CN107299130B - Molecular marker linked with rice stigma exposure rate QTL and application thereof - Google Patents
Molecular marker linked with rice stigma exposure rate QTL and application thereof Download PDFInfo
- Publication number
- CN107299130B CN107299130B CN201710081970.2A CN201710081970A CN107299130B CN 107299130 B CN107299130 B CN 107299130B CN 201710081970 A CN201710081970 A CN 201710081970A CN 107299130 B CN107299130 B CN 107299130B
- Authority
- CN
- China
- Prior art keywords
- rice
- stigma
- molecular marker
- rate
- qtl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker linked with a rice stigma exposure rate QTL, wherein the QTL comprises rice single stigma exposure rates qSSE5, qSSE10 and qSSE11, rice double stigma exposure rates qDSE10 and qDSE11, rice total stigma exposure rates qTSE5, qTSE6, qTSE10and qTSE 11; the molecular marker linked with qSSE11, qDSE11 and qTSE11 is RM286, the molecular marker linked with qSSE10, qDSE10 and qTSE10 is InD133, the molecular marker linked with qTSE6 is InD94, and the molecular marker linked with qSSE5and qTSE5 is RM 10; the invention also discloses application of the molecular marker. Based on the QTL positioning and linked molecular marker results, the method can be applied to auxiliary screening of rice varieties with high stigma exsertion rate.
Description
Technical Field
The invention relates to the field of rice molecular genetic breeding, in particular to a molecular marker linked with a rice stigma exsertion rate QTL and application thereof.
Background
Rice is an important food crop for billions of people worldwide. The hybrid rice seed production technology developed in China in the seventies of the twentieth century has made great progress in rice production in recent years. In order to cope with the shortage of food caused by the rapid increase of global population, the cultivation of high-yield hybrid rice is considered as an effective strategy for solving the international problem. Virmani and Athwal (Virmani SS, Athwal DS.1973.genetic variability in flow characteristics in fluorescence contamination L.crop Science,13, 66-67.) proposed the hypothesis that stigma exsertion is multigenic, by observing widely the expression changes of stigma exsertion within and among different varieties of rice, that traditionally, selection of species by direct observation of stigma exsertion rate in the field appears to be very inefficient in view of the very complex nature and susceptibility to environmental factors. The continuous development of DNA marking technology and the establishment of linkage maps in recent years make the detection of Quantitative Trait Loci (QTL) for controlling complex genetic traits (such as stigma exsertion and the like) feasible and applied to actual breeding work. QTL analysis of stigma exposure rate can be carried out by using different segregation populations. Hybrid rice has been put into full play for increasing rice yield in the last 30 years, however, a problem which is not solved yet is how to increase the seed production yield of hybrid rice, and the stigma exposure rate is a key determinant factor in the seed production of hybrid rice.
The rice with high stigma exposure rate can capture more pollen and effectively improve the seed production yield of the hybrid rice by improving the maturing rate. The exposed stigma can be maintained for about 4 days and can be continuously pollinated. Recent breakthroughs and advances in DNA labeling technology have improved the basic research on genetics with stigma exsertion and applied the research to practical breeding work. For example, 9 QTLs controlling stigma exsertion were detected in a population of recombinant inbred lines composed of indica rice IR24 and japonica rice Asominori. In another population of recombinant inbred lines derived from indica rice Pei-Kuh and wild rice W1944 (oryza sativa), 2 QTLs controlling stigma exsertion were detected. However, it has not been known until now whether these QTLs function as efficient candidate genes with genetic background in hybrid rice maintainer lines.
Rou et al (Lou J, Yue G H, Yang W Q, Mei H W, Luo L J, Lu H J.2014.mapping QTLs infection simulation experiment in rice. Bulgarian Journal of Agricultural Science,20,1450-1456.) utilize F derived from two indica cytoplasmic male sterility maintainer lines (Huhan 1B and K17B)2QTL for controlling the exposure rate of rice stigma by colony localization. QTLs affecting single stigma exposure rate (SSE), double stigma exposure rate (DSE) and total stigma exposure rate were examined using a linkage map containing 92 SSR markers. As a result, 1 and 3 chromosomes were detected on the 5 th, 6 th and 7 th chromosomes, respectivelyAnd 1 QTL controls the SSE, DSE and TSE, respectively. The results of correlation mapping experiments using the expression of 109 DNA markers in 90 different varieties of chips, performed strictly (Yan, w.g., Li, y., Agrama, h.a., Luo, d., Gao, f., Lu, x., Ren, G. (2009). Association mapping of stigma and spikelet characteristics in rice (Oryza sativa L.). Molecular Breeding.24,277-292.) indicate that simple repeat (SSR) marker RM5 has a very significant correlation with single stigma exposure and double stigma exposure and plays a major role. Applying two separate populations derived from indica rice Guangluai-4 and wild rice W1943, lie et al (Li P, Feng F, Zhang Q, Chao Y, Gao G, He y.2014.genetic mapping and validation of qualitative trait location for the purpose of stimulating an exposure rate in rice molecular Breeding,34,2131-2138.) reports that stigma exposure is a complex quantitative trait and is controlled by multiple genes. They further completed genetic mapping and validated the QTL that controls rice stigma exposure rate. In order to further analyze the genetic basis of stigma exsertion, a recombinant inbred line bred from two excellent rice varieties (Chinese fragrant rice and Chuanxiang 29B) is used for detecting QTL, 11 QTL are detected in 2 years, wherein 2 QTL and 4 QTL are detected on the 1 st chromosome and the 6 th chromosome respectively to form two QTL clusters which are qSe1 and qSe6 respectively.
From the above, the QTL study for controlling the exposure rate of rice stigma plays an important role in the seed production yield of hybrid rice, and therefore, further excavation of related QTL is required.
Disclosure of Invention
The invention aims to provide a molecular marker linked with a rice stigma exposure rate QTL and application thereof.
In order to solve the technical problems, the invention adopts the following technical scheme:
a molecular marker linked with a rice stigma exsertion rate QTL, wherein the rice stigma exsertion rate QTL comprises a rice single stigma exsertion rate qSSE11 and a rice total stigma exsertion rate qTSE 11; the molecular marker is an SSR molecular marker RM286, the upstream primer of the molecular marker RM286 is CTGGCCTCTAGCTACAACCTTGC (shown in SEQ ID No. 1), and the downstream primer is AAACTCTCGCTGGATTCGATAGG (shown in SEQ ID No. 2).
Further, the rice stigma exposure rate QTL also comprises a rice single stigma exposure rate qSSE10, rice double stigma exposure rates qDSE10 and qDSE11 and a rice total stigma exposure rate qTSE 10; the molecular marker RM286 is linked with the qDSE11, the molecular marker further comprises a molecular marker InD133 linked with qSSE10, qDSE10 and qTSE10, an upstream primer of the molecular marker InD133 is AATTCTTATGGACGGATACGC (shown in SEQ ID No. 3), and a downstream primer of the molecular marker InD133 is TCAGCATCTCGTAAGCAAAAA (shown in SEQ ID No. 4).
Further, the rice stigma exposure rate QTL also comprises a rice total stigma exposure rate qTSE 6; the molecular marker also comprises a molecular marker InD94 linked with qTSE6, wherein the upstream primer of the molecular marker InD94 is GGCATTGTAGCCAATCCAGA (shown in SEQ ID No. 5), and the downstream primer is AAACACACTCCCCCATGAGA (shown in SEQ ID No. 6).
Further, the rice stigma exposure rate QTL also comprises a rice single stigma exposure rate qSSE5and a rice total stigma exposure rate qTSE 5; the molecular marker also comprises a molecular marker RM3638 linked with qSSE5and qTSE5, wherein the upstream primer of the molecular marker RM3638 is CAGATCCATCCAAGCGAGAGTACG (shown in SEQ ID No. 7), and the downstream primer is ATAGCGAGGAGGAAGAGGAGGAGAGG (shown in SEQ ID No. 8).
The invention also provides a kit for detecting the rice stigma exsertion rate, which contains the molecular marker linked with the rice stigma exsertion rate QTL.
The invention also provides application of the molecular marker linked with the rice stigma exposure rate QTL in auxiliary screening of high rice stigma exposure rate.
The invention takes the Xieqingzao B with high stigma exposure rate as a donor and the Zhonghui 9308 with low stigma exposure rate as an acceptor to establish a chromosome fragment substitution line (CSSL) of 75 lines and to be used for QTL positioning. The CSSL population was tested for 3 traits related to flowering habit in Zhejiang and Hainan environments, including single stigma exposure rate (SSE), double stigma exposure rate (DSE) and total stigma exposure rate (TSE). Also, a QTL controlling stigma exposure is detected. According to the invention, the molecular markers linked with the QTLs are found through the positioning of the QTLs, hybrid rice seed production varieties with high stigma exposure rate can be selected through molecular marker assisted breeding (MAS), and the improvement of the stigma exposure rate of the seed production varieties is helpful for improving the rice outcrossing seed setting rate, so that the seed production yield of the hybrid rice can be improved; the invention also provides a research basis for fine positioning and gene cloning in the future.
Drawings
The foregoing is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and the detailed description.
FIG. 1 is the construction process and steps of 75 line Xieqingzao B X Hui 9308CSSL population;
FIG. 2 is a table showing rice morphology and stigma exsertion; wherein, the plant form of hui 9308 (left) and the plant form of xiegazao B (right) in (a), the stigma exsertion phenotype of hui 9308 (left, stigma is brown color and therefore invisible) and the stigma exsertion phenotype of xizao B (right) in (B); (C) a stigma-exposed exterior pattern diagram in the spikelet;
FIG. 3 is a histogram of the SSEs, DSEs, and TSEs of the CSSL population in the Hainan and Zhejiang environments; wherein, the average values of Zhonghui 9308 and Xieqingzao B are respectively displayed by a one-way arrow and a two-way arrow;
FIG. 4 is a QTL chromosome mapping of single stigma exposure rate (SSE), double stigma exposure rate (DSE) and total stigma exposure rate (TSE) for the CSSL population constructed in Xieqing Zao B and Zhonghui 9308; where triangles, squares and circles represent QTL locations for SSE, DSE and TSE, respectively.
Detailed Description
1 materials and methods
1.1 plant Material
As shown in fig. 1, a chromosome fragment replacement line (CSSL) of 75 lines was constructed by a series of selfing and backcrossing using synephrine proma B and zhonghui 9308 as parents, respectively, wherein synephrine proma B has a high stigma exsertion rate and zhonghui 9308 has a low stigma exsertion rate.
1.2 field test
The CSSL of 75 strains and parents are respectively planted in the coast water of Hainan island and the base of the Fuyang Chinese rice research institute in Zhejiang, 20 days in 2014 and 15 days in 2015. Each line was planted with 8 plants in 6 rows, with a spacing of 30cm by 20cm rows. And (5) standard field management.
1.3 detection of traits
Stigma exsertion can be divided into 3 traits: single stigma exposure rate (SSE), double stigma exposure rate (DSE), and total stigma exposure rate (TSE). After flowering for 5-7 days, respectively sampling from the male parent and the female parent and each plant line, respectively taking 5 spikes, and observing after the bottommost floret blooms. The calculation formula of the stigma exposure rate adopts the following formula:
SSE (%) - [ SSE/(SSE + DSE + no exposure of the stub) ] × 100
DSE (%) ([ DSE/(SSE + DSE + no exposure of the head) ] × 100
TSE(％)＝SSE(％)+DSE(％)
Wherein, FIG. 2 shows a rice morphology and stigma exsertion phenotype chart; wherein, the plant form of hui 9308 (left) and the plant form of xiegazao B (right) in (a), the stigma exsertion phenotype of hui 9308 (left, stigma is brown color and therefore invisible) and the stigma exsertion phenotype of xizao B (right) in (B); (C) exterior type picture with exposed stigmas in spikelets.
1.4 genetic map construction and QTL analysis
87 SSR markers and 33 InDel markers were analyzed, and markers that exhibited polymorphisms between parental lines were applied to the CSSL population. The QTL is detected by a combined interval mapping method (CIM) by using software QTL cimapping4.0 software (Wang 2009), and when the LOD value is more than or equal to 2.50 and the P is less than or equal to 0.05, a QTL is supposed to be detected. Contribution ratio (H)2) The proportion of the estimated variance is divided into an epistatic effect and an additive effect over the total phenotypic variation. The QTL name is named according to the standard (McCouch 2008).
2 results
2.1 stigma exsertion rates of CSSL population and both parents
Phenotypic data analysis showed that the plants of the parent synephrine zao b (xqzb) and zhonghui 9308(ZH9308) planted in zhejiang all had larger SSE, DSE and TSE than plants planted in hainan; and its rate of double stigma exsertion showed statistically significant differences only in the XQZB parent (table 1). In the CSSL population, the SSE, DSE and TSE values of Zhejiang plants are all greater than those of Hainan plants, and the SSE and TSE are significantly different. However, DSEs do not show significant differences in the two-location environment. The highest values of SSE, DSE and TSE in the CSSL population are: hainan 32.71,5.36, 38.07; zhejiang 29.73,5.14 and 34.87. FIG. 3 is a graph showing that SSE (FIG. 3A) and TSE (FIG. 3C) exhibit continuous variation and show normal distributions in both environments. In addition, segregation was observed for all traits.
TABLE 1CSSL population and parent stigma exsertion rate Performance
*Significance was at the 0.05 level; SSE, single stub exposure rate; DSE, double stigma exposure rate; TSE, total stigma exposure rate; SE, standard error.
In each case, SSE, DSE and TSE showed significant correlation. The highest phenotypic correlation in the Hainan environment arises between HSSE and HTSE (r ═ 0.997**) Immediately followed by HDSE and HTSE (r ═ 0.890)**) Again between HSSE and HDSE (r ═ 0.852)**) (ii) a The highest correlation in Zhejiang environment occurs between ZJSSE and ZJTSE (r is 0.996)**) Immediately followed by ZJDSE and ZJTSE (r is 0.889**) Again between ZJSSE and ZJDSE (r ═ 0.844)**) See table 2 for details. The above results show that plants with larger values of SSE are more likely to increase the TSE value by increasing the DSE value.
TABLE 2 correlation coefficient (Pearson index) of CSSL population of 75 lines derived from Xieqingzao B and Zhonghui 9308 in Hainan and Zhejiang environments
**Significant correlation was at the 0.01 level; HSSE, single-stub exposure rate in hainan; HDSE, Hainan double-stigma exposure rate; HTSE, Hainan Total stigma Exposure Rate; ZJSSE, single column exposure rate in zhejiang; ZJDSE, Zhejiang double stigma exposure rate; ZJTSE, Zhejiang Total stigma Exposure Rate。
2.2 analysis of variance and environmental fluctuations
Analysis of variance (ANOVA) based on the fixed effects model showed that the CSSL population had very significant differences between the two environments (hainan and zhejiang). All traits were improved in the Zhejiang environment (Table 3). Obviously, Zhejiang environment is favorable for improving stigma exposure rate.
TABLE 3 ANOVA results based on fixed Effect model for 75 CSSL populations in two environments
***Very significant at the 0.001 level; row, CSSL population; environment, Hainan and Zhejiang; MS, mean square.
Temperature information was collected in 2015 in Hainan and Zhejiang at 3, 4, 5 months and 8, 9, 10 months, respectively. The information recorded in Hainan and Zhejiang showed significant differences between months 3-8, months 4-9 and months 5-10 (Table 4).
TABLE 4 comparative study of monthly temperatures in two environments (Zhejiang and Hainan)
Very pronounced at the 0.01 level; at 0.001 level, very significant; SE, standard error.
2.3 QTL analysis of stigma Exposure Rate
A total of 9 QTLs were detected in both environments, distributed on chromosomes 5, 6, 10and 11, respectively, with LOD values between 2.74 and 6.33 (table 5). Each QTL may account for phenotypic variation between 12.26% and 25.44%. For example, QTLqSSE5, qSSE10 and qSSE11 of single stigma exposure rate SSE were detected on chromosomes 5, 10and 11, respectively. QTLqSSE5 could explain 13.03% of phenotypic variation in Zhejiang environment, with alleles from ZH9308 with a negative additive effect of 2.32. qSSE10 and qSSE11 were detected in both environments, accounting for 21.03 and 13.99% of the phenotypic variation in the southern hain environment, and 20.01 and 18.79% in the zhejiang environment, with alleles from QXZB, with additive effects of 12.04 and 3.29, and 5.62 and 3.19 in the southern hain and zhejiang environments, respectively. For the double stigma exposure rate, qDSE10 and qDSE11 were detected on chromosomes 10and 11, respectively, and were detected in both Hainan and Zhejiang environments. Phenotypic variation was explained by 25.44% and 22.04% in Hainan environment, respectively, and 21.53% and 12.26% in Zhejiang environment. Both QTL sites of action are derived from QXZB and have additive effects of 2.21 and 1.20 and 1.95 and 0.86 in the hainan and zhejiang environment, respectively. A total of 4 QTLs were detected on chromosomes 5, 6, 10and 11 to control the total stigma exposure rate. Wherein the qTSE5 can explain 13.04% phenotypic variation rate under Zhejiang environment, and the allele comes from ZH9308 and has a negative additive effect of 4.63. qTSE6 was detected in the southern hai environment, accounting for 17.60% of phenotypic variation, with the site of action from XQZB, with a 14.44 positive additive effect. qTSE10and qTSE11 were detected in both settings, accounting for 22.45 and 13.99% of the phenotypic variation in the southern hai setting, and 20.01 and 18.80% in the zhejiang setting, with alleles from XQZB having additive effects of 14.25 and 6.59, and 11.24 and 6.37, respectively. Interestingly, most of the QTLs were concentrated in 3 regions on chromosomes 5, 10and 11, and only the QTL for TSE was found on chromosome 6 (fig. 4). Therefore, these 3 regions can be used as candidate genetic fragments for XQZB and ZH9308 to control stigma exsertion rate.
TABLE 5 QTL detected in CSSL populations constructed from XQZB and ZH9308, detected in both Hainan and Zhejiang
A, additive effect of QTL; PVE, phenotypic variation explained by each QTL; LOD, log multiplier value; qSSE, QTL for single column head exposure rate; qDSE, QTL for double stigma exposure rate; qTSE, QTL for total stigma exposure rate.
2.4 epistasis with Environment interaction
The present invention detects 4 site interactions (Table 6). 3 occur between significant major effects and one between non-major effects.
Table 6 the uploaded effect and the environmental interaction effect were detected using IC imaping software two-site interaction analysis with an LOD value of 5.0.
LOD, log multiplier value; PVE, single QTL accounts for phenotypic variation; add, single QTL additive effect; m (QQ), QTL genotype mean for QQ (XQZB genotype marker 2); m (qq), QTL genotype mean (ZH9308 genotype marker 0) for qq.
Discussion of 3
The invention discloses QTL of stigma exposure rate in two different environments. The exposed stigma during flowering is very fragile and can be easily damaged by environmental conditions (e.g., wind, water pressure, or mechanical damage). In the invention, aiming at the previous research method, a plurality of new detection means and methods are provided, in the previous research, the ears are collected in the flowering period so as to avoid damaging the exposed stigmas and ensure the data accuracy, and in other researches, the ears are collected 7-10 days after flowering. Although some stigma is very fragile, we note that there are still many pistils that still flower during the filling phase. In the invention, when the bottom spikelet blooms for 5-7 days, 5 main spikes of a father and mother parent and 5 main spikes of each CSSL line are respectively collected. In both the Hainan and Zhejiang environments, there was a significant difference in the temperature at the flowering stage (Table 4). The CSSL population in both environments showed highly significant differences in the ANOVA analysis based on the fixed effects model (table 3). Compared with Hainan, all characters in Zhejiang environment are increased (Table 1). The data show that the environmental factors in Zhejiang are more beneficial to improving the stigma exsertion rate. Of the QTLs tested, 6 QTLs were stable in two environments and 3 QTLs were unstable due to environmental conditions such as temperature, wind, water pressure and mechanical damage.
The invention co-locates 4 marks for controlling the stigma exposure rate, which are respectively: RM3638 (shown in SEQ ID Nos. 7 and 8) of chromosome 5 is linked with qSSE5and qTSE 5; InD94 (shown in SEQ ID Nos. 5and 6) of chromosome 6 is linked with qTSE 6; InD133 of chromosome 10 (shown in SEQ ID Nos. 3 and 4) is linked with qSSE10, qDSE10 and qTSE 10; and RM286 of chromosome 11 (shown in SEQ ID Nos. 1 and 2) is linked to qSSE11, qDSE11 and qTSE 11.
Table 6 shows that in this study, 4 episomal interactions were detected, 3 between major genes and 1 between minor genes. QTLs with large effect values have been identified as an important resource for the genetic improvement of quantitative traits. In the present invention, a plurality of QTLs (e.g., qSSE11, qDSE11, qTSE11, etc.) linked to RM286 on chromosome 11 form a linked cluster; marker I nD133 on chromosome 10 is linked to numerous QTLs (e.g., qSSE10, qDSE10, and qTSE10) to form QTL-linked clusters. There is a strong positive correlation between SSE, DSE and TSE.
4 conclusion
We detected 9 QTLs in total on chromosomes 5, 6, 10, 11, with qSES5, qSSE10, qSSE11, qSSE10, qSSE11, qTSE5, qTSE6, qTSE10and qTSE11 controlling single stigma exposure rate (SSE) double stigma exposure rate (DSE) and total stigma exposure rate (TSE), respectively. 6 QTLs were detected in both the Hainan and Zhejiang environments (qSSE10, qSSE11, qDSE10, qDSE11, qTSE10and qTSE11), 1 found only in Hainan (qTSE6), and 2 found in Zhejiang (qSSE5and qTSE 5). SSE, DSE and TSE interact strongly in an environment-dependent manner. The qSSE10, qSSE11, qDSE10, qDSE11, qTSE6, qTSE10and qTSE11 alleles were from Synqing-early B and exhibited positive additive effects, while the qSSE5and qTSE5 alleles were from Zhonghui 9308 and exhibited negative additive effects. For the rice effect of heterospontane selfing, the single, double and total stigma exsertion should be considered separately, so as to further discuss how to realize the yield increasing effect of hybrid rice seeds in the future genetic improvement.
In conclusion, the positioning result and the obtained molecular marking result of the invention are beneficial to applying the cytoplasmic male sterile line with exposed high stigma to the hybrid rice seed production.
Sequence listing
<110> institute of Rice research in China
<120> molecular marker linked with rice stigma exsertion rate QTL and application
<160> 8
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence (RM 286 upstream primer)
<400> 1
ctggcctcta gctacaacct tgc 23
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence (RM 286 downstream primer)
<400> 2
aaactctcgc tggattcgat agg 23
<210> 3
<211>21
<212> DNA
<213> Artificial sequence (InD 133 upstream primer)
<400> 3
aattcttatg gacggatacg c 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (InD 133 downstream primer)
<400> 4
tcagcatctc gtaagcaaaa a 21
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (InD 94 upstream primer)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence (InD 94 downstream primer)
<400> 6
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence (RM 3638 upstream primer)
<400>7
cagatccatc caagcgagag tacg 24
<210> 8
<211> 26
<212> DNA
<213> Artificial sequence (RM 3638 downstream primer)
<400>8
atagcgagga ggaagaggag gagagg 26
Claims (6)
1. The application of a molecular marker linked with a rice stigma exposure rate QTL in auxiliary screening of high stigma exposure rate of rice is characterized in that:
the rice stigma exposure rate QTL comprises a rice single stigma exposure rate qSSE11, a rice total stigma exposure rate qTSE11, a rice single stigma exposure rate qSSE10, a rice double stigma exposure rate qDSE10, a rice double stigma exposure rate qDSE11 and a rice total stigma exposure rate qTSE 10;
the molecular marker RM286 linked with qSSE11, qTSE11 and qDSE11 is that the upstream primer of the molecular marker RM286 is CTGGCCTCTAGCTACAACCTTGC, and the downstream primer is AAACTCTCGCTGGATTCGATAGG;
the molecular marker InD133 linked with qSSE10, qDSE10 and qTSE10 is characterized in that the upstream primer of the molecular marker InD133 is AATTCTTATGGACGGATACGC, and the downstream primer is TCAGCATCTCGTAAGCAAAAA;
the application is as follows: the rice with high stigma exsertion rate is screened by the molecular marker linked with the rice stigma exsertion rate QTL.
2. The application of the molecular marker linked with the rice stigma exsertion rate QTL in the auxiliary screening of the high rice stigma exsertion rate of the rice according to the claim 1, wherein the rice stigma exsertion rate QTL also comprises a rice total stigma exsertion rate qTSE 6;
the molecular marker also comprises a molecular marker InD94 linked with qTSE6, wherein the upstream primer of the molecular marker InD94 is GGCATTGTAGCCAATCCAGA, and the downstream primer is AAACACACTCCCCCATGAGA.
3. The application of the molecular marker linked with the rice stigma exsertion rate QTL in the auxiliary screening of the high rice stigma exsertion rate is characterized in that the rice stigma exsertion rate QTL also comprises a rice single stigma exsertion rate qSSE5and a rice total stigma exsertion rate qTSE 5;
the molecular marker also comprises a molecular marker RM3638 linked with qSSE5and qTSE5, wherein the upstream primer of the molecular marker RM3638 is CAGATCCATCCAAGCGAGAGTACG, and the downstream primer is ATAGCGAGGAGGAAGAGGAGGAGAGG.
4. A kit for detecting the rice stigma exsertion rate is characterized by comprising a primer for detecting a molecular marker linked with a rice stigma exsertion rate QTL;
the rice stigma exposure rate QTL comprises a rice single stigma exposure rate qSSE11, a rice total stigma exposure rate qTSE11, a rice single stigma exposure rate qSSE10, a rice double stigma exposure rate qDSE10, a rice double stigma exposure rate qDSE11 and a rice total stigma exposure rate qTSE 10;
the molecular marker RM286 linked with qSSE11, qTSE11 and qDSE11 is that the upstream primer of the molecular marker RM286 is CTGGCCTCTAGCTACAACCTTGC, and the downstream primer is AAACTCTCGCTGGATTCGATAGG;
the molecular marker InD133 linked with qSSE10, qDSE10 and qTSE10 is the upstream primer AATTCTTATGGACGGATACGC and the downstream primer TCAGCATCTCGTAAGCAAAAA of the molecular marker InD 133.
5. The kit for detecting the rice stigma exsertion rate according to claim 4, wherein the rice stigma exsertion rate QTL further comprises a rice total stigma exsertion rate qTSE 6;
the molecular marker also comprises a molecular marker InD94 linked with qTSE6, wherein the upstream primer of the molecular marker InD94 is GGCATTGTAGCCAATCCAGA, and the downstream primer is AAACACACTCCCCCATGAGA.
6. The kit for detecting the rice stigma exsertion rate as claimed in claim 4 or 5, wherein the rice stigma exsertion rate QTL further comprises a rice single stigma exsertion rate qSSE5, a rice total stigma exsertion rate qTSE 5;
the molecular marker also comprises a molecular marker RM3638 linked with qSSE5and qTSE5, wherein the upstream primer of the molecular marker RM3638 is CAGATCCATCCAAGCGAGAGTACG, and the downstream primer is ATAGCGAGGAGGAAGAGGAGGAGAGG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710081970.2A CN107299130B (en) | 2017-02-15 | 2017-02-15 | Molecular marker linked with rice stigma exposure rate QTL and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710081970.2A CN107299130B (en) | 2017-02-15 | 2017-02-15 | Molecular marker linked with rice stigma exposure rate QTL and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107299130A CN107299130A (en) | 2017-10-27 |
| CN107299130B true CN107299130B (en) | 2021-02-26 |
Family
ID=60137828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710081970.2A Active CN107299130B (en) | 2017-02-15 | 2017-02-15 | Molecular marker linked with rice stigma exposure rate QTL and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107299130B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207621A (en) * | 2018-09-30 | 2019-01-15 | 上海市农业生物基因中心 | The molecular labeling and its methods and applications of Stigma Extrusion of Rice gene qSE7 |
| CN109504792B (en) * | 2018-12-14 | 2021-02-26 | 浙江大学 | Molecular marker related to rice stigma exsertion as well as screening method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178560A (en) * | 2013-12-19 | 2014-12-03 | 国家粳稻工程技术研究中心 | Molecular marking method of rice stigma exsertion major QTL sites |
| WO2016193953A1 (en) * | 2015-06-05 | 2016-12-08 | International Rice Research Institute | Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods |
-
2017
- 2017-02-15 CN CN201710081970.2A patent/CN107299130B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104178560A (en) * | 2013-12-19 | 2014-12-03 | 国家粳稻工程技术研究中心 | Molecular marking method of rice stigma exsertion major QTL sites |
| WO2016193953A1 (en) * | 2015-06-05 | 2016-12-08 | International Rice Research Institute | Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods |
Non-Patent Citations (2)
| Title |
|---|
| 水稻柱头外露率的QTL分析;冯玲玲等;《北方水稻》;20101231;第40卷(第3期);20-22 * |
| 粳稻柱头外露率QTL定位;李威等;《中国水稻科学》;20170131;第31卷(第1期);23-30 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107299130A (en) | 2017-10-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106069720B (en) | The method of rape dihaploid induction system selection and breeding cabbage type rape variety and material | |
| Kilian et al. | Aegilops | |
| Baltazar et al. | QTL mapping for tolerance of anaerobic germination from IR64 and the aus landrace Nanhi using SNP genotyping | |
| Zhang et al. | Development and utilization of introgression lines using synthetic octaploid wheat (Aegilops tauschii× hexaploid wheat) as donor | |
| CN107435066B (en) | Rice stigma exposure rate main effect QTL and positioning method and application thereof | |
| Kantar et al. | Evaluating an interspecific Helianthus annuus× Helianthus tuberosus population for use in a perennial sunflower breeding program | |
| Goswami et al. | Genetic potentiality of indigenous rice genotypes from Eastern India with reference to submergence tolerance and deepwater traits | |
| Popelka et al. | Reciprocal hybridization between diploid Ficaria calthifolia and tetraploid Ficaria verna subsp. verna: evidence from experimental crossing, genome size and molecular markers | |
| CN106069718A (en) | The method of Brassica campestris L dihaploid induction system selection-breeding cabbage type rape cytoplasmic male sterile line | |
| KR100885075B1 (en) | A Method for producing a hybrid seed using plant of novel Cytoplasmic?Genic Male Sterility Raphanus sativus line and DNA markers for selecting the plant of said Raphanus sativus line | |
| Dai et al. | Development of a platform for breeding by design of CMS lines based on an SSSL library in rice (Oryza sativa L.) | |
| Mondal et al. | Dissecting QTLs for reproductive stage salinity tolerance in rice from BRRI dhan 47. | |
| Jiang et al. | Molecular evidence for a natural diploid hybrid between Miscanthus sinensis (Poaceae) and M. sacchariflorus | |
| CN107299130B (en) | Molecular marker linked with rice stigma exposure rate QTL and application thereof | |
| Kim et al. | Identification of heterosis QTLs for yield and yield-related traits in indica-japonica recombinant inbred lines of rice (Oryza sativa L.) | |
| Toorchi et al. | Rice root morphology under contrasting moisture regimes and contribution of molecular marker heterozygosity | |
| Krahulec et al. | Production of polyhaploids by facultatively apomictic Pilosella can result in the formation of new genotypes via genome doubling | |
| Rahman et al. | Genetic mapping of quantitative trait loci for the stigma exsertion rate in rice (Oryza sativa L.) | |
| CN105331689B (en) | Wheat-elytrigia elongata powdery mildew resistant translocation line breeding method and molecular marker thereof | |
| Rahman et al. | Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.) | |
| Al-Ashkar | Genetic contribution of parental genotypes on anther culture response of bread wheat F1 hybrids | |
| CN106069721B (en) | The method of rape dihaploid induction system selection and breeding turnip type rape kind and material | |
| Tang et al. | Comparison of QTLs for early elongation ability between two floating rice cultivars with a different phylogenetic origin | |
| CN102763506A (en) | Method for increasing purity of plant variety | |
| Bingham | Medicago arborea project at University of Wisconsin, Madison |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |