula: malt syrup 6.0%, peptone
1.0%, yeast extract 1%, KH2PO40.2%, MnCl20.003%.Then with 5% phosphoric acid control fermentation pH 5.7 ±
0.2 or so, and first 18 hours with rate 1L/18hrs after constantly mended with rate 0.5L/18hrs into fermentor within 110 hours
Material.Feed supplement formula is as follows: malt syrup 48%, peptone 6%, yeast extract 8%.Entire fermentation process continues 140-150
Hour.It collects and all culture mediums in 4 DEG C, 1010krpm, 30 minutes centrifugation fermentors, the supernatant after centrifugation is used for α starch
The analysis of enzyme variants enzyme activity.
Embodiment 6: amylase activity measurement
Amylase activity measurement is hundred this outstanding amylase activities (BAU).The definition of 1 BAU unit: in pH6.0,70
Under the conditions of DEG C, enzyme amount required for 1 minute liquefaction 1mg soluble starch.
Briefly, enzyme activity determination operates as follows: 20ml 20g/L soluble starch solution and 5ml pH6.0 phosphoric acid buffer
Liquid mixing is added the enzyme solution after 1.0ml dilutes, accurate response 5 minutes, then takes 1ml reaction solution first in 70 DEG C of preheating 8min,
Addition fills in 0.5ml 0.1mol/L hydrochloric acid solution and the test tube of the dilute iodine solution of 5ml in advance, shakes up, and with 0.5ml 0.1mol/L
Hydrochloric acid solution and the dilute iodine solution of 5ml are that blank measures rapidly its light absorption value, tabled look-up according to absorbance under 660nm wavelength, are obtained
The enzyme activity of test sample.
Embodiment 7: the application of amylase
Except what is in addition illustrated, 1BAU: the vitality test of amylase is hundred this outstanding amylase units (BAU).One BAU
It is defined as under the conditions of pH6.0,70 DEG C, enzyme amount required for 1 minute liquefaction 1mg soluble starch.
TDS: dry matter per ton
It is expressed from Bacillus licheniformis cell and separates the amylase variant obtained and carry out first with cornstarch first
Wheel liquefaction test.Test condition: 18 Baume degrees (° B é), mix well, pH with hydrochloric acid is adjusted to 5.2.It is added 0.4kg/tDS's
Amylase is respectively adopted 100,105,108,112,115 degree of injection temperation, flashes after maintaining 5-8min, 95 degree of maintenance 120min.
DE and iodine examination test are carried out after liquefaction, while paying attention to observing albumen flocculation and viscosity situation, are control with Wild type, as a result
It is shown in Table lattice 1 and Fig. 4.
Table 1: under the conditions of different injection temperations, amylase liquefaction application is compared
| Temperature (DEG C) | Wild type DE (%) | 8008 mutant 2DE (%) |
| 100 | 18.02 | 19.80 |
| 105 | 17.79 | 19.59 |
| 108 | 15.00 | 19.17 |
| 112 | 13.85 | 17.75 |
| 115 | 7.05 | 15.81 |
The results show that 8008 mutant 2 (alpha-amylase variants of the present invention of above-mentioned preparation) are substantially better than wild type,
For 8008 mutant 2 in different injection temperations, 100,105,108 DEG C of liquefaction are excessive, and 112 DEG C of liquefaction are just right, and egg
White cotton fiber coagulates, and at 115 DEG C, liquefaction effect is still preferable, and albumen flocculation is normal, illustrates that alpha-amylase variants of the present invention have very
Good heat resistance, and wild type is not resistant to 115 DEG C of high temperature.
Secondly, we are tested by the liquefaction under different starch slurry concentration conditions, it is dense to high substrate to determine amylase
The tolerance of degree.Liquefaction reaction condition is same as above, and injection temperation is 108 DEG C, is control with Wild type, the results are shown in Table 2 Hes
Fig. 5.
Table 2: under different starch slurry concentration, amylase liquefaction application is compared
| Baume degrees (° B é) | Wild type DE (%) | 8008 mutant 2DE (%) |
| 15 | 15.27 | 18.56 |
| 18 | 15.04 | 18.47 |
| 20 | 14.98 | 18.40 |
| 22 | 12.49 | 16.89 |
As shown in table 2,8008 mutant 2 are substantially better than wild type, and 8008 mutant 2 are in different starch slurry concentration items
Under part, under the conditions of at concentrations up to 22 ° B é of starch slurry, L-type amylase remains to normally liquefy, and illustrates that alpha-amylase variants of the present invention can
To carry out underflow liquefaction, effectively save factory cost.
Then, we determine the acid resistance of amylase, while carrying out the liquefaction performance under the conditions of different enzyme concentrations.Liquefaction
Reaction condition is same as above, pH 5.0, and enzyme concentration is respectively 0.2,0.3,0.4,0.5,0.6kg/tDS, is with wild type
Control, the results are shown in Table 3 and Fig. 6.
Table 3: at pH5.0, the liquefaction application of amylase difference enzyme concentration is compared
| Enzyme concentration (kg/tDS) | Wild type DE (%) | 8008 mutant 2DE (%) |
| 0.2 | 8.24 | 11.47 |
| 0.3 | 11.61 | 15.62 |
| 0.4 | 14.98 | 18.58 |
| 0.5 | 15.16 | 18.65 |
| 0.6 | 16.77 | 20.17 |
As shown in table 3,8008 mutant 2 are substantially better than wild type, and 8008 mutant 2 are in low pH, 0.2-0.3kg/
Under the conditions of tDS additive amount, alpha-amylase variants of the present invention remain to normally liquefy, and illustrate that alpha-amylase variants of the present invention have low pH
Stronger tolerance, while under the conditions of 0.2kg/tDS low enzyme concentration, alpha-amylase variants of the present invention remain to normally liquefy, this can
Factory's enzyme cost is effectively reduced.
In addition, the influence We conducted amylase to saccharification is tested, while with Wild type amylase, Liquozyme
Supra (being purchased from Novozymes) liquefaction liquefier obtained compares, test condition: 32% dry matter (DS) sufficiently mixes
Even, pH is adjusted to 4.3 with hydrochloric acid.0.45kg/tDS compounded saccharifying enzyme is added, the reaction of 200ml reacts 24 and 48 at 60 DEG C respectively
Hour.Sample is analyzed after 0.22um film filters and 100 DEG C inactivate for HPLC.It the results are shown in Table 4.
Table 4: influence of the amylase to saccharification
As shown in table 4, using alpha-amylase variants liquefier of the present invention and Wild type liquefier, alpha amylase of the present invention
Variant saccharification result is substantially better than Wild type, while using alpha-amylase variants liquefier of the present invention and Liquozyme
Supra liquefier, the two saccharification result is just the same, illustrates that alpha-amylase variants of the present invention can be applied to starch sugar industry.
In addition, the influence We conducted amylase to wheaten starch is tested, test condition: 22,25,28,30% (W/W)
Different concentration of substrate, mix well, pH with hydrochloric acid is adjusted to 5.6.The amylase of 0.4kg/tDS is added, is maintained using 91-95 DEG C
120min.DE and iodine examination test are carried out after liquefaction, while paying attention to observing albumen flocculation and viscosity situation, are pair with wild type
According to the results are shown in Table 5 and Fig. 7.
Table 5: under the conditions of different concentration of substrate, amylase liquefaction application is compared
| Concentration of substrate (%) | Wild type DE (%) | 8008 mutant 2DE (%) |
| 22 | 20.85 | 21.21 |
| 25 | 20.21 | 20.47 |
| 28 | 19.64 | 19.82 |
| 30 | 18.14 | 19.02 |
The results show that 8008 mutant 2 are similar to wild type result, and in different concentration of substrate, 22-25%
It liquefies just right, and albumen flocculates, and 28 and 30%, liquefaction effect is still preferable, and albumen flocculation is normal, illustrates the present invention
Alpha-amylase variants can carry out underflow liquefaction, effectively save factory cost.
Secondly, we determine the acid resistance of amylase, while carrying out the liquefaction performance under condition of different pH.Liquefaction reaction
Condition is same as above, and pH is respectively 4.8,5.2,5.6,6.0, enzyme concentration 0.4kg/tDS, is control with wild type, as a result
It is shown in Table 6 and Fig. 8.
Table 6: at different pH, amylase liquefaction application is compared
| pH | Wild type DE (%) | 8008 mutant 2DE (%) |
| 4.8 | 8.11 | 13.30 |
| 5.2 | 20.43 | 19.07 |
| 5.6 | 21.77 | 20.98 |
| 6.0 | 21.97 | 21.05 |
As shown in table 6, under the conditions of pH4.8, alpha-amylase variants of the present invention remain to normally liquefy, and illustrate α starch of the present invention
Enzyme variants have stronger tolerance to low pH, and wild type is not resistant to low pH.
Then, the influence test We conducted amylase to rice, test condition: 12,15,18,20 Baume degrees (° B é)
Different concentration of substrate, mix well, pH with hydrochloric acid is adjusted to 5.2.The amylase of addition 0.4kg/tDS, 108 DEG C of injection temperation,
It is flashed after maintaining 5-8min, 95 degree of maintenance 120min.After liquefaction carry out DE and iodine examination test, while pay attention to observe albumen flocculation and
Viscosity situation is control with wild type, the results are shown in Table lattice 7 and Fig. 9.
Table 7: under the conditions of different concentration of substrate, amylase liquefaction application is compared
| Concentration of substrate (° B é) | Wild type DE (%) | 8008 mutant 2DE (%) |
| 12 | 19.53 | 22.33 |
| 15 | 18.87 | 21.59 |
| 18 | 17.06 | 21.17 |
| 20 | 15.72 | 20.46 |
The results show that 8008 mutant 2 are substantially better than wild type, 8008 mutant 2 are in different concentration of substrate situations
Under, 12-18 ° of B é liquefaction is just right, and albumen flocculates, and in 20 ° of B é, liquefaction effect is still preferable, and albumen flocculation is normal, says
Bright alpha-amylase variants of the present invention can carry out underflow liquefaction, effectively save factory cost.
Secondly, we are tested by liquefaction under the conditions of different starch pH (4.8,5.2,5.4,5.6,5.8), determine
Tolerance of the amylase to high concentration of substrate.Liquefaction reaction condition is same as above, and injection temperation is 108 DEG C, and enzyme concentration is
0.4kg/tDS is control with wild type, the results are shown in Table 8 and Figure 10.
Table 8: at different pH, amylase liquefaction application is compared
As shown in table 8, under the conditions of pH4.8-5.8, alpha-amylase variants of the present invention remain to normally liquefy, and illustrate α of the present invention
Amylase variant has stronger tolerance to low pH, and wild type acid resistance is poor.
Finally, because amylase has important application in alcohol industry production, it is raw in alcohol that we are also tested for amylase
Liquefaction effect in production prepares the corn flour (40 mesh) of different material-water ratios, and with salt acid for adjusting pH to 5.8,0.145kg/tDS is added
Amylase.In 95 DEG C of cooking and liquefaction 120min.After reaction, measure sample DE and viscosity, at the same with Liquozyme Supra
(being purchased from Novozymes) compares test,.It the results are shown in Table 9 and Figure 11.
Table 9: application of the amylase in corn alcohol liquefaction is compared
| The corn flour of different material-water ratios | DE (%) | Viscosity (mPas) |
| Amylase -1:2 | 11.88 | 1562 |
| Amylase -1:2.3 | 12.51 | 1109 |
| Amylase -1:2.5 | 13.15 | 586 |
| Amylase -1:2.7 | 13.30 | 429 |
| Liquozyme Supra-1:2 | 12.19 | 1702 |
| Liquozyme Supra-1:2.3 | 12.78 | 1114 |
| Liquozyme Supra-1:2,5 | 12.88 | 506 |
| Liquozyme Supra-1:2.7 | 13.32 | 352 |
As shown in table 9, alpha-amylase variants of the present invention and Liquzoyme Supra can achieve similar application effect.It says
Bright its can be applied to corn alcohol industry.
In conclusion alpha-amylase variants of the present invention have preferable heat resistance, pH resistance to according to the experimental result in the present invention
By property, the liquefaction of high concentration starch slurry can apply to, therefore can apply to starch sugar industry and alcohol industry.
The embodiment of the present invention is other than applying technical method in the art, the guidance of more too busy to get away inventive concept.
Therefore, the present invention is not limited only to disclosed specific embodiment, more to cover the revised provision in spirit and scope of the invention, in detail
See claim.
Claims (12)
1. a kind of alpha-amylase variants, it is characterised in that the alpha-amylase variants pass through in bacillus licheniformis (B.
Licheniformis alpha amylase N-terminal) increases by two additional amino acid A and N, and increases by five additional ammonia in C-terminal
Base acid KTTVS is obtained, while having still maintained parental generation hydrolyzing alpha-Isosorbide-5-Nitrae glycosidic bond ability；The amino of the alpha-amylase variants
Acid sequence is as shown in SEQ ID NO.4 in sequence table.
2. encoding the gene of alpha-amylase variants described in claim 1.
3. gene according to claim 2, it is characterised in that nucleotide sequence is as shown in SEQ ID NO.3 in sequence table.
4. the expression vector for expressing alpha-amylase variants described in claim 1, it is characterised in that contain Claims 2 or 3
The gene of the coding alpha-amylase variants.
5. expression vector according to claim 4, it is characterised in that the expression vector includes mainly natural by one
Or the promoter sequence of synthesis, a natural or synthetic ribosome bind site, a natural or synthetic terminator sequence
The gene order of column and coding alpha-amylase variants as claimed in claim 3 constitutes an expression component together.
6. a kind of for expressing the recombinant cell of alpha-amylase variants described in claim 1, it is characterised in that include claim
The gene of alpha-amylase variants is encoded described in 2.
7. recombinant cell according to claim 6, it is characterised in that the host cell of recombinant cell is selected from bacillus bacteria
Strain.
8. recombinant cell according to claim 7, it is characterised in that the host cell of recombinant cell is selected from lichens brood cell bar
Bacterium (B. licheniformis) or the bacillus licheniformis that AprE and/or Blase have been inactivated by genetic engineering transformation.
9. a kind of production method of alpha-amylase variants described in claim 1, it is characterised in that be included in suitable alpha amylase and become
Body surface cultivates the recombinant cell containing coding alpha-amylase variants gene order under conditions of reaching, and from recombinant cell or
Alpha-amylase variants are obtained in its culture supernatant of person.
10. application of the alpha-amylase variants described in claim 1 in α -1,4 glycosidic bond of Polysaccharides.
11. application according to claim 10, it is characterised in that the alpha-amylase variants are in high temperature and/or low pH item
Application under part in α -1,4 glycosidic bond of Polysaccharides；The high temperature is 80 DEG C ~ 110 DEG C；The low pH is that pH value is
5.0~5.8。
12. application according to claim 11, it is characterised in that the high temperature is 100 DEG C ~ 110 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610816934.1A CN107345223B (en) | 2016-09-12 | 2016-09-12 | Alpha-amylase variants and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610816934.1A CN107345223B (en) | 2016-09-12 | 2016-09-12 | Alpha-amylase variants and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107345223A CN107345223A (en) | 2017-11-14 |
| CN107345223B true CN107345223B (en) | 2019-05-03 |
Family
ID=60253253
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610816934.1A Active CN107345223B (en) | 2016-09-12 | 2016-09-12 | Alpha-amylase variants and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107345223B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101668855A (en) * | 2007-03-23 | 2010-03-10 | 丹尼斯科美国公司 | Enhanced amylase production by n-terminal addition to mature amylase protein |
| CN101815783A (en) * | 2007-05-30 | 2010-08-25 | 丹尼斯科美国公司 | The improvement variant of bacillus licheniformis alpha-amylase |
-
2016
- 2016-09-12 CN CN201610816934.1A patent/CN107345223B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101668855A (en) * | 2007-03-23 | 2010-03-10 | 丹尼斯科美国公司 | Enhanced amylase production by n-terminal addition to mature amylase protein |
| CN101815783A (en) * | 2007-05-30 | 2010-08-25 | 丹尼斯科美国公司 | The improvement variant of bacillus licheniformis alpha-amylase |
Non-Patent Citations (3)
| Title |
|---|
| "Comparison of starch hydrolysis activity and thermal stability of two Bacillus licheniformis alpha-amylases and insights into engineering alpha-amylase variants active under acidic conditions.";Lee S等;《J Biochem.》;20060630;第139卷(第6期);997-1005页 |
| "Genbank序列登录号：FJ556804.1";Yamabhai，M.等;《GENBANK》;20090131;全文 |
| "UniProt：P06278";Yuuki T.等;《ChEMBI》;19880101;全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107345223A (en) | 2017-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018129980A1 (en) | Method for efficiently expressing pullulanase in bacillus subtilis and recombinant bacillus subtilis | |
| US10294466B2 (en) | Alpha-glucosidase, compositions and methods | |
| CN107532155B (en) | Truncate Pullulanase and its production method and methods for using them | |
| CN104379737A (en) | Variant alpha amylases with enhanced activity on starch polymers | |
| JP2010518814A (en) | Polypeptide having starch debranching activity | |
| CN104073458B (en) | One strain capable of high-efficiency expresses the bacillus subtilis of external source secretory protein | |
| CN108699544A (en) | Alpha-amylase variants and its application | |
| CN107312763B (en) | L-type alpha-amylase variants and its production method | |
| US10647970B2 (en) | L-type amylase variant and use thereof | |
| CN107345223B (en) | Alpha-amylase variants and its application | |
| CN116254249A (en) | Construction of recombinant bacterium for expressing chitinase and preparation of high-enzyme activity mutant | |
| CN107312764B (en) | α amylase variants | |
| CN115197924B (en) | Pullulanase | |
| CN114058606B (en) | Application of bacillus licheniformis with xpt gene deleted in heterologous protein production | |
| CN107603965B (en) | Acid amylase mutant with improved thermal stability as well as preparation method and application thereof | |
| CN107345224B (en) | Amylase applications | |
| WO2020213604A1 (en) | NOVEL β-AMYLASE AND METHOD FOR UTILIZATION AND PRODUCTION THEREOF | |
| CN116426447A (en) | Oligosaccharide debranching enzyme extracellular expression system and application thereof in hydrolysis of isomaltooligosaccharide | |
| WO2020090734A1 (en) | Maltotriose-generating amylase | |
| CN115873772A (en) | Bacillus subtilis recombinant strain for efficiently expressing raw starch alpha-amylase and application thereof | |
| CN116855432A (en) | Bacillus subtilis for catalyzing and synthesizing trehalose by multienzyme co-production and application thereof | |
| CN114836361A (en) | Bacillus amyloliquefaciens engineering strain for high yield of glucosamine and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |