CN105830907A - Genic male sterile line of radish and breeding method thereof - Google Patents

Abstract

The invention relates to the technical field of breeding of crops and especially discloses a genic male sterile line of a radish and a breeding method thereof. The genic male sterile line of the radish is characterized in that the sterile line is a male sterile line controlled by a pair of recessive genic genes; the inheritance of fertility of the line is stable and not influenced by factors like environment; development of gynoecia is normal, stamens completely degenerate, and effective pollen does not exist; and the line is preserved in China Center for Type Culture Collection, Wuhan University, Hubei Province, China on October 26th, 2014, with an accession number of P201411 and is classified and named as 136 S. The genic male sterile line and the breeding method thereof in the invention make a breakthrough to limitation to the type of cytoplasmic male sterility in conventional male sterile lines of the radish and open up a novel approach for breeding of male sterile lines of the radish; and the discovered genic male sterile line is of great significance to overcoming of the problem of a single gene of the male sterile lines of the radish.

Description

A kind of Radix Raphani genie male sterile line and selection thereof

(1) technical field

The present invention relates to technical field of crop propagation, particularly to a kind of Radix Raphani genie male sterile line and selection thereof.

(2) background technology

Male sterility generally exists in high animals and plants, and according to statistics, people at least find in 617 kinds and interspecific hybrid Male sterility phenomenon, it is distributed in the plants of 162 genus of 43 sections, almost covers all of raise crop.

Crucifer is mostly allogamy crop, there is obvious hybrid vigor, but due to their floral organ Less, artificial emasculation operation is wasted time and energy, and the hybrid seed obtained of once pollinating is little, for solving this problem, and breeding work Author selects self incompatible line breeding, but self incompatible line is easily affected by factors such as environment, and affinity is unstable, often The phenomenon that seed production purity is the highest occurs.Utilize male sterility line of plants to carry out hybrid seeding, preferably solve selfing the most affine Being the problem of the production of hybrid seeds, and can improve the purity of hybrid seed, increasing the yield of crops, oneself becomes the main development of international seed industry Direction.Radish male sterile breeding is to conduct a research relatively early, and carries out the technology that commercial applications is more ripe.

The radish male sterile used on producing at present, it is common that the most mutual by plasmagene and cell nucleus gene Making, a kind of male sterility phenomenon of formation, the sterile cytoplasm of Radix Raphani typically has Ogura-CMS (orf138), Kos-CMS (orf125), the type such as DCGMS-CMS and NWB-CMS, but the modal or sterile type of Ogura；By mitochondrial gene Two pairs of recessive genes in orf138 and nucleus control, and sterile line genotype is S_ms1ms1ms2ms2, holding is that genotype is N_ms1ms1ms2ms2, (S is sterile type Cytoplasm, and N is normal cell matter).Radix Raphani male sterility shows as Anther degeneration, or can not shape Become there is the pollen of normal function, and Stamen development is normal.Keeping system then to have the most male and female organ, selfing can be just The most solid, when hybridizing with sterile line, it is possible to keep the sterility of sterile line.

Male sterile with radish cytoplasm gene is present on mitochondrial DNA, mainly due to mitochondrial genome intramolecular or The abnormal mosaic gene that intermolecular frequent restructuring is formed causes, and research at present is thought, Ogura is sterile, and type is male sterile Master genes is the gene corotation record in orf138, orf138 and mitochondrial genome with normal function, produces aberrant transcription This and translation product, thus disturb mitochondrial normal function to play in certain period of anther development, ultimately result in male not Educate the generation of phenomenon.Although the transcription and translation product of mitochondrial genome only accounts for little portion of whole cellular genome product Point, but its transcription and translation situation is more complicated.When hybridizing with sterile line by restorer, the Restore gene in restorer A kind of PPR albumen, the expression of this albumen suppression orf138 can be produced, thus reach the purpose of fertility restorer.

Up to the present, in known Radix Raphani male sterility type, Ogura male sterility is introduced into rate and stability aspect Outstanding sterile material, Ogura male sterility is also to study the most deep a kind of male sterile material, Japanology at present simultaneously Ogura male sterility gene orf138, by checking order the sterile material such as wild species, cultigen, is divided by person Yamagishi It is nine types (such as following table).Studying according to relevant information, A type and F type have identical recovery and holding relation, despite alkali Base variation result in aminoacid and there occurs change, but passes through verification experimental verification at present, it is possible to clearly cause male sterile have A, B, D, F, H type, other type need checking.

Note: Δ in table^aHurdle "+" it is 39 base pairs of disappearance in gene；In Orf138 type, A is the order-checking found the earliest Sequence；In other hurdle " " " for be not changed in A type.

After Japan finds Ogura, China successively finds Radix Raphani male sterile plant from the beginning of the seventies in last century, has started Radix Raphani The breeding work of male sterility line, has successively brought out multiple kind and has promoted on producing, such as the Shandong in Shandong to the mid-80 Radix Raphani No. three, red rich No. one of Liaoning, state's light in Shanxi, Feng Guang, the kind such as Zheng Yan in Henan.

Along with the development of biotechnology, Radix Raphani Ogura male sterility gene is successively incorporated into oil by scientific worker On the multiple crop in cruciferae such as dish, Caulis et Folium Brassicae capitatae, Chinese cabbage, Brassica oleracea L. var. botrytis L..China have now been found that and the radish male sterile that uses with Sample is Ogura cytoplasmic male sterility, and the radish male sterile almost all used in current worldwide is that Ogura is thin Kytoplasm type, along with male sterile material use more and more universal, the cytoplasm type of Radix Raphani and other crop in cruciferae will Serious unification.

In Cruciferae, nuclear male sterility phenomenon to be lacked relative to cytoplasmic male sterility, the most only in DABAI The natural population of the crops such as dish, Caulis et Folium Brassicae capitatae, Brassica campestris L, Plantula Brassicae chinensis is found that dominant or recessive nucleus male sterility material.Such as Nanjing agriculture Sparetime university learns and finds nuclear male sterility material the eighties in last century in Plantula Brassicae chinensis, and utilizes " dual purpose lines " to carry out hybridization system Kind；Fujian Academy finds kernel male sterile material in local Brassica campestris L. ssp.chinensis kind " the seven leaf hearts ", and obtains male sterility two With being；Agricultural University Of Shenyang obtains Recessive male sterile gene material in little Qing Kou, two Qing Gang's Chinese cabbage cultivars；Shenyang The institute of agricultural sciences of city is found that Dominant male sterile gene material in " the ten thousand spring Qing Gangs " local Chinese cabbage cultivar, and proposes " aobvious Property nuclear gene male sterility and dominant epistatic gene interaction " male sterility hereditary pattern, be finally obtained and there is 100% sterile rate Male sterile line of cabbage；The Chinese Academy of Agricultural Sciences is found that the male sterility that dominant karyogene controls in the natural population of Caulis et Folium Brassicae capitatae Material.In the research of Radix Raphani, the report of the domestic male sterile material also not finding to be controlled by karyogene in natural population Road.

(3) summary of the invention

The present invention is in order to make up the deficiencies in the prior art, it is provided that a kind of widening utilizes scope, avoids Cytoplasm Single-issue Radix Raphani genie male sterile line and selection thereof.

The present invention is achieved through the following technical solutions:

A kind of Radix Raphani genie male sterile line, it is characterised in that: described sterile line be by a pair recessive nuclear gene control male Sterile line, its fertility inheritting is stable, is not affected by factors such as environment, and Stamen development is normal, and stamen is degenerated completely, without effectively flower Powder, its preserving number is CCTCC No:P201411, and depositary institution is China typical culture collection center, and address Wuhan, China is military Chinese university, preservation date is on October 26th, 2014, and Classification And Nomenclature is radish male sterile 136S Raphanus sativus L.。

The selection of Radix Raphani genie male sterile line of the present invention, comprises the steps:

(1) with male sterile plant as female parent, carrying out test cross with the fertile plant in same natural population for male parent, this male parent is certainly simultaneously Hand over；

(2) seed of test cross and selfing gained is carried out vernalization treatment, by the planting seed after vernalization in isolation solarium, treat Post flowering, carries out observing statistics to the male sterility situation of filial generation；

(3) with the sterile plant of test cross offspring as female parent, fertile plant is that male parent hybridizes；Simultaneously can with what there is normal cell matter Educating strain is female parent, hybridizes with the fertile plant in test cross offspring for male parent；

(4) being seeded in after vernalization treatment in isolation solarium by the seed of hybridization results, Post flowering carries out fertility investigation, determines Sterile plant in seed is the male sterility line that nucleus controls；

(5) checked order by transcript profile, have found the exclusive genetic transcription group of male sterility line, and design primer cDNA and carry out PCR verifies, it is thus achieved that 4 mRNA that male sterility line is exclusive.

The more excellent technical scheme of the present invention is:

In step (1), local varieties natural population finds male sterile plant, uses Ogura special primer: ORF-F 5'- TTCAAATCCTGTCCCCGCACC-3', and ORF-R 5'-GCCTTACACCATTGGGATACTTC-3', to sterile material blade DNA carries out PCR molecular marker, specific band does not occur, illustrates that this sterile material does not contains Ogura male sterility gene, It is not belonging to normally used Ogura cytoplasmic male sterility type.

In step (2), every part of the seed of test cross and selfing gained is taken 50, with the warm water soaking 3 hours of 35 DEG C, then Put in paper substrate culture dish, after Seed sprouting, put into and the refrigerator of 2-4 DEG C carries out vernalization treatment 25 days, after vernalization Planting seed is in isolation solarium.

In the research carrying out male sterile with radish cytoplasm, we are found that a strain in local varieties in Shandong Male sterility individual plant, with male sterile plant as female parent, hybridizes with other fertile plant of this kind for male parent, 20 hybridization In the offspring of combination, have in an offspring combined and occur in that 50% can educate and the Phenotype of 50% sterile plant, continue with this combination Male parent self progeny and sterile plant hybridize, after hybridization in generation, some combination fertility are recovered completely, and some combinations still occur The phenomenon of fertile plant and sterile plant each 50%, and occur in that the segregation phenomenon of fertility in the self progeny of male parent, fertile plant with Sterile ratio is 3:1；Simultaneously in sterile plant with the filial generation keeping material, the self progeny of fertile plant occurs in that equally The separation of fertility, fertile plant is similarly 3:1 with the ratio of sterile plant, and I primarily determines that this sterile material is the hero that nucleus controls Property is sterile.

The determination of male sterility gene comprises the steps: with localization method

(1) mitochondrion checks order entirely with chloroplast

In order to find the sterile gene of this sterile material, we are to this sterile material and an Ogura cytoplasmic male sterility class The holding system of type has carried out mitochondrion and has entirely checked order with chloroplast.For ensureing sample purity, prevent from out mixing phenomenon, extracting line grain During body and chloroplast DNA, we extract sample from an individual plant respectively, according to mitochondrion and the extraction side of chloroplast DNA Method, is extracted the hybrid dna sample containing mitochondrial and chloroplast, carries out high flux DNA sequencing, the order-checking degree of depth 1000 times with On, look into benefit gap through the assembling of De novo program and PCR, complete the order-checking assembly working (two of mitochondrion and chloroplast DNA sequence is not also delivered), by local Blast, both mitochondrial DNAs are completely the same, and the novel sterile line of chloroplast DNA is only Had more the repetition of 31 bases in its mirror image duplicate block than check variety, other is completely the same, to the region morphed Carrying out gene and open reading frame (ORF) comparison, searching, this region in the clearest and the most definite chloroplast gene, does not also find no Exist more than the ORF of 150bp.

(2) biogenetics verification experimental verification.

Test one: with check variety as female parent, in the filial generation of sterile line and holding system, fertile plant is carried out for male parent Hybridization, it is thus achieved that F1；Take the seed of 20 material F1 generations carry out sprouting, vernalization treatment, Post flowering, each F1 generation individual plant carries out selfing, obtains Obtain F2 for seed；Every strain F1 generation takes the F2 of 50 selfings for seed, carries out equally sprouting, vernalization treatment, observes its Fertility segregation Situation.

Table 1 F2 is for Fertility segregation situation

In 20 strain F2 generations, having 11 strains for all can educate, there is Fertility segregation in 9 strains, add up to fertile plant 330 strain, sterile plant 108 Strain, substantially conforms to the genetic development of core recessive gene.

Test two: in this sterile material keeps the selection-breeding of system, every individual plant that can keep to sterile line, it keeps energy Power is all 50%.To having the individual plant selfing of holding capacity, in its 85 strain self progeny, having 64 strains is fertile plant, and 21 strains are sterile Strain, about 3:1, meet Mendel's single-gene recessive gene and control the genetic development of character；We are again with in 23 fertile plants 15 strains hybridize with sterile plant respectively, after seed maturity, through vernalization treatment, in 15 combinations, have 5 offspring's fertility combined complete Recover, have 10 offsprings combined that sterile plant and the fertile plant of each 50% still occur.

We represent the dominant character of fertile gene with " M ", represent the recessive character of fertile gene with " m ", by more than Test it can be concluded that this male sterility is recessive gene character, its genotype is " mm ", and male fertile genotype is " MM " Or " Mm ", wherein " Mm " type is for keeping system.When " MM " type fertile plant hybridizes with sterile line (mm), offspring's genotype is " Mm ", All can educate；When " Mm " type fertile plant and sterile line (mm) hybridize, offspring's genotype is " Mm " and " mm ", has 50% educate Strain, the sterile plant of 50%.

3) male sterility line taking this material carries out transcript profile order-checking with the alabastrum keeping system, it is thus achieved that a plurality of male sterility It is exclusive transcribing, and assembles the genetic transcription group design PCR primer obtained according to order-checking, RNA is converted cDNA and carries out PCR Checking, be finally obtained 4 exclusive genetic transcription groups Unigene1 of male sterility line, Unigene2, Unigene3, Unigene4。

The invention have the advantages that

(1) discovery of Radix Raphani genie male sterile line, has widened the scope that utilizes of radish male sterile, and original Ogura is thin Kytoplasm type sterile line, is by plasmagene and two pairs of coefficient results of karyogene, difficulty in the selection-breeding keeping system Very big, some materials just can not select holding system at all.Radix Raphani genic male sterile line is by single recessive gene control, is protecting Hold in the transformation and selection-breeding being relatively easy a lot, the material of cytoplasmic male sterile line can not be utilized to provide new breeding some Approach；

(2) the core recessiveness male sterility that the present invention relates to, it is to avoid the crop in cruciferae that Ogura cytoplasmic male sterility causes Cytoplasm Single-issue；

(3) genic male sterile line that the present invention relates to is the discovery first in Radix Raphani, has male sterile plant Anther degeneration thorough, The normal feature of Stamen development, it is possible to carry out preparation and the selection-breeding of cenospecies.

The present invention has broken traditional Radix Raphani male sterility and has only had the limitation of cytoplasmic sterility type, utilizes male sterility for Radix Raphani Breeding opens new approach, and for solving, Radix Raphani male sterile material gene is single has ten in the discovery of this sterile material simultaneously Divide important meaning.

(4) accompanying drawing explanation

The present invention is further illustrated below in conjunction with the accompanying drawings.

Fig. 1 is 136S mitochondrial genome figure of the present invention；

Fig. 2 is 136S Chloroplast gene figure of the present invention；

Fig. 3 is the difference comparison diagram of 136S Yu 45B chloroplast genomic dna of the present invention；

Fig. 4 is the selection block diagram of Radix Raphani genie male sterile line of the present invention；

Fig. 5 is the gene differential expression figure of 136S Yu 136F of the present invention.

(5) detailed description of the invention

The selection of a kind of Radix Raphani genie male sterile line, comprises the steps:

(1) in local varieties 136 natural population, find male sterile plant (136S), use Ogura special primer: ORF-F 5'- TTCAAATCCTGTCCCCGCACC-3', and ORF-R 5'-GCCTTACACCATTGGGATACTTC-3', to sterile material blade DNA carries out PCR molecular marker, specific band does not occur, illustrates that this sterile material does not contains Ogura male sterility gene.

(2) 136S and check variety 45B is carried out mitochondrion and chloroplast order-checking

45B is the holding system of Ogura cytoplasmic male sterile line, is generally acknowledged to have normal Cytoplasm.To 136S and right Blade according to kind 45B extracts chloroplast and mitochondrion, for ensureing sample purity, prevents from out mixing phenomenon, is extracting mitochondrion During chloroplast DNA, extract sample from an individual plant respectively, according to mitochondrion and the extracting method of chloroplast DNA, extract Hybrid dna sample containing mitochondrial and chloroplast, carries out high flux DNA sequencing, the chloroplast order-checking degree of depth 600 times with On, the mitochondrion sequencing degree of depth, more than 100 times, according to the difference of the order-checking degree of depth, looks into benefit through the assembling of De novo program and PCR Gap, first assembles chloroplast；It is completed after chloroplast again with identical method assembly line plastochondria, De novo is assembled Contig first compares with chloroplast DNA sequence, rejects chloroplast DNA part, then carries out mitochondrion assembling, assembles splicing side Method is identical with chloroplast, the most again by the method for PCR, DNA sequence identical with mitochondrion for chloroplast is screened.Complete line After the order-checking assembly working (two DNA sequence are not also delivered) of plastochondria and chloroplast, by local Blast, both mitochondrions DNA is completely the same, and the novel sterile line of chloroplast DNA has only had more the weight of 31 bases in its mirror image duplicate block than check variety Multiple, other is completely the same, and the region morphed carries out gene and open reading frame (ORF) comparison, searching, and this region does not exists In the clearest and the most definite chloroplast gene, also find no and exist more than the ORF of 150bp.Thus illustrating, 136S sterile material is at cell The most significantly distinguish with normal fertile strain in matter that (136S mitochondrial genome figure is shown in that Fig. 1, chloroplast figure genome are shown in Fig. 2, leaf Fig. 3 is seen in green body Sudden change region, note in Fig. 3: use Vector NTI software to 136S male sterility chloroplast and normal fertile strain 45B chloroplast is compared, and in the mirror image duplicate block of genome, 136S has had more 31 bases).

(3) 136S sterile line and selection-breeding such as Fig. 4 of holding system.

Spring in 2012, under the conditions of gauze is isolated, makees female parent with male sterile material 136S, with in same natural population Fertile plant carries out test cross as male parent, does test cross and combines 31, carries out test cross with five different cultivars simultaneously, and test cross combines 147, often The effectively knot kernal number of individual test cross combination is all more than 50；Effectively setting seeds of test cross male parent selfing counts also more than 50.

Autumn in 2012, at the beginning of 7 months, every part of the seed of test cross and selfing gained being taken 50, the warm water soaking 3 with 35 DEG C is little Time, it is then placed in paper substrate culture dish, after Seed sprouting, puts into and the refrigerator of 2-4 DEG C carries out vernalization treatment 25 days, pass through the spring Planting seed after change, in isolation solarium, treats Post flowering, carries out observing statistics to the male sterility situation of test cross offspring.Male The standard of sterile plant is, Stamen development is normal, and stamen is degenerated maybe can not form effective pollen completely.

Occurring individual plant 2 strain with part holding capacity in a test cross generation, its holding capacity is all about 50%；These are two years old Strain all occurs from the fertile plant in the natural population of 136, all fertile plants of test cross offspring of other kind, does not select tool There is the individual plant of holding capacity.2 strains have the individual plant of holding capacity, also occur in that the separation of fertility, a strain are in self progeny Sterile plant 12, fertile plant 37；Another strain is sterile plant 11, fertile plant 36.

With the sterile plant of test cross offspring as female parent, fertile plant is that male parent carries out hybridizing (FA2).To have normal cell matter Fertile plant 45B is maternal, carries out hybridizing (FB1) with the fertile plant in test cross offspring for male parent.

The seed that autumn harvest in 2012 obtains is seeded in solarium after vernalization treatment by the spring in 2013, and Post flowering carries out fertility Investigation, with the sterile plant of test cross offspring for female parent with fertile plant filial generation FA2, goes out fertile plant and sterile plant each 50%；With tool Fertile plant 45B having normal cell matter hybridizes with the fertile plant in test cross offspring, all in its offspring FB1 educates.

With the sterile plant in FA2 offspring as female parent, fertile plant is paternal hybrid (FA3)；FB1 carries out selfing (FB2).

FA3 and FB2 that spring is gathered in the crops by the autumn in 2013 carries out vernalization treatment for seed, by planting in solarium after vernalization In, Post flowering investigation fertility, in FA3 offspring, fertile plant and sterile plant respectively account for 50%；Selection-breeding continuous for novel sterile material 5 In generation, define stable sterile line (136S) and keep system (136F).

Having the offspring of 11 FB1 for all can educate in FB2 generation, the offspring of 9 FB1 occurs in that the separation of fertility, occurs In the FB2 generation of Fertility segregation, have 330 fertile plants, 108 sterile plants, about 3:1.

After this off-test, the most clearly this sterile material is the Recessive genes male sterility that karyogene controls, with Sterile plant in its test cross offspring is sterile line (136S), and fertile plant, for keeping system, has selected and stable had 50% holding energy The holding system of power.The fertility of 136S sterile line is degenerated thoroughly, observes through too much generation, and its fertility is not affected by factors such as environment, Flower pesticide is degenerated completely, it is impossible to forming the pollen with function, Stamen development is normal.The floral organ of sterile plant is slightly less than fertile plant.

(4) screening of 136S special cDNA primer

Taking 136S and keeping with it is that the alabastrum of two materials carries out RNA order-checking.An inflorescence unopened whole flowers are rounded during sampling Flower bud, each repeats to take an individual plant, each material 3 repetition.Examining order is completed by the company of order-checking.After extracting sample total serum IgE, With the enrichment with magnetic bead mRNA with Oligo (dT), add fragmentation buffer and mRNA is broken into short-movie section, with MRNA is template, with hexabasic base random primer synthesize Article 1 cDNA chain, then resynthesis Article 2 cDNA chain, through purification, After eluting, do end reparation, add poly (A) and connect sequence measuring joints, then carry out clip size choosing with agarose gel electrophoresis Selecting, finally carry out PCR amplification, the sequencing library built up (200bp) checks order with Illumina HiSeq 2000, to assemble The Unigene completed carries out the Differential expression analysis of gene.

In 110,000 Unigene, 3391 (see figure 5)s 136S of the gene of differential expression keep system with 136F() compare, Heighten the gene 745 of expression, turn down expression 2645.In 745 genes heightening expression, what 136S was exclusive has 11 Gene, with the mRNA primers of these 11 genes, is converted into cDNA by the RNA of 136S Yu 136F, special with design Primer carries out PCR amplification checking, and finally screening obtains 4 mRNA exclusive for 136S.Respectively:

Unigene1

CAATGGTCACTATCTGCTAGTTCCAGCAGCTTCCTCTTGATGGCATCAGAGCAAAGACGAGCCATCATACGGT GGAAGGAAAGAAGATCAGACAAACGCTCTGCGGACAGCTTGTCCATTGCCCTCTCATGCTCCTCTTTCCTCTTCATC CTCTTCATATACACACACGAGTTCCTCACCGTCGCTCCCATCTGCTTCAGCCTGTTCTCTTCTTGCTTGCTTAGAAC CGTTTTTGCCTCCAAAAGCTCATCTCCTGAGAAGCTTTTGACTAGCGTCTTCTTCACCACAATCTTTGTTGCATCTA GTTGCTTCTTCTGAAACACAGTCACAGCTTTCACAAACTCCCGGTAAACAGAAACACATCCTGGATAATCAAACTCA TCGTCAGAGAGCCTCATCCTCTCGGGATGAAACTGCAGACCCATCAGAAACCGACCTTCCTCTGGATCATACCGGTT CGGATCATAGAACCCTTCTACCAAGCCATCAGGAGCGTAAGCCATAGGCACAAAACGCTCCGCGAGCCTCTTCACAC CTTGATGATGATACGAATTCACCATGATCTGATCCATCTCATCGAACCATTCGTGCAGCGGCGTCTCCTCCACGAGC CTAGCCTCGTGCCTGTGCTCATCGTAGTTCTCGTAGTCTATATGCTTCGTACTAGTTCCAACTTCTTTGTCGATGTC TTGGTACAGAGTTCCTCCGGCTGCGACGTTGAGGATCTGAGAGCCACGACAGATGCCTAAAAAGGGAATGTTTCTTT CGAGACAGAGCTTGGCTAGACTCAGCTCGATGCTGTCTTTCTCTCTGTCTATCGTCGTGTCGCTTGCGTGCAACGTC CTGATCTCATCCATGTCCTCCTGAGAAAGTCCAGGTAGCTCTTCGTCTGCGTAGAGAGAAGGGTCGACGTCTTCTCC TTCGCAGAGGAGGACGCCGTGGATAGGCTCGAAGCTCCGGAGCATAGAGTGGATCCCGCTTACACGTGGGACGATGA CAGGGACGGCGCCGTGTGAGACGATGAGGTCGAGATGGTACTCTCCTACGAAGTCAACGAACTTGTTCTTGCGTAGA GTCCGACGAGAGACGACGAGAACTCTCGGGAGAGTCTTGGACGAGAGATCATCATTGTTAGCGACAACCACCACCAT CCTTGATTAAAGTTTTGTTTATGTCTTAAC；

Unigene 2

AACTAGATTTACAAAGGACTATAAATGTCCGTACAATTAGAAGATTTCAAATAGTGTTTTACTACGTAGAAGA GGTACATACACACTCGTAACAGCGCAAACGTAAATATTACAAACATAACCAGATTTTTTTGTATTACGGAAAGTAAA CAACCAAATAAGCATACAACATATTGATTATCTAAAAGGGAAATTAAATAGTACAAATCATACAGAAATATATATGC GTAATCAACTAAACCAAAACACACCACACTGATACATTTCACTATAGTATAAGAGACAACAAACCCCATGAAGTATA TAATTATTCAAGGACTCGATTTAGATGTAGTAGGCGGAGGAGAGAACATCGGAATGGATGGGAAATTAGTCGGGAGA GAAGGAATCGTTGTGGGGAATGAAGGTAAAGTTGGCATTGGAATAGGAGGGATTGAAGTGGGAATTGTGGGAAGAGT TGTTTGTGGCAATGTTGATGGCAGTGGAGGGATTGAAGTGGGCATGGTGGGAAGAGTTGGTTGTGGCAATGTAATTG AAGTGGGCATTGTGGGAAGACTTGGTTGTGGCAAGGTTGATGGTAACGGAGGTAGTCCCACTGTTGGGATAGACATA TTTGGAATTTGAGGAAGAGGTTGTTGCTGGAGAAGATGGCGTGAGGCCGAGCAAGTGTTGATCGTAATAGAGGAAGA AAGGCTCACTAAGACAGCAATGAGAAAAAGCTTGAATGATGCCATTTTGGATGTGTTGATGAATTCTCTTTTATTAT GGTTAAGCCACTCTTTAATTGCTTCTTTAGTTATTG；

Unigene 3

TACGAGATGCTCGGAACCTTCAAAGTTCAAACCATGGGAGCCTCATTACAATCACATTTCTGAGCATACGTGG GTGCTAAATGAAAGATTTTAAAACAAGTGTTGATTTTTTTTCCATCTGAGCGTCAGATATCCATATCTTCAAACCAT TGGAGCCTTATTACTTCGGGCTTTTTTATTTCAAATATTCGTCATTTACATTGGTACTTTAGATCTTTTCCACATAT ATTATTACACCAAACCAATGATGTGACACATGCAGGATTCAAATACCACCACTTAGAATCTTGTCATTAGGAATGTC GCTGCAGTAGTCGCATAAGCATTTAACATCAACGGTACCGTAATCTCCCCAAATGCATGTTCCACCTTGTGCGCCCT TGTCCTTACGGCAATTTGTATAACAAAACGAGGGAAATATCTCAGGCGCACAGAAGCTGAAACCCACATCGCCGCCG TATTCTACCAGGCACTCGTCATCATGCGCTTCTATCTCCGGCACTTCAAAGATAACCAAAACGAGGATGAAAATGAT GGCGAAAGAAGAAACTGATTTCGTTGCGAATGCCATCTTCTCTGCTCTATATCTCTCTGTCTACTCTTTACTTCTC；

Unigene 4

GCGTAGACACAAATACATATTAGTTAAAGAAATACATGTCGAGGTTTTGATCACATTGATCACAATATAACAG AACATATTACAATACATAAGTCTCTTGTTTAGTTGCATACAATACACCATAATACAGTTCATGTCTATTATCACAAA GACATAGCAACAGCCTGTTACTTAAACCCGACAATCATGCCTATTATCACAAAGACAACTACCATAACACCTATAAT GAGTTCAAAGCCATTGGAAACCCTAGATTTTGTTTTAGCTAAGTCACACACAATTCTCTCAAGCCTAACCAACTTGT CCTCTGTCTCGCTTTGCAGTTCCTTTACCTGGTTAAGATGAGTGTCATAGTCACTCATACAGGAGAGATAATCAACC TTATCAGAGAGCTGCTGACAGTGACTCGATATGGCTCTGATCTCCTCCGTTGCCGCGACATCCCACCACTTCCAGAC ATGGCAGTCTCCATCGTCTCTGTTCTCGCAGGTATAGAACCTTCTCCCAGGATCATTCCTTGTGTACGATGTGGCTG TCAGCGGTTCGGCACCACAGTAGCATTCCTTTGGGAAGCCGAACTCAACCTCGGGCTGGGGAGGATAGTAAATCCGT GCAGCATCAATTTCAGCTTGGTCCAAAAGTATATCAATTTCAGCTTCTGTCTGGCTGAACCCACTCTCTGCTGAGTC CCCTAAACCATAGTCCTCCGACTGAGACGGCTGCGTGTAACTATAATCCTGCCCCATATCTTGTGTAACCTGAAAAA CAACCTTCACTTAACATAATTCAAATAAGAACATATTACCATGAGCGGCGTAGATGTCATGAGCCACCTTTAGCACG TCATTGTCATTCTGACCGCTGCTTATTTGTCTCTCTGCAGCAGCGAATGCAGCGCAGAACTTGTTGGTCTGATCATT GATTTTGTGCCATCTCTGCTTGCAATGGAGTAGCTCTCTCTTCTCACCTAAGGCACGTCCAACATAATCTCCTACGC GGTCCCAGAAGGTCCCAGACGTCTGGTCATTTCCGACAATTGCATCCTTTGATGTGTTCAGCCACGCACTGATTAGT ATCTCATCATCAGCTGGCGTCCATTTTCTTCTCACCTGACGAACCGGGCGTCTGGCTTCAGGTTGGGATGGAGCCTC AGATTGCTGGGAACTGAAGGGAGGGATTTCAGAGGCTCCCATGTTTAGACTAGAAGGAAAACTTTCATAAGGAAAGT TTTCCTGAACAACATTTTCTTCTACGTTGTGAAGAAGGTTTACATAGCCAGTATACTGGCTATATGTATTCCTTGAG TTCATAGGAACAAGGACAGAGAAGAGATATTTAGAAAATAACTATTACTGTAAGC；

Wherein,

Unigene 1-primer:

F: TCATCCTCTCGGGATGAAAC

R: CGTCGACCCTTCTCTCTACG

PRODUCT SIZE: 518, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 1.00；

Unigene 2-primer:

F: CGTAACAGCGCAAACGTAAA

R:TCCAAAATGGCATCATTCAA

PRODUCT SIZE: 653, PAIR ANY COMPL: 2.00, PAIR 3' COMPL: 1.00；

Unigene 3-primer:

F: CTGAGCATACGTGGGTGCTA

R: TAGAAGCGCATGATGACGAG

PRODUCT SIZE: 433, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: 3.00；

Unigene 4-primer:

F:TCTGGCTGAACCCACTCTCT

R:CCTCTGAAATCCCTCCCTTC

PRODUCT SIZE: 525, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 0.00。

With 4 the special primer Unigene 1-primer, Unigene 2-primer, Unigene 3-that are screened Primer, Unigene 4-primer carries out PCR amplification to the cDNA of male sterility line 136S, has what specific band occurred to be Sterile line, otherwise for keeping system or other material.

Sequence table

<110>Shandong Crop Germplasm Resource Center

<120>a kind of Radix Raphani genie male sterile line and selection thereof

<160〉4

<170〉Patent-In 3.3

<210〉1

<211〉1181

<212〉RNA

< 213 ＞ Radix Raphani nuclear male sterilities keep system

<220〉

<221〉allele

<222〉

<400> 1

caatggtcac tatctgctag ttccagcagc ttcctcttga tggcatcaga gcaaagacga 60

gccatcatac ggtggaagga aagaagatca gacaaacgct ctgcggacag cttgtccatt 120

gccctctcat gctcctcttt cctcttcatc ctcttcatat acacacacga gttcctcacc 180

gtcgctccca tctgcttcag cctgttctct tcttgcttgc ttagaaccgt ttttgcctcc 240

aaaagctcat ctcctgagaa gcttttgact agcgtcttct tcaccacaat ctttgttgca 300

tctagttgct tcttctgaaa cacagtcaca gctttcacaa actcccggta aacagaaaca 360

catcctggat aatcaaactc atcgtcagag agcctcatcc tctcgggatg aaactgcaga 420

cccatcagaa accgaccttc ctctggatca taccggttcg gatcatagaa cccttctacc 480

aagccatcag gagcgtaagc cataggcaca aaacgctccg cgagcctctt cacaccttga 540

tgatgatacg aattcaccat gatctgatcc atctcatcga accattcgtg cagcggcgtc 600

tcctccacga gcctagcctc gtgcctgtgc tcatcgtagt tctcgtagtc tatatgcttc 660

gtactagttc caacttcttt gtcgatgtct tggtacagag ttcctccggc tgcgacgttg 720

aggatctgag agccacgaca gatgcctaaa aagggaatgt ttctttcgag acagagcttg 780

gctagactca gctcgatgct gtctttctct ctgtctatcg tcgtgtcgct tgcgtgcaac 840

gtcctgatct catccatgtc ctcctgagaa agtccaggta gctcttcgtc tgcgtagaga 900

gaagggtcga cgtcttctcc ttcgcagagg aggacgccgt ggataggctc gaagctccgg 960

agcatagagt ggatcccgct tacacgtggg acgatgacag ggacggcgcc gtgtgagacg 1020

atgaggtcga gatggtactc tcctacgaag tcaacgaact tgttcttgcg tagagtccga 1080

cgagagacga cgagaactct cgggagagtc ttggacgaga gatcatcatt gttagcgaca 1140

accaccacca tccttgatta aagttttgtt tatgtcttaa c 1181

〈210〉2

〈211〉802

〈212〉RNA

＜ 213 ＞ Radix Raphani nuclear male sterility keeps system

〈400〉2

aactagattt acaaaggact ataaatgtcc gtacaattag aagatttcaa atagtgtttt 60

actacgtaga agaggtacat acacactcgt aacagcgcaa acgtaaatat tacaaacata 120

accagatttt tttgtattac ggaaagtaaa caaccaaata agcatacaac atattgatta 180

tctaaaaggg aaattaaata gtacaaatca tacagaaata tatatgcgta atcaactaaa 240

ccaaaacaca ccacactgat acatttcact atagtataag agacaacaaa ccccatgaag 300

tatataatta ttcaaggact cgatttagat gtagtaggcg gaggagagaa catcggaatg 360

gatgggaaat tagtcgggag agaaggaatc gttgtgggga atgaaggtaa agttggcatt 420

ggaataggag ggattgaagt gggaattgtg ggaagagttg tttgtggcaa tgttgatggc 480

agtggaggga ttgaagtggg catggtggga agagttggtt gtggcaatgt aattgaagtg 540

ggcattgtgg gaagacttgg ttgtggcaag gttgatggta acggaggtag tcccactgtt 600

gggatagaca tatttggaat ttgaggaaga ggttgttgct ggagaagatg gcgtgaggcc 660

gagcaagtgt tgatcgtaat agaggaagaa aggctcacta agacagcaat gagaaaaagc 720

ttgaatgatg ccattttgga tgtgttgatg aattctcttt tattatggtt aagccactct 780

ttaattgctt ctttagttat tg 802

〈210〉3

〈211〉611

〈212〉RNA

＜ 213 ＞ Radix Raphani nuclear male sterility keeps system

〈400〉3

tacgagatgc tcggaacctt caaagttcaa accatgggag cctcattaca atcacatttc 60

tgagcatacg tgggtgctaa atgaaagatt ttaaaacaag tgttgatttt ttttccatct 120

gagcgtcaga tatccatatc ttcaaaccat tggagcctta ttacttcggg cttttttatt 180

tcaaatattc gtcatttaca ttggtacttt agatcttttc cacatatatt attacaccaa 240

accaatgatg tgacacatgc aggattcaaa taccaccact tagaatcttg tcattaggaa 300

tgtcgctgca gtagtcgcat aagcatttaa catcaacggt accgtaatct ccccaaatgc 360

atgttccacc ttgtgcgccc ttgtccttac ggcaatttgt ataacaaaac gagggaaata 420

tctcaggcgc acagaagctg aaacccacat cgccgccgta ttctaccagg cactcgtcat 480

catgcgcttc tatctccggc acttcaaaga taaccaaaac gaggatgaaa atgatggcga 540

aagaagaaac tgatttcgtt gcgaatgcca tcttctctgc tctatatctc tctgtctact 600

ctttacttct c 611

〈210〉4

〈211〉1360

〈212〉RNA

＜ 213 ＞ Radix Raphani nuclear male sterility keeps system

〈400〉4

gcgtagacac aaatacatat tagttaaaga aatacatgtc gaggttttga tcacattgat 60

cacaatataa cagaacatat tacaatacat aagtctcttg tttagttgca tacaatacac 120

cataatacag ttcatgtcta ttatcacaaa gacatagcaa cagcctgtta cttaaacccg 180

acaatcatgc ctattatcac aaagacaact accataacac ctataatgag ttcaaagcca 240

ttggaaaccc tagattttgt tttagctaag tcacacacaa ttctctcaag cctaaccaac 300

ttgtcctctg tctcgctttg cagttccttt acctggttaa gatgagtgtc atagtcactc 360

atacaggaga gataatcaac cttatcagag agctgctgac agtgactcga tatggctctg 420

atctcctccg ttgccgcgac atcccaccac ttccagacat ggcagtctcc atcgtctctg 480

ttctcgcagg tatagaacct tctcccagga tcattccttg tgtacgatgt ggctgtcagc 540

ggttcggcac cacagtagca ttcctttggg aagccgaact caacctcggg ctggggagga 600

tagtaaatcc gtgcagcatc aatttcagct tggtccaaaa gtatatcaat ttcagcttct 660

gtctggctga acccactctc tgctgagtcc cctaaaccat agtcctccga ctgagacggc 720

tgcgtgtaac tataatcctg ccccatatct tgtgtaacct gaaaaacaac cttcacttaa 780

cataattcaa ataagaacat attaccatga gcggcgtaga tgtcatgagc cacctttagc 840

acgtcattgt cattctgacc gctgcttatt tgtctctctg cagcagcgaa tgcagcgcag 900

aacttgttgg tctgatcatt gattttgtgc catctctgct tgcaatggag tagctctctc 960

ttctcaccta aggcacgtcc aacataatct cctacgcggt cccagaaggt cccagacgtc 1020

tggtcatttc cgacaattgc atcctttgat gtgttcagcc acgcactgat tagtatctca 1080

tcatcagctg gcgtccattt tcttctcacc tgacgaaccg ggcgtctggc ttcaggttgg 1140

gatggagcct cagattgctg ggaactgaag ggagggattt cagaggctcc catgtttaga 1200

ctagaaggaa aactttcata aggaaagttt tcctgaacaa cattttcttc tacgttgtga 1260

agaaggttta catagccagt atactggcta tatgtattcc ttgagttcat aggaacaagg 1320

acagagaaga gatatttaga aaataactat tactgtaagc 1360

Claims (5)

1. a Radix Raphani genie male sterile line, it is characterised in that: described sterile line is by the hero of a pair recessive nuclear gene control Property sterile line, its fertility inheritting is stable, is not affected by factors such as environment, and Stamen development is normal, and stamen is degenerated completely, without effectively Pollen, its preserving number is P201411, and depositary institution is China typical culture collection center, address Wuhan, China Wuhan University, Preservation date is on October 26th, 2014, and Classification And Nomenclature is 136S.

The selection of Radix Raphani genie male sterile line the most according to claim 1, is characterized by, comprise the steps: (1) with male sterile plant as female parent, test cross, simultaneously this male parent selfing are carried out with the fertile plant in same natural population for male parent； (2) seed of test cross and selfing gained is carried out vernalization treatment, by the planting seed after vernalization in isolation solarium, wait to bloom After, carry out observing statistics to the male sterility situation of filial generation；(3) with the sterile plant of test cross offspring as female parent, fertile plant is Male parent hybridizes, simultaneously with there is normal cell matter fertile plant as female parent, enter with the fertile plant in test cross offspring for male parent Row hybridization；(4) being seeded in after vernalization treatment in isolation solarium by the seed of hybridization results, Post flowering carries out fertility investigation, Determine that the sterile plant in seed is the male sterility line that nucleus controls；(5) checked order by transcript profile, have found male sterility line Exclusive genetic transcription group, and design primer cDNA and carry out PCR checking, it is thus achieved that 4 mRNA that male sterility line is exclusive.

The selection of Radix Raphani genie male sterile line the most according to claim 2, it is characterised in that: in step (1), In local varieties natural population, find male sterile plant, use Ogura special primer: ORF-F 5'- TTCAAATCCTGTCCCCGCACC-3', and ORF-R 5'-GCCTTACACCATTGGGATACTTC-3', to sterile material blade DNA carries out PCR molecular marker, specific band does not occur, illustrates that this sterile material does not contains Ogura male sterility gene.

The selection of Radix Raphani genie male sterile line the most according to claim 2, it is characterised in that: in step (2), Every part of the seed of test cross and selfing gained is taken 50, with the warm water soaking 3 hours of 35 DEG C, is then placed in paper substrate culture dish, After Seed sprouting, put into and the refrigerator of 2-4 DEG C carries out vernalization treatment 25 days, by the planting seed after vernalization in isolation solarium In.

The selection of Radix Raphani genie male sterile line the most according to claim 2, it is characterised in that: in step (5), Primer is four, respectively Unigene 1-primer:F:TCATCCTCTCGGGATGAAAC, R: CGTCGACCCTTCTCTCTACG；Unigene 2-primer:F:CGTAACAGCGCAAACGTAAA, R: TCCAAAATGGCATCATTCAA；Unigene 3-primer:F:CTGAGCATACGTGGGTGCTA, R: TAGAAGCGCATGATGACGAG；Unigene 4-primer:F:TCTGGCTGAACCCACTCTCT, R: CCTCTGAAATCCCTCCCTTC；CDNA in sterile material alabastrum is carried out PCR molecular marker, and specific band do not occur is Fertile plant, occur specific band for sterile line.