Embodiment
Method therefor is ordinary method if no special instructions among the following embodiment.
" glucase " definition among the present invention: (Glucoamylase EC.3.2.1.3), claims gamma amylase again to glucoamylase, is called for short saccharifying enzyme, and saccharifying enzyme has the extracellular enzyme of 5 prime excision enzyme activity by a series of microorganism secretions.The main effect of saccharifying enzyme is the α-D-1 on the carbochains such as hydrolyzed starch, dextrin, glycogen, 4 glucoside bonds and α-D-1,6 glucoside bonds.With glucose one by one hydrolysis get off, and obtain end product β-D-glucose.Saccharifying enzyme also can be faint hydrolyzing alpha-D-1,3 glucoside bonds, but hydrolyzing alpha-D-1,4 glucoside bonds fastest.
Embodiment 1, can express the structure of the engineering bacteria of thermophilic glucoamylase
One, the structure of the glaA gene knockout engineering bacteria of Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204)
1, the clone of aspergillus niger saccharification enzyme (glaA) gene 5 ' flanking sequence and 3 ' flanking sequence
Go up glucoamylase gene (having GENBANK Accession Number is 5 of AM270061.1 ' end 94354-92183 position nucleotide sequence) and the upstream and downstream sequences Design primer of announcing thereof according to NCBI:
The primer of the distolateral wing sequence of 5 of glaA ':
GlA5’FR1’F:5′-CAAGTATATGATGCGGTAGTGG-3′;
GlA5’FR1’R:5′-TGCTGAGGTGTAATGATGCTGG-3′。
The primer of the distolateral wing sequence of 3 of glaA ' adds XhoI and ApaI restriction enzyme site:
Hyg-GlA3’FR3’F:5’-CTCGAGACAATCAATCCATTTCGCTAT-3’
Hyg-GlA3’FR3’R:5’-GGGCCCTAACTCCGCGGAGGCTCATGG-3’
As template, is primer with GlA5 ' FR1 ' F and GlA5 ' FR1 ' R sequence with the genomic dna of Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204) respectively; Hyg-GlA3 ' FR3 ' F and Hyg-GlA3 ' FR3 ' R sequence are that primer carries out pcr amplification and obtains saccharifying enzyme 5 ' flanking sequence, 3 ' flanking sequence.
Above-mentioned pcr amplification condition is: 94 ℃ of pre-sex change 5 minutes, carry out 25 circulations again: 94 ℃ of sex change, 1 minute, extend 72 ℃, 2 minutes, 72 ℃, extended 10 minutes 56 ℃ of 30 seconds, annealing.
The primer of the distolateral wing sequence of 5 of above-mentioned glaA ' (GlA5 ' FR1 ' F and GlA5 ' FR1 ' R) pcr amplification obtains the amplified production of 1.5kb, show that through order-checking this product is the distolateral fin section of 5 of glaA ' (being 5 of AM270061.1 ' end 95854-94355 position Nucleotide from GENBANK number), with this fragment called after glaA5 ' FR.
Above-mentioned primer obtains about 1.5kb product to Hyg-GlA3 ' FR3 ' F and Hyg-GlA3 ' FR3 ' R pcr amplification, show that through order-checking this amplified fragments is the distolateral fin section of 3 of glaA ', with its called after glaA3 ' FR, this product has from GENBANK number holds 92182-90683 position Nucleotide for 5 of AM270061.1 '.
2, the structure of aspergillus niger saccharification enzyme (glaA) gene knockout carrier
Go up the following primer of Totomycin expression cassette sequences Design according to plasmid pSecTag2/Hygro A (available from invitrogen company):
Hyg aligning primer two ends add the NotI restriction enzyme site:
GlA5’FR-Hyg2’F:5’-GCGGCCGCGATGAAAAAGCCTGAACTCACCG-3’
GlA5’FR-Hyg2’R:5’-GCGGCCGCGCTATTCCTTTGCCCTCGGACGA-3’
With GlA5 ' FR-Hyg2 ' F and GlA5 ' FR-Hyg2 ' R is primer, is template with plasmid pSecTag2/Hygro A (available from invitrogen company), amplification hygromycin gene expression cassette.
Amplification condition is: 94 ℃ of pre-sex change 5 minutes, carry out 25 circulations again: 94 ℃ of sex change, 1 minute, extend 72 ℃, 2 minutes, 72 ℃, extended 10 minutes 56 ℃ of 30 seconds, annealing.
Pcr amplification obtains about 1.0kb fragment, shows that through order-checking its nucleotides sequence classifies sequence 1 in the sequence table as, is hygromycin gene, with its called after HYG.
1.5kb glaA5 ' FR that above-mentioned amplification is obtained is cloned on the T carrier pEasy-T1 (available from full formula King Company), cuts through pcr amplification, enzyme and identifies and sequence verification, will checking correctly contains recombinant vectors called after pET-5 ' FR1 of 1.5kb glaA5 ' FR.The 1.0kb HYG that above-mentioned amplification is obtained is cloned on the T carrier pEasy-T1 (available from full formula King Company), cuts through pcr amplification, enzyme and identifies and sequence verification, will checking correctly contains the recombinant vectors called after pET-Hyg of HYG.1.5kb glaA3 ' FR that above-mentioned amplification is obtained is cloned on the T carrier pEasy-T1 (available from full formula King Company), cuts through pcr amplification, enzyme and identifies and sequence verification, will checking correctly contains recombinant vectors called after pET-3 ' FR1 of glaA3 ' FR.
The building process of aspergillus niger saccharification enzyme (glaA) gene knockout carrier as shown in Figure 1, after pET-Hyg cut with the NotI enzyme, the 1.0kb fragment that recovery obtains, the NotI restriction enzyme site that this fragment is inserted into pET-5 ' FR1 obtains recombinant vectors, carry out that enzyme is cut and sequence verification, empirical tests is shown contain Hyg and the segmental recombinant vectors called after of glaA5 ' FR pET-5 ' FR1-Hyg.PET-3 ' FR1 is cut with XhoI and ApaI enzyme, reclaim the 1.5kb fragment, be inserted between the XhoI and ApaI restriction enzyme site of pET-5 ' FR1-Hyg, obtain recombinant vectors, this recombinant vectors carried out enzyme is cut and sequence verification, empirical tests is shown contain glaA5 ' FR, Hyg and the segmental recombinant vectors called after of the glaA3 ' FR pEasy-glaA that connects successively
Dir(Fig. 1), this carrier is Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204) glucoamylase gene knockout carrier.
3, Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204) knocks out the bacterial strain 668-glaA of saccharifying enzyme (glaA) gene
DirStructure
Digest the plasmid pEasy-glaA of 10 micrograms with HindIII
Dir, on 0.8% sepharose, separate linear DNA, and isolate the linearizing pEasy-glaA of HindIII by agarose gel electrophoresis
DirPlasmid DNA fragment, glue reclaim this fragment.
The pEasy-glaA that above-mentioned separation is obtained
DirThe plasmid linear DNA carries out protoplast transformation and goes in Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204).Method for transformation see document (Yao Tingting, Wang Zhengxiang. the preparation of aspergillus niger protoplastis, regeneration and conversion condition. food and biotechnology journal, 2006 25 the volume 04 phase), concrete steps are as follows:
A, Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204) is cultivated with the Cha Shi solid medium, picking includes the 4cm of substratum
2About the single bacterium colony and the substratum of size put into the triangular flask that includes 60ml Cha Shi liquid nutrient medium together, 30 ℃ of 200rpm shaking tables were cultivated 4 days, collected mycelium;
B, with the 1M Sorbitol Solution USP wash steps A obtain mycelium once, take by weighing weight in wet base, be the enzyme-added lysate of 1g: 10ml according to mass volume ratio, 30 ℃, the slight shaking table enzymolysis of 80rpm, blood counting chamber detect the formation quantity of protoplastis and determine enzymolysis time, obtain protoplasma body fluid;
C, protoplasma body fluid is filtered, collect filtrate, 4 ℃ of centrifugal 10min of following 3200rpm, abandon supernatant liquor, with the 0.6M KCl solution and the S/C solution washing precipitation, centrifugal of precooling, the protoplastis precipitation is resuspended in an amount of S/C solution, makes protoplastis concentration reach 1-3 * 10 respectively
6Individual/ml, it is standby to put ice bath;
D, get the protoplastis suspension that 100ul step C obtains, add linearization plasmid (10ul) pEasy-glaA of about 1-10ug
Dir, use rifle head pressure-vaccum mixing gently, add 50ul PEG solution, put upside down mixing gently, ice bath 20 minutes;
Get the protoplastis that 100ul step C obtains simultaneously respectively, add ddH respectively
2O (10ul) with rifle head pressure-vaccum mixing and add 50ulPEG solution gently, puts upside down mixing, ice bath 20 minutes respectively gently;
E, change plasmid after taking out over to change ddH over to
2The difference of O slowly adds 1ml PEG solution, and room temperature is placed and to be added 2ml S/C solution after 5 minutes, puts upside down mixing gently, with change plasmid over to change ddH over to
2Being layered on respectively of O (minimum medium that contains the 200ug/ml hygromycin B) on the selectivity flat board changes ddH in addition over to
2Being layered on the control medium of O contrasts as protoplastis; 30 ℃ of cultivations.
The substratum that uses in the above-mentioned steps and the prescription of solution are as follows:
Cha Shi solid medium: contain the agar of 1.6% (quality percentage composition), sucrose 3.0% (quality percentage composition), NaNO
30.2% (quality percentage composition), K
2HPO
40.1% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), all the other are water; The solid medium of pH5.5-6.0
Cha Shi liquid nutrient medium: contain sucrose 3.0% (quality percentage composition), NaNO
30.2% (quality percentage composition), K
2HPO
40.1% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), all the other are water, the liquid nutrient medium of pH5.5-6.0.
Minimum medium: contain 1M sucrose, K
2HPO
40.1% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), KCl 0.05% (quality percentage composition), NaNO
30.2% (quality percentage composition), the agar of 1% (quality percentage composition), the 200ug/ml hygromycin B, all the other are the solid medium of water.
Control medium: 1M sucrose, NaNO
30.2% (quality percentage composition), K
2HPO
40.1% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), 1% agar.
Enzymatic lysis liquid: 1% (quality percentage composition) helicase, 1% (quality percentage composition) cellulase, 0.1% (quality percentage composition) N,O-Diacetylmuramidase, after the Sorbitol Solution USP configuration with 1M, with the membrane filtration sterilization in 0.45um aperture.
S/C solution: contain the 1M sorbyl alcohol, 50mM CaCl
2Solution.
PEG solution: contain 25% (quality percentage composition) PEG8000,50mM CaCl
2, 10mM Tris-HCl, the solution of pH7.5.
A transformant 30 ℃ of cultivations all grew ten after 9-10 days on the selectivity flat board surplus, protoplastis is in contrast grown up on control medium, illustrates that the digestion of protoplastis is no problem, and do not grow bacterium colony on selective medium.Transformant list bacterium colony on the picking selectivity flat board, be seeded in the Cha Shi liquid nutrient medium that contains hygromycin B (200ug/ml), cultivate after 3-4 days for 30 ℃, getting 200ul liquid is coated on the Cha Shi solid medium (containing hygromycin B 200ug/ml), separate continuously and go down to posterity 2 times, the transformant that contains the hygromycin B resistant gene survives.According to the distolateral fin section of 5 of glaA ' (is 5 of AM270061.1 ' end 95854-94355 position Nucleotide from GENBANK number), in conjunction with its position and upstream sequence, design authenticate forward primer (this primer is positioned at GENBANK number and is 5 of AM270061.1 ' end 96180-96161 position Nucleotide)
Up glaA 5’FR F:CTATCGTGTTTGTAGCAATG
According to the Totomycin sequence, design authenticate reverse primer:
In Hyg 3‘FR R:CTATTTACCCGCAGGACATA
The bacterial strain of getting survival extracts genomic gene, carries out augmentation detection with Up glaA 5 ' FR F and In Hyg 3 ' FR R, and it is that PCR detects the male bacterial strain that amplification obtains the segmental bacterial strain of 2.0kb.PCR is detected male recombinant bacterial strain called after aspergillus niger 668-glaA
Dir
Two, express the acquisition of the recombinant bacterial strain of sulfolobus solfataricus (sulfolobus solfataricus) SSG (SSG is the protein of ssg genetic expression)
1, the structure of the glucoamylase gene expression vector of sulfolobus solfataricus (sulfolobus solfataricus)
1) clone of aspergillus niger amdS gene
Go up aspergillus oryzae acetamidase gene order and the aspergillus niger genomic dna announced according to NCBI and compare the sequences Design primer of choosing the similarity maximum:
Acetamidase primer band Sca I and Not I restriction enzyme site
PgpdA-amdS 5F:5′-AGTACTATGGCCCTCACATCCTGGGAAC-3′;
amdS-TrpC 5R:5′-GCGGCCGCTCAAGCACTAGCCTTCTTGAATT-3′;
As template, is primer with PgpdA-amdS 5F and amdS-TrpC 5R with the genomic dna of Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204), carries out pcr amplification.
Amplification condition is: 94 ℃ of pre-sex change 5 minutes, carry out 25 circulations again: 94 ℃ of sex change, 1 minute, extend 72 ℃, 2 minutes, 72 ℃, extended 10 minutes 56 ℃ of 30 seconds, annealing.
Amplification obtains the dna fragmentation of about 1.9kb, reclaim and check order after this fragment is connected to pEasy-T1 (purchase in full formula King Company) carrier, show that through order-checking this amplified fragments is acetamidase gene (being 5 of AM270228.1 ' end 31228-33207 position nucleotide sequence from GENBANK number), with its called after amdS, will contain the segmental recombinant vectors called after of this amdS pET-amdS.
The amdS fragment that plasmid pET-amdS is obtained 1.9kb after with Sca I and Not I double digestion is standby.
2) the segmental acquisition of PgpdA
According to the promotor PgpdA sequences Design primer of Aspergillus nidulans glyceraldehyde 3-phosphate dehydro-genase gene gpdA with Aspergillus nidulans (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) 2288) genomic dna obtains the PgpdA fragment of 2049bp for the template pcr amplification, its sequence is for 5 of Z32524.1 ' end 138-2186 position nucleotide sequence, as the promoter sequence of amdS from GENEBANK number.
Primer is with Bgl II and Sca I restriction enzyme site respectively, and primer sequence is as follows:
PgpdA-F:AGATCT AGATCTTTCGACACTGAAATAC;
PgpdA-R:AGTACT AGTACTTACTTAGGGGAAATAA。
Amplification obtains the fragment of about 2.0kb, reclaim be connected to after the PgpdA fragment that amplification obtains on the pEASY-T1 carrier through order-checking show correct after, use Bgl II and Sca I double digestion, obtain about 2.0kb fragment, with its called after PgpdA.
3) the segmental acquisition of TtrpC
According to the terminator TtrpC sequences Design primer of Aspergillus nidulans tryptophane synthetic gene trpC with Aspergillus nidulans (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) 2288) genomic dna obtains the TtrpC fragment of 763bp for the template pcr amplification, the sequence of NCBI from GENEBANK number for X02390.1 5 ' hold 3406-4168 position nucleotide sequence, this fragment is as the terminator of amdS.
Primer sequence is as follows:
amdS-TtrpC 6F:5′-GCGGCCGC GGATCCACTTAACGTTACTGA-3′;
TtrpC-GlA3’FR 6R:5′-AAGCTT TCGAGTGGAGATGTGGAGTGG-3′;
With NotI and this fragment of HindIII double digestion, obtain the 0.76kb fragment, after the TtrpC fragment that the recovery amplification obtains through the correct fragment called after TtrpC of sequence verification.
4) with the amplification of 3 ' FR sequence of different restriction enzyme sites
With carrier pET-3 ' FR1 template, design following two pairs of primers respectively with different restriction enzyme sites, carry out pcr amplification.Wherein the primer sequence with ApaI and BglII restriction enzyme site is:
Ssg-GlA3’FR 3F:5′-GGGCCCACAATCAATCCATTTCGCTATA-3′;
GlA3’FR-PgpdA 3R:5′-AGATCTTAACTCCGCGGAGGCTCATGG-3′。
Band HindIII and AatII restriction enzyme site primer sequence are:
TrpC-GlA3’FR 7F:5′-AAGCTTACAATCAATCCATTTCGCTA-3′;
GlA3’FR 7R:5′-GACGTCTAACTCCGCGGAGGCTCATGG-3′。
Amplification condition is: 94 ℃ of pre-sex change 5 minutes, carry out 25 circulations again: 94 ℃ of sex change, 1 minute, extend 72 ℃, 2 minutes, 72 ℃, extended 10 minutes 56 ℃ of 30 seconds, annealing.
Amplification obtains having 3 ' FR fragment of the 1.5kb of different restriction enzyme sites.This amplification is obtained having 3 ' FR fragment called after, 3 ' flank P1 fragment of ApaI and BglII restriction enzyme site; 3 ' FR fragment called after, the 3 ' flank P2 fragment that has HindIII and AatII restriction enzyme site that above amplification is obtained.
5) clone of the glucoamylase gene of sulfolobus solfataricus (sulfolobus solfataricus)
The ssg gene order of the sulfolobus solfataricus P2 that announces according to NCBI, analyze Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204) middle glucoamylase gene promoter sequence, utilization fusion round pcr is synthetic to contain Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204) in the fragment of ssg gene order (having GENBANKAccession Number is that 5 of AE006718 ' holds 6228-8096 position nucleotide sequence) of saccharifying enzyme 5 ' terminal sequence (being 5 of AM270061.1 ' end 95854-94355 position Nucleotide) and sulfolobus solfataricus P2 from GENBANK number, with its called after 5 ' FR-SSG.Its concrete preparation method is as described below:
Design Overlap PCR primer sequence is as follows, wherein, GlA 5 ' FR 1F band AatII restriction enzyme site, Ssg2R band ApaI restriction enzyme site:
GlA 5’FR 1F:5′-GACGTCCAAGTATATGATGCGGTAGTG-3′;
GlA5’FR-ssg1R:
5′-TTCCTATGGAGGAAACTCTCATTGCTGAGGTGTAATGATGCTGG-3′;
GlA5’FR-ssg2F:
5′-CCAGCATCATTACACCTCAGCAATGAGAGTTTCCTCCATAGGAA-3′;
Ssg2R:5′-GGGCCCTTATATATGGTTTAAGAGCT-3′。
With pET-5 ' FR1 is template, (GlA 5 ' FR 1F and GlA5 ' FR-ssg1R) is that primer carries out pcr amplification with above-mentioned sequence, amplification condition is: 94 ℃ of pre-sex change 5 minutes, carry out 25 circulations again: 94 ℃ of sex change, 56 ℃ of 30 seconds, annealing, 1 minute, extend 72 ℃, 2 minutes, 72 ℃, extended 10 minutes.Obtain GlA 5 ' FR fragment of 1.5kb.
With hyperthermophilic archaeon strain sulfolobus solfataricus P2 (available from Chinese common micro-organisms culture presevation administrative center, catalog number (Cat.No.) 1.2371
T) genomic dna is template, above-mentioned GlA5 ' FR-ssg2F and Ssg2R are primer, carry out pcr amplification, amplification condition is: 94 ℃ of pre-sex change 5 minutes, carry out 25 circulations again: 94 ℃ of sex change, 56 ℃ of 30 seconds, annealing, 1 minute, extend 72 ℃, 2 minutes, 72 ℃, extended 10 minutes.PCR obtains the ssg fragment fragment of 1.8kb.
GlA 5 ' the FR and the ssg fragment that obtain with above-mentioned PCR are template, carry out pcr amplification with primer GlA 5 ' FR 1F and Ssg2R, amplification condition is: 94 ℃ of pre-sex change 5 minutes, carry out 25 circulations again: 94 ℃ of sex change, 56 ℃ of 30 seconds, annealing, 1 minute, extend 72 ℃, 3 minutes, 72 ℃, extended 10 minutes.
3.3kb fragment with pcr amplification obtains is 5 ' FR-ssg, 5 ' FR-ssg is connected to pEasy-T1 upward cuts evaluation correctly, called after pET-5 ' FR-ssg through order-checking and enzyme.Show the nucleotide sequence that about 3.3kb fragment 5 ' FR-ssg that this pcr amplification obtains has sequence 2 in the sequence table through order-checking, 5 of sequence 2 ' end 1-1500 position is that above-mentioned Aspergillus niger strain CICC 2204 is (available from Research for Industrial Microbial Germ preservation administrative center in sequence table, catalog number (Cat.No.) is 2204) middle saccharifying enzyme 5 ' terminal sequence is the SSG gene order of above-mentioned sulfolobus solfataricus P2 from 5 of sequence 2 ' end 1501-3369 position.
6) structure of the recombinant vectors of the glucoamylase gene of expression sulfolobus solfataricus (sulfolobus solfataricus)
With the above-mentioned PgpdA fragment that obtains with is connected through the amdS fragment of double digestion after obtain the 4034bp fragment, and obtain the 4797bp fragment after TtrpC 763p fragment through NotI and the acquisition of HindIII double digestion is connected.This fragment with obtain the 6297bp fragment after 3 ' flank P1 fragment with the 1.5kb behind ApaI and the BglII double digestion is connected, with through HindIII with obtain the 7797bp fragment after 3 ' flank P2 fragment (1510bp) after the AatII enzyme is cut is connected.
After pET-5 ' FR-ssg cut with AatII and ApaI enzyme, be connected (selecting the two to hold ways of connecting), obtain the 11.1kb fragment at ApaI with the fragment of the above-mentioned 7.8kb that obtains.
Cut with this fragment and through the AatII enzyme and to obtain new recombinant expression vector after pGEM-T Vector (available from the promega) carrier segments that reclaims the back is connected, this carrier is carried out PCR and sequence verification, with the correct segmental recombinant vectors called after of the above-mentioned 11.1kb pWW (its structural representation as shown in Figure 2) that contains of checking.
2, the screening of the conversion of recombinant aspergillus niger expression vector pWW and transformant
1) conversion of recombinant aspergillus niger expression vector pWW
Recombinant aspergillus niger expression vector pWW is after the linearizing of AatII complete degestion, with the bacterial strain aspergillus niger 668-glaA of the step 3) of step 1 preparation
DirFor starting strain prepares protoplastis, carry out the PEG-protoplast transformation, method for transformation see document (Yao Tingting, Wang Zhengxiang. the preparation of aspergillus niger protoplastis, regeneration and conversion condition. food and biotechnology journal, 2006 25 04 phases of volume), concrete steps are as follows:
A, with aspergillus niger 668-glaA
DirCultivate with the Cha Shi solid medium, picking includes the 4cm of substratum
2About the single bacterium colony and the substratum of size put into the triangular flask that includes 60ml Cha Shi liquid nutrient medium together, 30 ℃ of 200rpm shaking tables were cultivated 4 days, collected mycelium;
B, with the 1M Sorbitol Solution USP wash steps A obtain mycelium once, take by weighing weight in wet base, be the enzyme-added lysate of 1g: 10ml according to mass volume ratio, 30 ℃, the slight shaking table enzymolysis of 80rpm, blood counting chamber detect the formation quantity of protoplastis and determine enzymolysis time, obtain protoplasma body fluid;
C, protoplasma body fluid is filtered, collect filtrate, 4 ℃ of centrifugal 10min of following 3200rpm, abandon supernatant liquor, with the 0.6M KCl solution and the S/C solution washing precipitation, centrifugal of precooling, the protoplastis precipitation is resuspended in an amount of S/C solution, makes protoplastis concentration reach 1-3 * 10 respectively
6Individual/ml, it is standby to put ice bath;
D, get the protoplastis suspension that 100ul step C obtains, add linearization plasmid (10ul) pWW of about 1-10ug, with rifle head pressure-vaccum mixing gently, adding 50ulPEG solution is put upside down mixing, ice bath 20 minutes gently;
Get the protoplastis that 100ul step C obtains simultaneously respectively, add ddH respectively
2O (10ul) with rifle head pressure-vaccum mixing and add 50ulPEG solution gently, puts upside down mixing, ice bath 20 minutes respectively gently;
E, change plasmid after taking out over to change ddH over to
2The difference of O slowly adds 1ml PEG solution, and room temperature is placed and to be added 2ml S/C solution after 5 minutes, puts upside down mixing gently, with change plasmid over to change ddH over to
2Dull and stereotyped go up (minimum medium that contains 10mM ethanamide and 20mM CsCl) selected in being layered on respectively of O, changes ddH in addition over to
2Being layered on the control medium of O contrasts as protoplastis; Cultivated 5-6 days for 30 ℃.
The substratum that uses in the above-mentioned steps and the prescription of solution are as follows:
Cha Shi solid medium: contain the agar of 1.6% (quality percentage composition), sucrose 3.0% (quality percentage composition), NaNO
30.2% (quality percentage composition), K
2HPO
40.1% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), all the other are water; The solid medium of pH5.5-6.0.
Cha Shi liquid nutrient medium: contain sucrose 3.0% (quality percentage composition), NaNO
30.2% (quality percentage composition), K
2HPO
40.1% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), all the other are water, the liquid nutrient medium of pH5.5-6.0.
Minimum medium: contain 1M sucrose, K
2HPO
40.1% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), 10mM ethanamide, the solid medium of 20mM CsCl and 1% (quality percentage composition) agar.
Control medium: 1M sucrose, NaNO
30.2% (quality percentage composition), K
2HPO
40.1% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), 1% agar.
Enzymatic lysis liquid: 1% (quality percentage composition) helicase, 1% (quality percentage composition) cellulase, 0.1% (quality percentage composition) N,O-Diacetylmuramidase, after the Sorbitol Solution USP configuration with 1M, with the membrane filtration sterilization in 0.45um aperture.
S/C solution: contain the 1M sorbyl alcohol, 50mM CaCl
2Solution.
PEG solution: contain 25% (quality percentage composition) PEG8000,50mM CaCl
2, 10mM Tris-HCl, the solution of pH7.5.
2) screening of transformant
AmdS genes encoding acetamidase gene, this endonuclease capable acts on ethanamide, and decomposing ethanamide is acetate and ammonium, as the carbon source of cell growth.The faint expression in Aspergillus niger strain CICC 2204 (available from Research for Industrial Microbial Germ preservation administrative center, catalog number (Cat.No.) is 2204) of this gene, the faint expression of endogenic acetamidase simultaneously can be inhibited by adding 20mM CsCl.By being that thereby growth filters out the positive colony that homologous recombination takes place on the substratum supplied with of carbon source only containing ethanamide, stable transformant shows as dominant growth and bacterium colony increases gradually.Aspergillus niger strain CICC 2204 protoplastiss are grown in contrast on minimum medium, contrast can grow up the explanation protoplastis digestion no problem, and Aspergillus niger strain CICC 2204 protoplastiss (minimum medium that contains 10mM ethanamide and 20mM CsCl) on selective medium do not grow or grow less bacterium colony but can not continued growth, are positive transformant at the above-mentioned transformant of selecting can grow on the substratum that obtains.The transformant that the picking step 1) obtains (contains 1M sucrose, K at the minimum medium that contains 10mM ethanamide and 20mM CsCl
2HPO
40.1% (quality percentage composition), 7H
2OFeSO
40.001% (quality percentage composition), 7H
2OMgSO
40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), 10mM ethanamide, the solid medium of 20mM CsCl and 1% (quality percentage composition) agar), cultivate screening 2 times, obtain positive transformant for 30 ℃.
For positive transformant is identified, according to the distolateral fin section of 5 of glaA ' (is 5 of AM270061.1 ' end 95854-94355 position Nucleotide from GENBANK number), in conjunction with its position and upstream sequence, design authenticate forward primer (this primer is positioned at GENBANK number and is 5 of AM270061.1 ' end 96180-96161 position Nucleotide)
Up glaA 5’FR F:5′-CTATCGTGTTTGTAGCAATG-3′
According to the synthetic authenticate reverse primer of glucoamylase gene (having GENBANK Accession Number is 5 of AE006718 ' end 6228-8096 position nucleotide sequence) of sulfolobus solfataricus,
In Ssg R:5′-CTATATATAATACAGTAGTTTC-3′
Extract bacterial strain aspergillus niger 668-glaA
DirAnd the genomic dna of transformant, carry out the PCR Molecular Identification, carry out augmentation detection with primer Up glaA 5 ' FR F and In Ssg R, it is that PCR detects the male bacterial strain that amplification obtains the segmental bacterial strain of 2047bp, and result's screening obtains PCR and detects the correct commentaries on classics pWW bacterial strain of male.And the contrast bacterium purpose band that do not increase.
3) transformant thermophilic glucoamylase enzyme activity determination
The mono-clonal of the above-mentioned transformant of picking includes the 4cm of substratum respectively
2About the size single bacterium colony, put into together to be switched to substratum 100ml shake-flask culture base (soybean cake powder 2% (quality percentage composition) is housed, corn steep liquor 2% (quality percentage composition), W-Gum 12% (quality percentage composition), all the other are water) the 500ml triangular flask in, get original bacteria strain aspergillus niger 668-glaA simultaneously
DirIn contrast, shake training 4 days under 30 ℃, get fermented liquid supernatant liquid and test diastatic activity respectively.
Thermophilic glucoamylase enzyme activity determination method is as described below:
Draw 1ml fermented liquid supernatant liquid respectively, move in the volumetric flask, be diluted to the 10ml scale with damping fluid respectively, the 100ml scale, the 1000ml scale (decide according to enzyme height alive, and concentration is high more by dilute strength, extension rate should be big more) fully shake up, to be measured as sample.When preparing enzyme liquid to be measured, the difference that sample liquid concentration consumes 0.05mol/L Sulfothiorine standard titration solution in the time of should being controlled at the blank and sample of titration is at 4.5ml~5.5ml, and scope is interior, and (enzyme activity is about 120U/ml~150U/ml).
Get two 50ml colorimetric cylinders of A, B, add 25ml 20g/L Zulkovsky starch solution and 5ml 0.05mol/L acetate-sodium acetate buffer solution (pH6.0) respectively, shake up.Preheating 5min~10min in 80 ± 0.2 ℃ water bath with thermostatic control.In the B pipe, add the above-mentioned liquid to be measured of 2.0ml, shake up, clock immediately.Behind accurate response 30min under this temperature, in A, B two pipes, respectively add 0.2ml 200g/L sodium hydroxide solution immediately, shake up, simultaneously two pipes are taken out, use water cooling rapidly, and in the A pipe, add the above-mentioned liquid to be measured of 2.0ml (as blank).
Draw each 5.0ml of reaction solution in above-mentioned A, B two pipes, in two iodine flasks, accurately add 0.1mol/L iodine reference liquid (press the GB/T601 preparation and demarcate) 10.0ml, add 15ml 0.1mol/L sodium hydroxide solution again, the limit edged shakes up, and places 15min in the dark place, takes out.Use the water wash bottle cap, add 2mol/L sulphuric acid soln 2ml, with 0.05mol/L Sulfothiorine standard titration solution (press GB/T601 preparation with demarcate) titration blue-violet solution, until just colourless be its terminal point, the volume (V of the blank and sample consumption Sulfothiorine standard titration solution of record respectively
A, V
B).
The thermophilic glucoamylase unit of activity: 1ml enzyme liquid or 1g enzyme powder are under 80 ℃, the condition of pH6.0, and 1h hydrolysis Zulkovsky starch produces 1mg glucose, is an enzyme activity unit, and symbol is: U/ml (or U/g).
Enzyme activity unit calculates by formula (1):
X=(V
A-V
B)×c×90.05×32.2/5×1/2×n×2=579.9×(V
A-V
B)c×n...........(1)
In the formula:
The enzyme activity unit of X---sample, unit are every milliliter of enzyme activity unit (U/ml) or the every gram of enzyme activity unit (U/.g);
V
A---when titration is blank, consume the volume of Sulfothiorine standard titration solution, unit is a milliliter (mL);
V
B---during the titration sample, consume the volume of Sulfothiorine standard titration solution, unit is a milliliter (mL);
The accurate concentration of c---Sulfothiorine standard titration solution, unit is every liter (mol/L) of mole;
90.05---the molar mass of glucose, unit is every mole (g/mol) of gram;
32.2---the cumulative volume of reaction solution, unit are milliliter (mL);
5---draw the volume of reaction solution, unit is a milliliter (mL);
1/2---be converted to the amount of 1mL enzyme liquid;
N---extension rate;
2---react 30min, be converted into the enzyme activity coefficient of 1h.
With sample determination result's arithmetical mean value representation, the revision of the convention to three position effective digital.
Result's tolerance: the twice independent test result's who under repeated condition, obtains absolute difference be not more than these two measured values arithmetical av 10%, be prerequisite to be no more than 5% under the situation greater than the arithmetical av 10% of these two measured values.
The result shows, original bacteria strain aspergillus niger 668-glaA
DirThe work of thermophilic glucoamylase enzyme be zero because there is not the thermophilic glucoamylase gene of sulfolobus solfataricus in original strain, and the saccharifying enzyme of himself is also knocked out.This with we the expection consistent.10 positive transformant vigor being measured are had nothing in common with each other, and the enzyme that one of them bacterial strain produces is lived the highest, and enzyme is lived and is 3000U/ml.
With this bacterial strain called after aspergillus niger (Aspergillus niger) WW1.This aspergillus niger (Aspergillus niger) WW1, be preserved in Chinese microorganism strain preservation board of trustee reason person on December 25th, 2008 and understand common micro-organisms center (abbreviation CGMCC, the address is: Da Tun road, Chaoyang District, BeiJing, China city), preserving number is CGMCC No.2841.
The compound method of the reagent that above-mentioned enzyme activity determination uses is as described below:
0.05mol/L acetate-sodium acetate buffer solution (pH6.0): take by weighing sodium acetate (CH
3COONa3H
2O) 6.7g is with water dissolution and be settled to 1000ml.The pH value of above-mentioned damping fluid should be drawn glacial acetic acid (about 0.5ml-1ml) and use acidometer to be proofreaied and correct.
20g/L Zulkovsky starch solution: take by weighing Zulkovsky starch (2 ± 0.001) g, mix well with less water then, slowly impouring in the ebullient water, is boiled, is stirred until transparent, cooling, and water is settled to 100ml.This solution needs preparation on the same day.
Embodiment 2, prepare thermophilic glucoamylase in a large number
1, substratum preparation
Strain activation and culture base: sucrose 3.0% (quality percentage composition), K
2HPO
40.1% (quality percentage composition), 7H2OFeSO40.001% (quality percentage composition), 7H2OMgSO40.05% (quality percentage composition), KCl 0.05% (quality percentage composition), 10mM ethanamide and 20mM CsCl, all the other are water, regulate pH to 5.5-6.0,121 ℃ of sterilization 30min.
First order seed substratum:
soybean cake powder 3% (quality percentage composition), corn steep liquor 2.5% (quality percentage composition), W-Gum 15% (quality percentage composition), alpha-amylase (Novi
Profit can come fire resistant alpha-diastase Supra (
Supra) lot number: NBSG4213) 12U/ gram W-Gum is handled 30min for 80 ℃, polyoxyethylene polyoxypropylene tetramethylolmethane ether (Polyoxyethylene Polyoxypropylene PentaerythritolEther-PPE) 0.05% (quality percentage composition), all the other are water, 121 ℃ of sterilization 30min.
Fermention medium: W-
Gum 20% (quality percentage composition),
soybean cake powder 5% (quality percentage composition), corn
steep liquor 3% (quality percentage composition), sulphur ammonium 0.8% (quality percentage composition), calcium chloride 0.05% (quality percentage composition), alpha-amylase (Novi
Profit can come fire resistant alpha-diastase Supra (
Supra) lot number: NBSG4213) 12U/ gram W-Gum is handled 30min for 80 ℃, polyoxyethylene polyoxypropylene tetramethylolmethane ether (Polyoxyethylene Polyoxypropylene Pentaerythritol Ether-PPE) 0.05% (quality percentage composition), all the other are water, 121 ℃ of sterilization 30min.
2, fermentative preparation thermophilic glucoamylase
Seed culture: aspergillus niger (Aspergillus niger) WW1 is inoculated into strain activation and culture base (Cha Shi substratum) activation, choose single bacterium colony from flat board, be linked in the first order seed substratum (100ml/500ml triangular flask), 30 ℃, 150r/min cultivates 2d, and whether microscopy also is coated with dull and stereotyped the detection and pollutes.
High density fermentation: seed is after the first order seed culture medium culturing, be that 10% inoculum size is received in the 5L fermentor tank that the 2.5L fermention medium is housed by volume, 30 ℃, 200 rev/mins (fermentor tank is a Shanghai Baoxing Biology Equipment Engineering Co., Ltd, model: stirring velocity BIOTECH-5BG) is carried out fermentation culture, after about 16 hours, beginning with mass percentage concentration is that 25% ammoniacal liquor is regulated pH, makes the pH of fermented liquid be controlled at 4.2-4.5.By regulating rotating speed, tank pressure and air flow quantity, speed makes dissolved oxygen greater than 20%, cultivates about 120 hours.Timing sampling observation of cell growing state and enzyme are lived in the culturing process.The enzyme activity determination method is carried out according to the described thermophilic glucoamylase activity determination method of the step 3) of step 2 in the step 2 of embodiment 1.The result shows that aspergillus niger (Aspergillus niger) WW1CGMCC No.2841 thermophilic glucoamylase enzyme is lived and is 3000U/ml.
The zymologic property research of embodiment 3, saccharifying enzyme
1, the detection of optimal pH
With the further preliminary study recombinase active of fermented supernatant fluid of engineering bacteria aspergillus niger (Aspergillus niger) WW1 CGMCC No.2841 and the relation of pH, get the nutrient solution supernatant liquor of positive transformant fermentation 140h, the pH value of change damping fluid (pH2.3~pH7.0), the mensuration enzyme is lived, all the other conditions of enzyme activity determination are carried out according to the described thermophilic glucoamylase activity determination method of the step 3) of step 2 in the step 2 of embodiment 1, enzyme soprano's alive relative enzyme work is decided to be 100%, and remaining enzyme is lived and the highest enzyme is lived, and ratio is that its relative enzyme is lived.
The result as shown in Figure 3, the optimal pH of recombinase is 6.0 as seen from Figure 3.At present the optimum pH of the alpha-amylase that uses during starch liquefacation in the alcohol industry production also be pH6.0, as using this enzyme can save accent one step of pH when the saccharification, provides cost savings.
2, the detection of enzyme reaction temperature
Culture supernatant with the positive transformant 140h of shake-flask culture, measuring enzyme under different temperature of reaction lives, all the other conditions of enzyme activity determination are carried out according to the described thermophilic glucoamylase activity determination method of the step 3) of step 2 in the step 2 of embodiment 1, enzyme soprano's alive relative enzyme work is decided to be 100%, and remaining enzyme is lived and the highest enzyme is lived, and ratio is that its relative enzyme is lived.
The result as shown in Figure 4, the detected result of recombinase optimum temperuture shows (Fig. 4): the optimum temperuture of recombinase is 90 ℃, still has activity in the time of 100 ℃.Its optimum temperuture is close with the fire resistant alpha-diastase that derives from Bacillus licheniformis that industry is at present used always, as uses this recombinase to be used for alcohol industry and can lower the temperature when Mashing process, has saved the energy.
3, enzyme stability detects
Get the culture supernatant of the positive transformant 140h of shake-flask culture, under 60 ℃, 80 ℃ and 100 ℃, be incubated 0,10,20,30 respectively, 60min, rapid cool to room temperature, measuring the activity of residual enzyme according to the described thermophilic glucoamylase activity determination method of the step 3) of step 2 in the step 2 of embodiment 1, is 100% with the enzyme work of uninsulated enzyme liquid.It is that relative enzyme is lived that remaining enzyme is lived with the ratio of living with the enzyme of uninsulated enzyme liquid.
The detected result of recombinase optimum temperuture shows as shown in Figure 5: recombinase is in the time of 80 ℃, and the enzyme activity transformation period is more than 60min; 100 ℃ of enzymes are lived and are reduced comparatively fast, and enzyme activity still is higher than 60% behind the insulation 10min, and residual enzyme activity is 28% behind the insulation 60min.From this glucoamylase gene, this enzyme has glycosylation site, and has glycosylase in this Archimycetes, so may there be glycosylation in this enzyme.Optimize so be more suitable in fungal expression system, expressing.