CN106978409B - Efficient preparation method of alpha-glucosidase - Google Patents

Abstract

The invention provides an efficient preparation method of α -glucosidase, which comprises the steps of screening to obtain α -glucosidase encoding genes with remarkably improved catalytic performance by taking α -glucosidase gene base sequences from microorganisms or plants as the basis, then increasing the copy number of α -glucosidase genes by introducing strong promoters and high secretion efficiency signal peptide elements through reconstructed expression plasmids to obtain recombinant bacteria for efficiently secreting and expressing α -glucosidase, screening to obtain strains with highest activity by combining enzyme activity differences, and establishing 30m strains by combining the growth characteristics and the enzyme production characteristics of the strains³The expression method for screening and obtaining the high-strength promoter can ensure the high level of the transcription process of α -glucosidase and the high expression level of the subsequent expression process.

Description

Efficient preparation method of alpha-glucosidase

Technical Field

The invention provides a high-efficiency preparation method of alpha-glucosidase, belonging to the fields of microorganisms and genetic engineering.

Background

Alpha-glucosidase, also known as glucosyltransferase (ec.3.2.1.20), is systematically named alpha-D-glucoside glucohydrolase. It has dual functions of hydrolysis and transglycosidation in the catalytic reaction of sugar. Hydrolysis can cleave the alpha-1, 4 glycosidic bond from the non-reducing ends of alpha-glucosides, oligosaccharides and glucans, releasing glucose; transglycosylation can transfer the free glucose residue to another glucose or maltose substrate by alpha-1, 6 glycosidic bond, thus obtaining non-fermentable Isomaltooligosaccharides (IMO).

Since the screening of alpha-glucosidase producing strains from Aspergillus niger in Japan in the 80 th 20 th century and the industrial production of enzyme preparations, alpha-glucosidase has played an increasingly important role in basic research and industrial production. At present, most of the alpha-glucosidase produced abroad is pure enzyme with higher enzyme activity; while the crude enzyme solution is mainly used in China, and the enzyme activity is low. In addition, no commercial alpha-glucosidase enzyme preparation is sold at home, and the enzymes for production are from a few enzyme preparation factories abroad and have high import price, so that the production cost of the IMO is low, and the development of the IMO industry in China is restricted to a certain extent. The key point for realizing the low-cost commercial manufacture of the alpha-glucosidase is to breed high-yield strains of the alpha-glucosidase and establish a corresponding high-efficiency preparation process.

Disclosure of Invention

The invention aims to provide an efficient preparation method of α -glucosidase, which is characterized in that a α -glucosidase gene base sequence of a microorganism or plant source is used as a basis, codon optimization is carried out by referring to codon preference of a target host bacterium, a α -glucosidase encoding gene with remarkably improved catalytic performance is obtained by screening through adopting a long primer and low-temperature error-prone PCR (polymerase chain reaction), then elements such as a strong promoter, a signal peptide with high secretion efficiency and the like are introduced, the copy number of the α -glucosidase gene is increased by means of reconstructed expression plasmids, a recombinant bacterium for efficiently secreting and expressing α -glucosidase is obtained, a strain with highest activity is obtained by screening in combination with enzyme activity difference, and a strain with the highest activity is established by combining growth characteristics and enzyme production characteristics of the strain³An α -glucosidase efficient secretion expression process under a fermentation system.

The alpha-glucosidase gene may be obtained by PCR amplification using chromosomal DNA of the source microorganism as a template, or may be obtained by whole gene synthesis using a nucleic acid sequence on the chromosomal DNA of the source microorganism, or may be obtained by redesigning and synthesizing the nucleic acid sequence on the chromosomal DNA of the source microorganism based on the codon preference pattern associated with the target host bacterium.

The target host bacteria for cloning and expressing the preferred alpha-glucosidase gene are strains capable of efficiently secreting and expressing various proteins, and the target strains can be subjected to genetic modification as required. The target host bacteria can be aspergillus niger, aspergillus fumigatus, aspergillus oryzae, bacillus licheniformis, bacillus subtilis, bacillus amyloliquefaciens, saccharomyces cerevisiae, pichia pastoris and the like, and can also be other food safe microorganisms.

The obtained optimized alpha-glucosidase gene can perform a high-efficiency transcription process at the downstream of a promoter sequence of a dominant gene of a target host bacterium. The promoter of the dominant gene can be an operon of related genes such as protease, amylase, lipase, cellulase, hemicellulase, pectinase, glycosidase and the like from target host bacteria.

The obtained optimized alpha-glucosidase gene can perform a high-efficiency secretion expression process at the downstream of a signal peptide sequence of a dominant gene of a target host bacterium. The signal peptide of the dominant gene may be an operon of related genes such as protease, amylase, lipase, cellulase, hemicellulase, pectinase, glycosidase, etc., derived from the target host bacterium.

The plasmid vector for efficient expression of the preferred alpha-glucosidase gene may be a plasmid with 1-4 copies, a plasmid with about 400 copies, or a whole plasmid with temperature-induced regulation. More importantly, the plasmid vector simultaneously carries replicons required by high-efficiency replication in target host bacteria and escherichia coli, so that high-copy replication of the plasmid in the target host bacteria is facilitated.

The obtained recombinant protein can realize the target protein at 30m under a simple fermentation process³High-efficiency preparation under a fermentation system.

Preferably, the α -glucosidase gene of microbial or plant origin is a gene encoding Aspergillus niger α -glucosidaseagA，agB，agC，agD，agE，agF。

The long primer sequences used were as follows:

agXtemP1：ATGGTTAAACTGCCCTTTAACATCCAAATGTTTTCTACTTCCATTACGG；

agXtemP2：TTACCATTCAAACGTTAGTTGAAACGAACGTAACGAGAGTCAACATCCCA。

the preferably obtained alpha-glucosidase coding gene sequence with remarkably improved catalytic performance is shown in SEQ ID NO. 1.

The invention has the beneficial effects that:

the alpha-glucosidase coding gene used in the invention is obtained by codon optimization and other strategy modification and catalytic performance screening, and has the characteristics of high catalytic performance and the like.

The expression method of the alpha-glucosidase used in the invention, particularly the expression method of screening and obtaining the high-strength promoter can ensure the high level of the transcription process of the alpha-glucosidase and the high expression quantity of the subsequent expression process.

The expression method of the alpha-glucosidase used in the invention, particularly the expression method of the signal peptide with excellent secretion performance obtained by screening can ensure the high efficiency of the secretion process of the alpha-glucosidase and the high expression quantity of the subsequent expression process.

The expression method of the alpha-glucosidase, particularly the expression method of the high-copy shuttle-type plasmid, used in the invention can ensure the convenience of the recombinant plasmid in the construction process and also ensure the high expression quantity of the recombinant plasmid in the expression process of the target host bacteria.

The high-yield strain of the alpha-glucosidase obtained by the invention has the characteristics of stable growth and enzyme production characteristics, and easy amplification production in the fermentation enzyme production process.

The preparation process of the alpha-glucosidase has the characteristics of simple process, stable operation and the like, greatly reduces the operation difficulty, and saves the economic cost.

The alpha-glucosidase preparation process can realize the high-efficiency preparation process of high-activity alpha-glucosidase of 10 tons to 30 tons and larger scale.

Drawings

FIG. 1 shows a physical map of a plasmid for efficient expression of an alpha-glucosidase encoding gene obtained by screening.

FIG. 2 shows the difference in pH optimum for a plurality of α -glucosidases obtained by screening.

FIG. 3 shows the difference of the optimal action temperature of a plurality of alpha-glucosidase enzymes obtained by screening.

FIG. 4 shows the analytical pattern of α -glucosidase for preparing isomaltooligosaccharide syrup fractions.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention.

(1) The method employs TRIZol of Thermofeisher^®The Plus RNA purification system enables the cracking capability of TRIzol reagent and PureLink^®The RNA extraction technology of the RNA small-amount extraction kit silica gel centrifugal column is combined conveniently, and the Aspergillus niger total RNA is separated and extracted quickly.

(2) In the reverse transcriptase kit EnzChek^®Synthesizing cDNA under the action of Reverse Transcriptase Assay Kit, and obtaining α -glucosidase encoding gene by using the cDNA as template and primer pair agA1/agA2, agB1/agB2, agC1/agC2, agD1/agD2, agE1/agE2 and agF1/agF2agA，agB，agC，agD，agE，agF(each sequence information is XM _001396469.2, XM _001393862.2, XM _001391091.2, XM _001402016.2, XM _001400418.2, XM _001388877.2 in decibels).

(3) The gene encoding α -glucosidase obtained above was cloned into pPIC9K plasmidSnaBI/EcoObtaining recombinant plasmids pPIC-agA-F from the RI site.

(4) The recombinant plasmid pPIC-agA-F is linearized and then is subjected to electric shock transformation to be integrated and expressed in Pichia pastoris GS 115. And positive transformants were obtained by histidine auxotrophy selection and G418 resistance selection.

(5) The enzyme solution was prepared from the positive transformant obtained above by the fermentation verification method of the positive transformant by the Pichia pastoris operation manual provided by Thermofisher (Invitrogen). Measuring the enzyme activity of alpha-glucosidase in the enzyme solution and further screening a target transformant.

(6) Based on the amino acid sequence of the target transformant obtained by screening, the nucleic acid sequence of the gene is optimized by referring to the codon preference of the bacillus subtilis, and the existing nucleotide sequence in the original gene is eliminated in the codon optimization processSmaI andEcothe RI site does not form new two enzyme cutting sites at the same time, and related α -glucosidase code with optimal enzyme activity is obtained in a whole gene synthesis modeA gene.

(7) The completely synthesized gene fragment is taken as a template, and a novel gene fragment is obtained by adopting a combination mode of a universal long primer and low-temperature error-prone PCR. Introduction of upstream and downstream primers respectivelySmaI andEcothe RI site.

(8) Using chromosome DNA of Bacillus subtilis BF7658 as template, using primer pair SPamy 1/SPamy 2 to amplify to obtain signal peptide of amylase gene, and cloning into recombinant plasmid pHY-P43BamHI andSmaand (c) a site I. Obtaining the recombinant bacillus subtilis pHY-P43-SPamy.

(9) Cloning the above gene fragment into pHY-P43-SPamy vectorSmaI andEcothe RI site. Obtaining the recombinant plasmid.

(10) The recombinant bacillus subtilis rotor obtained in the method is fermented in a shake flask to prepare enzyme solution, and alpha-glucosidase producing strains with high enzyme activity are screened at 65 ℃.

(11) An efficient preparation process is established by combining the growth and enzyme production characteristics of the recombinant bacteria.

The specific technical method comprises the following steps:

(1) expression of the alpha-glucosidase agD gene in Bacillus subtilis BF 7658;

based on the agD gene cDNA sequence from Aspergillus niger, the agDbs gene is synthesized from the whole gene by referring to the codon preference of Bacillus subtilis, and the existing gene in the original gene is eliminated in the process of codon optimizationSmaI andEcothe RI site does not form new two enzyme cutting sites at the same time;

(2) and PCR amplification is carried out to obtain a promoter sequence fragment, a signal peptide sequence fragment and an alpha-glucosidase gene fragment.

(3) Preparing escherichia coli DH5 alpha transformation competence;

(4) the promoter sequence fragment, the signal peptide sequence fragment and the alpha-glucosidase gene fragment are connected with an expression vector for transformation

(5) Transforming the recombinant plasmid into a target host bacterium;

(6) the enzyme activity determination method comprises the following steps:

1) principle for determining alpha-glucosidase enzyme activity by national standard method

The alpha-glucosidase is used for acting a substrate alpha-methyl-D-glucoside to generate glucose, and the generated glucose is subjected to color reaction with 4-aminoantipyrine containing glucose oxidase and peroxidase and a phenol reagent to be quantitatively measured. Under this test condition, the amount of enzyme required to produce l. mu.g of glucose in 2.5 mL of the reaction mixture for 60 min was defined as one unit of α -glucosidase activity.

The chemical reaction formula is as follows:

2) step of determining alpha-glucosidase enzyme activity by national standard method

a. 1 g of glucose dried at 105 ℃ for 6 h is accurately weighed, dissolved in 100 mL of water, and taken up to 100 mL with water (1 mL, 2 mL, 3mL, 4 mL, 5mL, respectively) (each 1mL of the solution contains 100. mu.g, 200. mu.g, 300. mu.g, 400. mu.g, 500. mu.g of glucose).

Respectively sucking 0.1 mL of the glucose standard solution and 3mL of the 4-aminoantipyrine-phenol color developing agent, adding into a test tube, and uniformly mixing. Placing the test tubes into a constant temperature water bath at 0.5 deg.C (40 soil), maintaining the temperature for 20 min, and measuring absorbance As at wavelength of 500 nm₁₀，As₂₀，As₃₀，As₄₀，As₅₀. Blank control for standard solution: replacing the standard liquid of grape enamel with water, and measuring the absorbance As of the blank control liquid by the method₀。

b. 1mL of the substrate solution and 1mL of 0.02 mol/L acetic acid-sodium acetate buffer (pH 5.0) were aspirated into the tube, and the tube was incubated in a constant temperature water bath at 0.5 ℃ C. (40 g/L) for 10 min. Adding 0.5mL of diluted enzyme solution, mixing, keeping temperature in a constant temperature water bath box at 40 deg.C for 60 min, transferring the test tube to boiling water bath, heating for 5 min, and rapidly cooling with flowing water. After cooling, 0.1 mL of the solution was pipetted into a test tube, and 3mL of 4-aminoantipyrine-phenol developer was added and mixed. Placing the test tube in constant temperature water bath (40 soil 0.5) deg.C, keeping the temperature for 20 min, and measuring absorbance A at 500 nm₆₀。

Blank control: 1mL of 0.02 mol/L acetic acid-sodium acetate buffer solution (pH 5.0) and 0.5mL of sample dilution enzyme solution are added into a test tube and mixed uniformly. The tube was transferred to a boiling water bath and heated for 5 min, then rapidly cooled with running water. After cooling, 1mL of substrate solution was added and mixed well. Sucking 0.1 mL of the solution into an empty test tube, adding 3mL of 4-aminoantipyrine-phenol color developing agent, and uniformly mixing. Placing the test tube in constant temperature water bath (40 soil 0.5) deg.C, keeping the temperature for 20 min, and measuring absorbance A at 500 nm₀。

3) Calculation for determining alpha-glucosidase enzyme activity by national standard method

Amount G (μ G) of the grape pip corresponding to 1.000 absorbance difference

Calculating the activity of alpha-glucosidase:

in the formula: a. the₆₀-absorbance of the sample reaction solution;

A₀-absorbance of the blank solution;

the amount of glucose, μ G, determined from the glucose calibration curve when the difference in G-absorbance was 1.000.

2.5-total volume of reaction system, mL;

0.1-sample volume of reaction system, mL;

n-dilution factor of the enzyme sample;

0.5-addition of enzyme sample in reaction system, mL.

4) Principle for measuring alpha-glucosidase enzyme activity by biosensor method

The amount of enzyme required to produce l. mu.g of D-glucose in 2.5 mL of the reaction mixture at 60 min as measured by biosensing using α -glucosidase as substrate a-methyl-D-glucoside, the chemical reaction formula is as follows:

example 1 cloning and expression of alpha-glucosidase encoding Gene in Pichia pastoris

Using Aspergillus nigerAspergillus nigerThe CICIM F0215 strain (http:// CICIM-cu.jiangnan.edu.cn) in the university of Jiangnan China college and university is used as an initial strain to be cultured, and the strain is collected. Their total RNA was extracted using TRNzol total RNA extraction reagent. And (3) performing reverse transcription by taking total RNA as a template and oligo (dT) as a primer according to the RT-PCR kit instruction to synthesize first strand cDNA.

Respectively taking chromosomal DNA or first strand cDNA as templates, and performing PCR amplification by using primers (SEQ ID number 2-SEQ ID NO. 13; two adjacent primers are a pair of upstream and downstream primers) to obtain α -glucosidase encoding geneagA、agB、agC、agD、agEAndagF. The PCR reaction conditions were as follows: pre-denaturation at 94 ℃ for 5 min; 30 cycles of 94 ℃ for 30 s, 61 ℃ for 30 s, and 72 ℃ for 2 min; extension at 72 ℃ for 10 min. The PCR product and the plasmid pPIC9K were used separatelySnaB I andEcoRI is subjected to enzyme digestion, purification, ligation and transformationEscheriachia coliJM109 competent cells. Screening positive transformant with LB solid culture medium containing ampicillin, extracting plasmid, and restriction enzyme digestion for verification.

Genetic transformation and screening of pichia pastoris: 6 successfully constructed recombinant plasmids pPIC9K-agA、pPIC9K-agB、pPIC9K-agC、pPIC9K-agD、pPIC9K-agEAnd pPIC9K-agF(FIG. 4) forSacI orSalI, single enzyme digestion linearization is carried out. Purifying and recovering the enzyme digestion product, and then converting the enzyme digestion product into electricityPichia pastorisGS115, evenly spread on MD plate, and cultured at constant temperature of 30 ℃ until single colony is formed. Selecting multiple monoclonal recombinant yeasts, respectively inoculating the recombinant yeasts on YPD plates with the final concentration of 0.5 and 2mg/mL G418 for screening, culturing in an incubator at 30 ℃ until single colonies grow out, selecting recombinant yeast strains with good growth conditions for storage, and respectively naming the 6 recombinant yeasts as AGa, AGb, AGc, AGd, AGE and AGf. Prepared by a culture method and a methanol induction fermentation method given by a pichia pastoris operation manualCorresponding α -glucosidase enzyme solution.

(1) Streaking and activating the screened recombinant yeast strains and a control strain Pichia pastoris GS115, selecting single colonies, respectively inoculating the single colonies into 50 mL of YPD liquid culture medium (containing kanamycin with the final concentration of 50 mu g/mL), and culturing at 30 ℃ and 180 r/min for 16-18 h;

(2) inoculating into 50 mL BMGY liquid medium (containing kanamycin to a final concentration of 50. mu.g/mL) at 1% inoculum concentration, and culturing at 30 ℃ and 180 r/min to OD600= 2-6 (about 16-18 hours);

(3) collecting the bacterial liquid in a sterilized 50 mL centrifuge tube, centrifuging at 8000 r/min for 5 min, pouring off the supernatant, and resuspending the cells with BMMY (myoglobin) with the volume of 1/5-1/10 original culture medium to make OD of the thallus₆₀₀=1, adding methanol until the final concentration is 0.5%, inducing, putting into a 30 ℃ shaking table for continuous culture;

(4) samples were taken for 96 hours of fermentation to determine enzyme activity (as determined above) and methanol was added to a final concentration of 0.5% for induction.

The enzyme activities measured are shown in Table 1.

TABLE 1 Synthesis level of alpha-glucosidase in recombinant Pichia pastoris

Example 2 cloning and expression of alpha-glucosidase encoding Gene in Bacillus subtilis

Using chromosome DNA of Bacillus subtilis BF7658 as template, using primer pair Samy 1/Samy 2 to amplify to obtain signal peptide of amylase gene, and cloning into recombinant plasmid pHY-P43BamHI andSmaand (c) a site I. Obtaining the recombinant bacillus subtilis pHY-P43-Samy. The sequence Samy 1/Samy 2 is Samy 1: CGGGGTACCAAAAAATCAAATAAGGAG, respectively; samy 2: CGCGGATCCTGTAAGCTCATTCGATTTGTT are provided.

Based on the α -glucosidase coding gene nucleic acid sequence with confirmed catalytic activity, aiming at the codon preference of bacillus subtilis, the nucleic acid sequence of the six-codon α -glucosidase coding gene is optimized, and the optimization process is the same as that of the optimization processEliminating existing gene in timeSmaI andEcototal synthesis of six α -glucosidase-encoding genes, agAbs, agBbs, agCbs, agDbs, agEbs, and agFbs, cloned into pHY-P43-Samy plasmidSmaI andEcoobtaining corresponding recombinant bacillus subtilis AGabs, AGbbs, AGcbs, AGdbs, AGebs and AGfbs according to a chemical conversion method, preparing corresponding α -glucosidase enzyme solutions AGabs, AGBbs, AGCbs, AGDbs, AGEbs and AGFbs by adopting a fermentation medium (3-5% of yeast extract, 3.8-6.2% of peptone, 10-30% of glucose, 1-5% of lactose and pH 7.0) aerobic fermentation method, and determining the obtained enzyme activities to be 296U/mL, 315U/mL, 350U/mL, 376U/mL, 388U/mL and 368U/mL respectively.

Example 3 acquisition of high-producing Strain of alpha-glucosidase

Then, six alpha-glucosidase encoding genes agAbs, agBbs, agCbs, agDbs, agEbs and agFbs are mixed to be used as a template, long primers agXtemP1 and agXtemP2 are adopted, the agXX gene is obtained through amplification and cloned into pHY-P43-Samy plasmid, recombinant plasmid pHY-P43-Samy-agXX is obtained and transformed into Bacillus subtilis 1A717, the obtained recombinant Bacillus subtilis 1A717 (pHY-P43-Samy-agXX) is subjected to shake flask fermentation to prepare enzyme liquid, and the optimal transformant is obtained through measuring the enzyme activity of the alpha-glucosidase. Basic enzymology properties of 4 optimal recombinant bacillus subtilis 1A717-agX06, 1A717-agX17, 1A717-agX45 and 1A717-agX58 obtained by screening are shown in a figure 2 and a figure 3, and the highest enzyme activities are 430U/mL, 510U/mL, 500U/mL and 680U/mL respectively.

Wherein agXtemP 1: ATGGTTAAACTGCCCTTTAACATCCAAATGTTTTCTACTTCCATTACGG, respectively;

agXtemP2：TTACCATTCAAACGTTAGTTGAAACGAACGTAACGAGAGTCAACATCCCA。

example 4 establishment of fermentation Process of alpha-glucosidase producing Strain 1A717-agX58

Further performing a fermentation test on the recombinant bacillus subtilis 1A717-agX58 in a 25L full-automatic fermentation tank, wherein a fermentation medium comprises 5-7% of corn steep liquor powder, 6-9% of soybean meal, 10-30% of glucose, 1-5% of lactose and 7.0 of pH; the working fermentation volume is 12L; the fermentation temperature is 42 +/-1 ℃; the dissolved oxygen is maintained to be more than 20 percent in the fermentation process; after fermenting for 12 hours, feeding a 50% glucose solution to maintain the glucose concentration at 5-10 g/L; controlling the pH value to be 7.0 by using sulfuric acid or ammonia water in the fermentation process; the fermentation time is 50-80 h. The enzyme production level reaches 760U/mL.

Example 5.30 m³Preparation of α -glucosidase in fermentation system

The recombinant Bacillus subtilis 1A717-agX58 was further adjusted to 30m according to the procedure of example 4³The fermentation system comprises a fermentation medium, wherein the fermentation medium comprises 5-7% of corn pulp powder, 6-9% of soybean meal, 10-30% of glucose, 1-5% of lactose and 7.0 of pH, seed culture is respectively completed, a first-stage seed tank, a second-stage seed tank and a main fermentation tank are inoculated, thalli are cultured, after the operations of enzyme production fermentation for 70-90 hours after a material supplementing growth stage, the fermentation is finished, the enzyme production level reaches 830U/mL, fermentation liquor is filtered by a plate frame to remove thalli, an ultrafiltration membrane concentrates enzyme liquid to proper concentration, an auxiliary preparation is added, fine filtration is carried out to prepare α -glucosidase liquid finished products, or a proper amount of food grade starch is added, and spray drying is carried out to prepare powder α -glucosidase finished products.

Example 630 m³Bulk preparation of isomaltooligosaccharide under sugar production system

Starch liquefaction and saccharification: adding 4.5t starch to 10m³Adding starch while stirring, adding a certain amount of water after stirring the starch milk uniformly, and metering to 18m in a fermentation tank³Adjusting the pH to 6.0, heating the starch milk to 40-50 ℃, adding 450L (40000U/ml) of high-temperature resistant α -amylase, and continuing to heat the starch mash to boiling to finish liquefaction, cooling the liquefied mash to 50-60 ℃, adding 40.5L (1000U/ml) of pullulanase, 3.2L (70 ten thousand U/ml) of β -amylase and 5.65kg of α -glucosidase prepared in example 5, maintaining the reaction temperature at 50-60 ℃, and reacting for 13 hours to obtain the syrup with 48-60% of isomaltooligosaccharide (IG 2+ P + IG 3) in dry matter content, as shown in figure 4.

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Fujianfu Baite Biotech Co., Ltd

<120> high-efficiency preparation method of alpha-glucosidase

<130>17

<160>17

<170>PatentIn version 3.3

<210>1

<211>2911

<212>DNA

<213>agX58

<400>1

atggttaaac ttacacatct tcttgctcgt gcttggcttg ttcctcttgc ttacggcgct 60

tctcaatctc ttctttctac aacagctcct tctcaacctc aattcacaat ccctgcttct 120

gctgatgttg gcgctcaact tatcgctaac atcgatgatc ctcaagcgct ttgcccttct 180

tacaaatctc ctcaagttga tatgggctac gatatcgctg attactactc tatcgctgat 240

gaatacggca cagctggccg tccttgcaac gtttacggca cagatgttga atctcttaca 300

ctttctgttg aataccaaga ttctgatcgt cttaacatcc aaatccttcc tacacatgtt 360

gattctacaa acgcttcttg gtacttcctt tctgaaaacc ttgttcctcg tcctaaagct 420

tctcttaacg cttctgtttc tcaatctgat cttttcgttt cttggtctaa cgaaccttct 480

ttcaacttca aagttatccg taaagctaca ggcgatgctc ttttctctac agaaggcaca 540

gttcttgttt acgaaaacca attcatcgaa ttcgttacag ctcttcctga agaatacaac 600

tacgtttctt ctgatggccg tgttttctac cttgatgaaa acgatacagc ttacgctgtt 660

ttcgatttcc aacgttctga tgctgttaca gttcgttacg attctctttc tgttcatggc 720

catcttatgc aagctgatac aatgcttgat gctatcacaa tgcttacaga atacacaggc 780

cgtatgccta cacttcctga atgggttgat catggcgctc ttcttggcat ccaaggcggc 840

caagaaaaag ttaaccgtat cgttaaacaa ggcttcgaac atgattgccc tgttgctggc 900

gtttggcttc aagattggtc tggcacacat cttcaatctg ctccttacgg caacatgaac 960

atctctcgtc tttggtggaa ctgggaatct gatataaaca aaactactac gataaaggca 1020

tctggtggac aacagatatc ggcggcttcc atggcggcga tccttctgat cctgctttcc 1080

gtgaactttt cacacgttgg ttccaatggg gcgctttctg ccctgttatg cgtcttcatg 1140

gcgatcgtga acctaaacct gaaaaccgtc ctacagattc tggctctgat aacgaaatct 1200

catgaatctg gccgttacta cgttcctatc gttgatgctg ctctttacat ccctaaccct 1260

gaaaacgctt ctgatgctta cgctacatac gatcgtggcg ctgctgatga cctgttatgc 1320

gtacactttt ctacgaattt cctgctgata aaaaagcttg ggatgttgaa acagaacatc 1380

ttttcggctc taaatacctt gttgttcctg ttttcgaagc tggcaaacgt tctgttgaag 1440

tttaccttcc tgctggcgct tcttggaaag tttggggcca agaagatgtt atccatgaag 1500

gcggcaaaga aatccaagtt gattgccctc cctgctcatc cttctttcct tcttcctggc 1560

gaacctggcg atatcatcta cgattaccct gaagctttca acatcacaaa cgctacagaa 1620

gctgcttctg cttctgctgg cgcttcttct caagctgctg ctacagctac aacaacatct 1680

acatctgttt cttaccttcg tacaacacct acacctggcg ttcgtaacgt tgaacatcct 1740

ccttacgtta tcaaccatga tcaagaaggc catgatcttt ctgttcatgc tgtttctcct 1800

aacgctacac atgttgatgg cgttgaagaa tacgatgttc atggccttta cggccatcaa 1860

ggccttaacg ctacatacca aggccttctt gaagtttggt ctcataaacg tcgtcctttc 1920

atcatcggcc gttctacatt cgctggctct ggcaaatggg ctggccattg gggcggcgat 1980

aactactcta aatggtggtc tatgtactac tctatctctc aagctctttc tttctctctt 2040

ttcggcatcc ctatgttcgg cgctgataca tgcggcttca acggcaactc tgatgaagaa 2100

ctttgcaacc gttggatgca actttctgct ttcttccctt tctaccgtaa ccataacgaa 2160

ctttctacaa tccctcaaga accttaccgt tgggcttctg ttatcgaagc tacaaaatct 2220

cgttcgtttc aacgctacgc tatccttcct tacttctaca cacttttcga tcttgctcat 2280

acaacaggct ctacagttat gcgtgctctt tcttgggaat tccctaacga tcctacactt 2340

gctgctgttg aaacacaatt catggttggc cctgctatca tggttgttcc tgttcttgaa 2400

cctcttgtta acacagttaa aggcgttttc cctggcgttg gccatggcga agtttggtac 2460

gattggtaca cacaagctgc tgttgatgct aaacctggcg ttaacacaac aatctctgct 2520

cctcttggcc atatccctgt ttacgttcgt ggcggcaaca tccttcctat gcaagaacct 2580

gctcttacaa cacgtgaagc tcgtcaaaca ccttgggctc ttcttgctgc tcttggctct 2640

aacggcacag cttctggcca actttacctt gatgatggcg aatctatcta ccctaacgct 2700

acacttcatg ttgatttcac agcttctcgt tcttctcttc gttcttctgc tcaaggccgt 2760

tggaaagaac gtaaccctct tgctaacgtt acagttcttg gcgttaacaa agaaccttct 2820

gctgttacac ttaacggcca agctgttttc cctggctctg ttacatacaa ctctacatct 2880

caagttcttt tcgttggcgg ccttcaaata a 2911

<210>2

<211>49

<212>DNA

<213>agXtemP1

<400>2

atggttaaac tgccctttaa catccaaatg ttttctactt ccattacgg 49

<210>3

<211>50

<212>DNA

<213>agXtemP2

<400>3

ttaccattca aacgttagtt gaaacgaacg taacgagagt caacatccca 50

<210>4

<211>27

<212>DNA

<213>Samy1

<400>4

cggggtacca aaaaatcaaa taaggag 27

<210>5

<211>30

<212>DNA

<213>Samy2

<400>5

cgcggatcct gtaagctcat tcgatttgtt 30

<210>6

<211>24

<212>DNA

<213>agA1

<400>6

gtttcctcta gtcctaccaa gcga 24

<210>7

<211>25

<212>DNA

<213>agA2

<400>7

ctaactacaa cacccaacga cacct 25

<210>8

<211>29

<212>DNA

<213>agB1

<400>8

gatagttctt ctttcagagg ttgagtgtc 29

<210>9

<211>28

<212>DNA

<213>agB2

<400>9

ctaaaactca atccgccatg tctttcca 28

<210>10

<211>22

<212>DNA

<213>agC1

<400>10

cccagctata aatcgggact ga 22

<210>11

<211>21

<212>DNA

<213>agC2

<400>11

tcacgcatac agcaccgttc c 21

<210>12

<211>26

<212>DNA

<213>agD1

<400>12

gtaatagctg ttccattctc atcaag 26

<210>13

<211>25

<212>DNA

<213>agD2

<400>13

ctaccattcc aatacccagt tttcc 25

<210>14

<211>21

<212>DNA

<213>agE1

<400>14

cagaaaacgc ccaaaacacc a 21

<210>15

<211>22

<212>DNA

<213>agE2

<400>15

tcaagcctcc accaaaagaa ca 22

<210>16

<211>25

<212>DNA

<213>agF1

<400>16

cctaattgga ctgcatctgt tcaac 25

<210>17

<211>22

<212>DNA

<213>agF2

<400>17

tcagaccctg acaaataccg gc 22

Claims (1)

1. An alpha-glucosidase encoding gene, characterized in that: the sequence of the alpha-glucosidase coding gene is shown as SEQ ID NO. 1.

Images