CN107299130A - A kind of and molecular labeling chain Stigma Extrusion of Rice QTL and application - Google Patents
A kind of and molecular labeling chain Stigma Extrusion of Rice QTL and application Download PDFInfo
- Publication number
- CN107299130A CN107299130A CN201710081970.2A CN201710081970A CN107299130A CN 107299130 A CN107299130 A CN 107299130A CN 201710081970 A CN201710081970 A CN 201710081970A CN 107299130 A CN107299130 A CN 107299130A
- Authority
- CN
- China
- Prior art keywords
- stigma
- molecular labeling
- rice
- qtl
- chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of and chain Stigma Extrusion of Rice QTL molecular labeling, the QTL includes single stigma exposing ratio qSSE5, qSSE10, the qSSE11 of paddy rice, paddy rice double capital exposing ratio qDSE10, qDSE11, paddy rice total stigma exposing ratio qTSE5, qTSE6, qTSE10, qTSE11；It is RM286 with qSSE11, qDSE11, qTSE11 chain molecular labeling, is InD133 with qSSE10, qDSE10, qTSE10 chain molecular labeling, be InD94 with molecular labeling chain qTSE6, is RM3638 with qSSE5, qTSE5 chain molecular labeling；The invention also discloses the application of above-mentioned molecular labeling.The positioning of QTL based on the present invention and chain molecular labeling result, can be applied to assisting sifting paddy rice high stigma exposure rate kind.
Description
Technical field
It is more particularly to a kind of chain with Stigma Extrusion of Rice QTL the present invention relates to rice molecular genetic breeding field
Molecular labeling and application.
Background technology
Paddy rice is the important cereal crops that hundred million populations are crossed in the whole world.The hybridization of nineteen seventies China is developed in earliest
Paddy rice seeding technique, has made great progress in Rice Production in recent years.The grain brought for reply population in the world rapid growth
Food is in short supply, and it is considered as the available strategy for solving this international question to cultivate High-Yielding Hybrid Rice.By observing paddy rice extensively not
With the performance change of the stigma appearing in kind and between different cultivars, Virmani and Athwal (Virmani SS, Athwal
DS.1973.Genetic variability in floral characteristics influencing out-
Crossing in Oryza sativa L.Crop Science, 13,66-67.) stigma appearing is proposed by controlled by multiple genes
Hypothesis, in view of the character is extremely complex and easily by such environmental effects, tradition in field by directly observing stigma appearing
Rate seems that efficiency is very low to choose seeds.In recent years DNA marker technology continue to develop and linkage map foundation cause control
The detection of complex inheritance character (for example, stigma appearing etc.) quantitative trait locus (QTL) processed becomes practical, and is actually educating
Plant and be applied in work.Using different segregating populations, the qtl analysis of stigma exposing ratio can be carried out.Hybrid rice was in the past
Performed deeds of valour in battle for the lifting of rice yield within 30 years, but a still an open question is how to improve hybrid paddy rice so far
Hybrid seed yield, and stigma exposing ratio be then the hybrid paddy rice production of hybrid seeds production in a key determinant.
Paddy rice with high stigma exposure rate can capture more pollen and effectively lift hybridization by improving setting percentage
Rice hybrid seed yield.The column cap exposed can about be kept 4 days and sustainable pollination.In recent years in the technical breakthrough of DNA marker
Study and be applied in actual breeding work with the progressive genetic base for improving stigma appearing for us.For example,
9 are detected in the recombinant inbred lines assembled by long-grained nonglutinous rice IR24 and japonica rice Asominori and controls stigma appearing
QTL.In another recombinant inbred lines being derived by long-grained nonglutinous rice Pei-Kuh and wild rice W1944 (common wild-rice)
Then detect the QTL of 2 control stigma appearings.But so far, whether these QTL are used as in hybrid paddy rice maintainer something lost
Pass effective candidate gene of background and play efficiency and do not understand yet.
(Lou J, Yue G H, Yang W Q, Mei H W, Luo L J, Lu the H J.2014.Mapping QTLs such as Lou
influencing stigma exertion in rice.Bulgarian Journal of Agricultural
Science, 20,1450-1456.) using two long-grained nonglutinous rice cytoplasmic male sterility maintainers (Huhan 1B and K17B) derivatives
The F come2The QTL of colony's location control Stigma Extrusion of Rice.Shadow is have detected with a linkage map for containing 92 SSR markers
Ring the QTL of list stigma exposing ratio (SSE), double capital exposing ratio (DSE) and total stigma exposing ratio.As a result contaminated in the 5th, 6 and the 7th
1,3 and 1 QTL is detected on colour solid respectively and controls SSE, DSE and TSE respectively.Tight etc. (Yan, W.G., Li, Y.,
Agrama,H.A.,Luo,D.,Gao,F.,Lu,X.,Ren,G.(2009).Association mapping of stigma
and spikelet characteristics in rice(Oryza sativa L.).Molecular Breeding.24,
277-292.) performance using 109 DNA markers in 90 different cultivars chips, has done correlation mapping experiments, as a result table
Bright, simple repeated sequence (SSR) mark RM5 is exposed with pole significant correlation with single stigma appearing and double capital, and sends out
Wave main function.Using two segregating populations from long-grained nonglutinous rice Guangluai-4 and wild rice W1943, Lee wait (Li P,
Feng F,Zhang Q,Chao Y,Gao G,He Y.2014.Genetic mapping and validation of
quantitative trait loci for stigma exertion rate in rice.Molecular Breeding,
34,2131-2138.) report stigma exposing ratio is complicated quantitative character and by controlled by multiple genes.They further complete something lost
Pass the QTL for mapping and demonstrating control Stigma Extrusion of Rice.It is excellent by two further to parse the hereditary basis of stigma appearing
The RIL that different rice varieties (Chinese Fragrant Rice and river perfume 29B) are cultivated and come is used to detect QTL, is detected altogether in as a result 2 years
To 11 QTL, wherein detecting 2 QTL and 4 QTL on the 1st chromosome and the 6th chromosome respectively, two QTL clusters are formed, point
Wei not qSe1 and qSe6.
From the foregoing, it will be observed that the QTL researchs of control Stigma Extrusion of Rice play an important role the hybrid seed yield to hybrid paddy rice,
Accordingly, it would be desirable to further excavate correlation QTL.
The content of the invention
The technical problem to be solved in the present invention is to provide it is a kind of with chain Stigma Extrusion of Rice QTL molecular labeling and its
Using.
In order to solve the above technical problems, the present invention is adopted the following technical scheme that：
A kind of and chain Stigma Extrusion of Rice QTL molecular labeling, it is single that the Stigma Extrusion of Rice QTL includes paddy rice
The stigma exposing ratio qSSE11 and total stigma exposing ratio qTSE11 of paddy rice；The molecular labeling is SSR molecular marker RM286, described
Molecular labeling RM286 sense primer is CTGGCCTCTAGCTACAACCTTGC (shown in SEQ ID No.1), and anti-sense primer is
AAACTCTCGCTGGATTCGATAGG (shown in SEQ ID No.2).
Further, the Stigma Extrusion of Rice QTL also includes the single stigma exposing ratio qSSE10 of paddy rice, paddy rice double capital
Exposing ratio qDSE10, qDSE11, and the total stigma exposing ratio qTSE10 of paddy rice；The molecular labeling RM286 and described qDSE11
Chain, described molecular labeling also includes the molecular labeling InD133 chain with qSSE10, qDSE10, qTSE10, the molecule
The sense primer for marking InD133 is AATTCTTATGGACGGATACGC (shown in SEQ ID No.3), and anti-sense primer is
TCAGCATCTCGTAAGCAAAAA (shown in SEQ ID No.4).
Further, the Stigma Extrusion of Rice QTL also includes the total stigma exposing ratio qTSE6 of paddy rice；Described molecule
Mark also includes the molecular labeling InD94 chain with qTSE6, and the sense primer of the molecular labeling InD94 is
GGCATTGTAGCCAATCCAGA (shown in SEQ ID No.5), anti-sense primer is AAACACACTCCCCCATGAGA (SEQ ID
Shown in No.6).
Further, the Stigma Extrusion of Rice QTL also includes the single stigma exposing ratio qSSE5 of paddy rice, the total column cap of paddy rice
Exposing ratio qTSE5；Described molecular labeling also includes the molecular labeling RM3638 chain with qSSE5, qTSE5, the molecule mark
The sense primer for remembering RM3638 is CAGATCCATCCAAGCGAGAGTACG (shown in SEQ ID No.7), and anti-sense primer is
ATAGCGAGGAGGAAGAGGAGGAGAGG (shown in SEQ ID No.8).
Present invention also offers it is a kind of detect Stigma Extrusion of Rice kit, its contain it is above-mentioned with outside Rice Stigma
Molecular labeling chain dew rate QTL.
Present invention also offers above-mentioned and chain Stigma Extrusion of Rice QTL molecular labeling in assisting sifting paddy rice Gao Zhu
Application in head exposing ratio.
The present invention using the association green grass or young crops morning B with high stigma exposure rate as donor, in low stigma exposing ratio extensive 9308 for by
Body, sets up the chromosome segment substitution line (CSSL) of 75 strains, and to QTL positioning.In Zhejiang, two, Hainan environment respectively
To 3 characters related to flowering habit of CSSL crowd surveillances, including single stigma exposing ratio (SSE), double capital exposing ratio (DSE)
And total stigma exposing ratio (TSE).Also, detect the QTL of control stigma appearing.Positioning of the invention by above-mentioned QTL,
The molecular labeling chain with each QTL is found, the hybridization of high stigma exposure rate by molecular mark (MAS), can be selected
Rice production of hybrid seeds kind, will be helpful to improve paddy rice outcrossing seed-setting rate, and then can carry by improving the stigma exposing ratio of production of hybrid seeds kind
The hybrid seed yield of high hybrid paddy rice；The present invention is also that finely positioning from now on and gene cloning provide Research foundation.
Brief description of the drawings
Above-mentioned is only the general introduction of technical solution of the present invention, in order to better understand the technological means of the present invention, below
With reference to accompanying drawing, the present invention is described in further detail with embodiment.
Fig. 1 is extensive 9308CSSL informative populations process and step in 75 strains association blue or green morning B X；
Fig. 2 is morphology and stigma appearing phenotypic map；Wherein, extensive 9308 phytomorph (left side) and association plant blue or green morning B in (A)
Extensive 9308 stigma appearing phenotype (left, column cap is the color of brown, so invisible) and the blue or green morning B posts of association in thing form (right side), (B)
Exposed phenotype (right side)；(C) the stigma appearing phenotypic map in small ear；
Fig. 3 is the histogram of CSSL colonies SSE, DSE and TSE in Hainan and Zhejiang Environment；Wherein, unidirectional arrow
In being shown respectively with four-headed arrow extensive 9308 and association's blue or green morning B average value；
Fig. 4 be implemented in association's blue or green morning B and in extensive 9308 CSSL colonies in list stigma exposing ratio (SSE), double capital it is exposed
The QTL chromosome mapping figures of rate (DSE) and total stigma exposing ratio (TSE)；Wherein triangle, square and circle are represented respectively
SSE, DSE and TSE QTL positioning.
Embodiment
1 materials and methods
1.1 plant material
As shown in figure 1, using association's blue or green morning B and in extensive 9308 respectively as Parent, then by a series of selfing and time
Hand over the chromosome segment substitution line (CSSL) for building 75 strains, wherein association green grass or young crops morning B has a high stigma exposure rate, and in extensive 9308 have
There is low stigma exposing ratio.
1.2 field test
The CSSL and Parent of 75 strains are planted in Hainan Island Lingshui and Fuyang, Zhejiang China Paddy Rice Inst base respectively,
It is seeded in Lingshui on December 20th, 2014, is seeded in Fuyang on June 15th, 2015.Per 6 row of strain, 8 plants of plantations, 30cm*20cm rows
Spacing.Standard field management.
1.3 characters are detected
Stigma appearing can be divided into 3 characters：Single stigma exposing ratio (SSE), double capital exposing ratio (DSE) and total stigma appearing
Rate (TSE).Sampled respectively from Parent and each strain plant after blooming 5-7 days, respectively take 5 tassels, small the flowers are in blossom in bottommost
Just start observation after spending.The calculation formula of stigma exposing ratio uses below equation：
SSE (%)=[SSE/ (SSE+DSE+ is without stigma appearing)] × 100
DSE (%)=[DSE/ (SSE+DSE+ is without stigma appearing)] × 100
TSE (%)=SSE (%)+DSE (%)
Wherein, Fig. 2 show morphology and stigma appearing phenotypic map；Wherein, in (A) extensive 9308 phytomorph (left side) and
The blue or green morning B phytomorphs (right side) of association, in (B) extensive 9308 stigma appearing phenotype (left side, column cap is the color of brown, so invisible) and
The blue or green morning B stigma appearings phenotype (right side) of association；(C) the stigma appearing phenotypic map in small ear.
1.4 genetic map constructions and qtl analysis
87 SSR markers and 33 InDel mark are analyzed, is showed between Parent and polymorphic applies the tag to CSSL colonies
In.With multiple and Interval Mapping (CIM), QTL is detected using software QTL ciMapping4.0 softwares (king 2009), works as LOD value
>=2.50 and P≤0.05, it is assumed that detect a QTL.Contribution rate (H2) ratio of estimate variance is divided on total phenotypic variation
Epistatic analysis and additive effect.QTL titles are named (McCouch 2008) according to standard.
2 results
2.1CSSL colonies and its stigma exposing ratio of two parents
Phenotypic data analysis display, parent association green grass or young crops morning B (XQZB) and in extensive 9308 (ZH9308) plant plant in Zhejiang
Its SSE, DSE and TSE are all higher than planting the plant in Hainan；And its double capital exposing ratio display statistics only in XQZB parents
Significant difference (table 1) on.In CSSL colonies, SSE, DSE and TSE numerical value of Zhejiang plant are all higher than the number of Hainan plant
Value, and SSE and TSE significant differences.But DSE does not show significant difference in the environment of two places.SSE, DSE in CSSL colonies
Distinguish with TSE highest numerical value：Hainan 32.71,5.36,38.07；Zhejiang 29.73,5.14 and 34.87.Coordinate shown in Fig. 3, its
Middle SSE (Fig. 3 A) and TSE (Fig. 3 C) performance continuous variations simultaneously show normal distribution in two environment.In addition, all characters
Inclined separation is observed.
The CSSL colonies of table 1 and the performance of parent's stigma exposing ratio
*, conspicuousness is in 0.05 level；SSE, single stigma exposing ratio；DSE, double capital exposing ratio；TSE, total stigma appearing
Rate；± SE, standard error.
In respective environment, SSE, DSE and TSE show significant correlation.Highest phenotype correlation under the environment of Hainan
(r=0.997 is resulted between HSSE and HTSE**), followed by (r=0.890 between HDSE and HTSE**), it is again HSSE
(the r=0.852 between HDSE**)；And highest correlation then comes across between ZJSSE and ZJTSE (r=under Zhejiang Environment
0.996**), followed by (r=0.889 between ZJDSE and ZJTSE**), it is again (r=between ZJSSE and ZJDSE
0.844**), refer in table 2.The plant that result above shows SSE and has bigger numerical value is more likely entered by lifting DSE numerical value
And finally improve TSE numerical value.
75 strain CSSL colonies coefficient correlations derived from extensive 9308 with of blue or green morning B are assisted in the Hainan of table 2 and Zhejiang two places environment
(Pearson's index)
**Conspicuousness correlation is in 0.01 level；HSSE, Hainan list stigma exposing ratio；HDSE, Hainan double capital exposing ratio；
HTSE, the total stigma exposing ratio in Hainan；ZJSSE, Zhejiang list stigma exposing ratio；ZJDSE, Zhejiang double capital exposing ratio；ZJTSE, Zhejiang
The total stigma exposing ratio in river.
2.2 variance analyses and environmental fluctuating
Variance analysis (ANOVA) based on fixed-effect model shows CSSL colonies (Hainan and Zhejiang between two environment
River) there is pole significant difference.All characters increase (table 3) in Zhejiang Environment.Obviously, Zhejiang Environment is conducive to improving post
Head exposing ratio.
ANOVA result of 75 CSSL colonies based on fixed-effect model in 3 liang of environment of table
***, it is extremely notable in 0.001 level；OK, CSSL colonies；Environment, Hainan and Zhejiang；MS, just.
2015 are collected respectively in Hainan and Zhejiang 3,4, May and 8,9, the temperature information in October.Hainan and Zhejiang are remembered
The presentation of information 3-8 months, the 4-9 months and the 5-10 months of record have significant difference (table 4).
The comparative studies of 4 liang of environment of table (Zhejiang and Hainan) moon temperature
* is extremely notable in 0.01 level；* * are extremely notable in 0.001 level；± SE, standard error.
The qtl analysis of 2.3 stigma exposing ratios
9 QTL are detected in two environment altogether, chromosome 5,6,10 and 11 are distributed in respectively, LOD value is in 2.74 and 6.33
Between (table 5).Phenotypic variation can be explained between 12.26% to 25.44% in each QTL.For example, on chromosome 5,10,11
Single stigma exposing ratio SSE QTLqSSE5, qSSE10 and qSSE11 is detected respectively.QTLqSSE5 can be solved under Zhejiang Environment
Release 13.03% phenotypic variation, allele come from ZH 9308, tool 2.32 negative sense additive effect.QSSE10 and qSSE11
Be detected under two environment, can be explained under the environment of Hainan 21.03 and 13.99% phenotypic variation, and in Zhejiang ring
Under border then can be explained 20.01 and 18.79% phenotypic variation, allele is both from QXZB, under Hainan and Zhejiang Environment
There is 12.04 and 3.29, and 5.62 and 3.19 additive effect respectively.For double capital exposing ratio, the He of chromosome 10
QDSE10 and qDSE11 is detected on 11 respectively, and is detected in Hainan and Zhejiang two places environment.Lower point of Hainan environment
Not Xie Shi 25.44% and 22.04% phenotypic variation, and then explained under Zhejiang Environment 21.53% and 12.26% phenotype become
It is different.Two QTL action sites have 2.21 and 1.20 and 1.95 Hes both from QXZB and under Hainan and Zhejiang Environment respectively
0.86 additive effect.Detect 4 QTL altogether on chromosome 5,6,10 and 11 and control total stigma exposing ratio.Wherein qTSE5
13.04% phenotypic variation rate can be explained under Zhejiang Environment, allele comes from ZH9308, with 4.63 negative sense additivity effect
Should.QTSE6 is detected under the environment of Hainan, explains 17.60% phenotypic variation, action site comes from XQZB, with 14.44
Positive additive effect.QTSE10 and qTSE11 is detected in the environment of two places, and 22.45 Hes are explained under the environment of Hainan
13.99% phenotypic variation, under Zhejiang Environment explain 20.01 and 18.80% phenotypic variation, allele both from
XQZB, respectively with 14.25 and 6.59 and 11.24 and 6.37 additive effect.It is interesting that major part QTL is focused on
In 3 regions on chromosome 5,10 and 11, only TSE QTL is found on chromosome 6 (Fig. 4).Therefore, this 3 regions can
The candidate genetic fragment of stigma exposing ratio is controlled as XQZB and ZH9308.
The QTL that table 5 is detected in the CSSL colonies for being implemented in XQZB and ZH9308 that Hainan and Zhejiang two places are detected
A, QTL additive effect；PVE, the phenotypic variation that each QTL is explained；LOD, logarithm multiplier value；QSSE, single-column head
The QTL of exposing ratio；QDSE, the QTL of double capital exposing ratio；QTSE, the QTL of total stigma exposing ratio.
2.4 epistasis and environment interaction
The present invention detects the interaction (table 6) in 4 sites altogether.3 betide between notable main effect, a generation
Between non-main effect.
Table 6 is mutually performed an analysis using IC IMapping softwares double sites and detects epistatic analysis and environment interaction effect,
LOD value is 5.0.
LOD, logarithm multiplier value；PVE, single QTL explains phenotypic variation；Add, single QTL additive effects；M (QQ), QQ's
QTL genotype means (XQZB genotypic markers are 2)；M (qq), qq QTL genotype means (ZH9308 genotypic markers
For 0).
3 discuss
The invention discloses the QTL of stigma exposing ratio in two varying environments.The exposed column cap of duration of flowering is very fragile
And (for example, wind, hydraulic pressure or mechanical damage) can be damaged easily by environmental condition.In the present invention, we are directed to conventional research side
Method, it is proposed that several new detection means and method, in conventional research, florescence collects tassel in order to avoid damaging exposed column cap
And ensure data accuracy, and then collect tassel after blooming 7-10 days in other researchs.Although some column caps are very fragile,
But it was noticed that still there are many gynoeciums still to bloom in the watery stage.In the present invention, after the small tassel blossom in bottom 5-7 days, respectively
5 main fringes and CSSL of Parent are collected per 5 main fringes of strain.In Hainan and two, Zhejiang environment, the temperature in florescence
With significant difference (table 4).CSSL colonies in two environment show height in the ANOVA analyses based on fixed-effect model
Significant difference (table 3).Compared with Hainan, all characters increased (table 1) under Zhejiang Environment.Data above shows, Zhejiang
Envirment factor be more beneficial for improve stigma exposing ratio.In the QTL detected, have under two environment 6 QTL be it is stable,
And it is unstable to have 3, due to by environmental influence, such as temperature, wind, hydraulic pressure and mechanical injuries.
4 marks of common location of the present invention control stigma exposing ratio, be respectively：RM3638 (the SEQ ID of No. 5 chromosome
No.7, shown in 8) it is chain with qSSE5, qTSE5；The InD94 (SEQ ID No.5,6 shown in) of No. 6 chromosome is chain with qTSE6；
The InD133 (SEQ ID No.3,4 shown in) of No. 10 chromosome is chain with qSSE10, qDSE10, qTSE10；And 11 chromosome
RM286 (SEQ ID No.1,2 shown in) it is chain with qSSE11, qDSE11, qTSE11.
Table 6 is shown detects 4 epistatic interactions altogether in this research, 3 are located between major gene resistance, and 1 is located at minor effect
Between gene.QTL with big effect value has been confirmed as the valuable source of Inheritance of Quantitative Characters improvement.In the present invention, the 11st
The chain cluster of the numerous QTLs chain with RM286 (such as qSSE11, qDSE11, and qTSE11 etc.) formation on chromosome；10th dyeing
Mark I nD133 and numerous QTL (such as qSSE10, qDSE10, and qTSE10) on body are chain, form the chain clusters of QTL.SSE、
Between DSE and TSE there is strong positive correlation to act on.
4 conclusions
We detect 9 QTL, wherein qSES5, qSSE10, qSSE11 altogether on chromosome 5,6,10,11,
QDSE10, qDSE11, qTSE5, qTSE6, qTSE10and qTSE11 control single stigma exposing ratio (SSE) double capital exposed respectively
Rate (DSE) and total stigma exposing ratio (TSE).6 QTL detected in Hainan and Zhejiang two places environment (qSSE10,
QSSE11, qDSE10, qDSE11, qTSE10 and qTSE11), 1 is only found in Hainan (qTSE6), and 2 are found in Zhejiang
(qSSE5and qTSE5).SSE, DSE and TSE are with a kind of strong interaction of environmental factor dependence mode.qSSE10,qSSE11,
QDSE10, qDSE11, qTSE6, qTSE10 and qTSE11 allele come from association's blue or green morning B, show positive additive effect,
And qSSE5 and qTSE5 allele shows negative sense additive effect extensive 9308 in coming from.Stigma appearing is for different colored selfing
For paddy rice effect, preferably single, double and total stigma appearing is separately considered, further to inquire into how in genetic improvement from now on
Realize the production-increasing function of hybrid rice seed.
In summary, positioning result of the invention and obtained molecular labeling result will be helpful to the thin of high stigma exposure
Cytoplasm male sterility line is applied in hybrid paddy rice production of hybrid seeds production.
Sequence table
<110>China Paddy Rice Inst
<120>A kind of and molecular labeling chain Stigma Extrusion of Rice QTL and application
<160> 8
<210> 1
<211> 23
<212> DNA
<213>Artificial sequence（RM286 sense primers）
<400> 1
ctggcctcta gctacaacct tgc 23
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence（RM286 anti-sense primers）
<400> 2
aaactctcgc tggattcgat agg 23
<210> 3
<211>21
<212> DNA
<213>Artificial sequence（InD133 sense primers）
<400> 3
aattcttatg gacggatacg c 21
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence（InD133 anti-sense primers）
<400> 4
tcagcatctc gtaagcaaaa a 21
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence（InD94 sense primers）
<400> 5
ggcattgtag ccaatccaga 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence（InD94 anti-sense primers）
<400> 6
aaacacactc ccccatgaga 20
<210> 7
<211> 24
<212> DNA
<213>Artificial sequence（RM3638 sense primers）
<400>7
cagatccatc caagcgagag tacg 24
<210> 8
<211> 26
<212> DNA
<213>Artificial sequence（RM3638 anti-sense primers）
<400>8
atagcgagga ggaagaggag gagagg 26
Claims (7)
1. a kind of and chain Stigma Extrusion of Rice QTL molecular labeling, it is characterised in that the Stigma Extrusion of Rice QTL
Including paddy rice list stigma exposing ratio qSSE11 and the total stigma exposing ratio qTSE11 of paddy rice；
The molecular labeling is SSR molecular marker RM286, and the sense primer of the molecular labeling RM286 is
CTGGCCTCTAGCTACAACCTTGC, anti-sense primer is AAACTCTCGCTGGATTCGATAGG.
2. according to claim 1 and chain Stigma Extrusion of Rice QTL molecular labeling, it is characterised in that the water
Rice stigma exposing ratio QTL also includes paddy rice single stigma exposing ratio qSSE10, paddy rice double capital exposing ratio qDSE10, qDSE11, and
The total stigma exposing ratio qTSE10 of paddy rice；
The molecular labeling RM286 and described qDSE11 are chain, described molecular labeling also include with qSSE10, qDSE10,
Molecular labeling InD133 chain qTSE10, the sense primer of the molecular labeling InD133 is
AATTCTTATGGACGGATACGC, anti-sense primer is TCAGCATCTCGTAAGCAAAAA.
3. according to claim 1 or 2 and chain Stigma Extrusion of Rice QTL molecular labeling, it is characterised in that described
Stigma Extrusion of Rice QTL also includes the total stigma exposing ratio qTSE6 of paddy rice；
Described molecular labeling also includes the molecular labeling InD94 chain with qTSE6, and the upstream of the molecular labeling InD94 is drawn
Thing is GGCATTGTAGCCAATCCAGA, and anti-sense primer is AAACACACTCCCCCATGAGA.
4. according to claim 1 or 2 and chain Stigma Extrusion of Rice QTL molecular labeling, it is characterised in that described
Stigma Extrusion of Rice QTL also includes the single stigma exposing ratio qSSE5 of paddy rice, the total stigma exposing ratio qTSE5 of paddy rice；
Described molecular labeling also includes the molecular labeling RM3638, the molecular labeling RM3638 chain with qSSE5, qTSE5
Sense primer be CAGATCCATCCAAGCGAGAGTACG, anti-sense primer is ATAGCGAGGAGGAAGAGGAGGAGAGG.
5. according to claim 3 and chain Stigma Extrusion of Rice QTL molecular labeling, it is characterised in that the water
Rice stigma exposing ratio QTL also includes the single stigma exposing ratio qSSE5 of paddy rice, the total stigma exposing ratio qTSE5 of paddy rice；
Described molecular labeling also includes the molecular labeling RM3638, the molecular labeling RM3638 chain with qSSE5, qTSE5
Sense primer be CAGATCCATCCAAGCGAGAGTACG, anti-sense primer is ATAGCGAGGAGGAAGAGGAGGAGAGG.
6. it is a kind of detect Stigma Extrusion of Rice kit, it is characterised in that containing described in claim any one of 1-5 with
Molecular labeling chain Stigma Extrusion of Rice QTL.
7. the molecular labeling chain with Stigma Extrusion of Rice QTL described in claim any one of 1-5 is in assisting sifting paddy rice
Application in high stigma exposure rate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710081970.2A CN107299130B (en) | 2017-02-15 | 2017-02-15 | Molecular marker linked with rice stigma exposure rate QTL and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710081970.2A CN107299130B (en) | 2017-02-15 | 2017-02-15 | Molecular marker linked with rice stigma exposure rate QTL and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107299130A true CN107299130A (en) | 2017-10-27 |
| CN107299130B CN107299130B (en) | 2021-02-26 |
Family
ID=60137828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710081970.2A Active CN107299130B (en) | 2017-02-15 | 2017-02-15 | Molecular marker linked with rice stigma exposure rate QTL and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107299130B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207621A (en) * | 2018-09-30 | 2019-01-15 | 上海市农业生物基因中心 | The molecular labeling and its methods and applications of Stigma Extrusion of Rice gene qSE7 |
| CN109504792A (en) * | 2018-12-14 | 2019-03-22 | 浙江大学 | One kind molecular labeling relevant to rice stigma exposure and its screening technique and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178560A (en) * | 2013-12-19 | 2014-12-03 | 国家粳稻工程技术研究中心 | Molecular marking method of rice stigma exsertion major QTL sites |
| WO2016193953A1 (en) * | 2015-06-05 | 2016-12-08 | International Rice Research Institute | Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods |
-
2017
- 2017-02-15 CN CN201710081970.2A patent/CN107299130B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178560A (en) * | 2013-12-19 | 2014-12-03 | 国家粳稻工程技术研究中心 | Molecular marking method of rice stigma exsertion major QTL sites |
| WO2016193953A1 (en) * | 2015-06-05 | 2016-12-08 | International Rice Research Institute | Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods |
Non-Patent Citations (2)
| Title |
|---|
| 冯玲玲等: "水稻柱头外露率的QTL分析", 《北方水稻》 * |
| 李威等: "粳稻柱头外露率QTL定位", 《中国水稻科学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207621A (en) * | 2018-09-30 | 2019-01-15 | 上海市农业生物基因中心 | The molecular labeling and its methods and applications of Stigma Extrusion of Rice gene qSE7 |
| CN109504792A (en) * | 2018-12-14 | 2019-03-22 | 浙江大学 | One kind molecular labeling relevant to rice stigma exposure and its screening technique and application |
| CN109504792B (en) * | 2018-12-14 | 2021-02-26 | 浙江大学 | Molecular marker related to rice stigma exsertion as well as screening method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107299130B (en) | 2021-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bo et al. | Molecular mapping reveals structural rearrangements and quantitative trait loci underlying traits with local adaptation in semi-wild Xishuangbanna cucumber (Cucumis sativus L. var. xishuangbannanesis Qi et Yuan) | |
| CN106069720B (en) | The method of rape dihaploid induction system selection and breeding cabbage type rape variety and material | |
| Mujeeb-Kazi et al. | Utilizing wild grass biodiversity in wheat improvement: 15 years of wide cross research at CIMMYT | |
| Goswami et al. | Genetic potentiality of indigenous rice genotypes from Eastern India with reference to submergence tolerance and deepwater traits | |
| CN106857232A (en) | Method and application using hero wild rice vegetative propagation characteristic hybrid vigor fixing long | |
| WO2020113979A1 (en) | Cultivation method for novel interspecific hybrid downy mildew resistant cucumis sativus variety and use thereof | |
| Kaya | Sunflower | |
| CN110117599A (en) | Brassica Napus sulfonylurea herbicide mutated gene and application | |
| CN111543310A (en) | Method for breeding by using rice indica subspecies cross/doubled tetraploid recombinant inbred line | |
| Chen et al. | Somaclonal variation: an important source for cultivar development of floriculture crops | |
| CN107299130A (en) | A kind of and molecular labeling chain Stigma Extrusion of Rice QTL and application | |
| CN104313150B (en) | Chrysanthemum aphid resistance association molecular labeling, screening technique and application | |
| CN105734057B (en) | With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage | |
| Yin et al. | Breeding for climate resilience in castor: Current status, challenges, and opportunities | |
| CN105830907A (en) | Genic male sterile line of radish and breeding method thereof | |
| Gupta et al. | Lens | |
| Tang et al. | Comparison of QTLs for early elongation ability between two floating rice cultivars with a different phylogenetic origin | |
| CN106069721B (en) | The method of rape dihaploid induction system selection and breeding turnip type rape kind and material | |
| CN104642092A (en) | Selection method for onion male sterility maintainer line | |
| Nakano et al. | Quantitative trait loci (QTL) controlling plant architecture traits in a Solanum lycopersicum× S. pimpinellifolium cross | |
| CN109006456A (en) | A kind of selection of pimento genic male sterility dual purpose | |
| CN104542258B (en) | The method of structure polyploid rice PMeS NILs is returned using throwback | |
| Nguyen et al. | Development and molecular characterization of a doubled haploid population derived from a hybrid between japonica rice and wide compatible indica rice | |
| Guan et al. | Feature of blast resistant near-isogenic lines using an elite maintainer line II-32B by marker-assisted selection | |
| Nimura et al. | Interspecific hybrid production by reciprocal crosses between Dianthus caryophyllus L. and Dianthus× isensis Hirahata et Kitamura |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |