CN107286230B - Rice chloroplast ribosomal protein and coding gene and application thereof - Google Patents

Abstract

The invention discloses a rice chloroplast ribosomal protein, a coding gene and application thereof, wherein the protein has an amino acid sequence shown as SEQ ID NO.1, the DNA sequence of the coding gene is shown as SEQ ID NO.2, the total length is 3963bp, and the CDS sequence is shown as SEQ ID NO. 3. The gene prediction and the function identification show that the protein is chloroplast ribosome small subunit protein S1, the coding gene of the protein is introduced into mutant plants with abnormal chloroplast development, and the plants with normal development and normal pigment can be cultivated, and the deletion mutation can cause albinism and death of rice seedlings. The discovery of the protein and the coding gene thereof has important significance for researching the growth, development, heredity and photosynthesis of plants, and provides potential application value for further utilizing a genetic engineering means to cultivate high-photosynthetic-efficiency crop varieties.

Description

Rice chloroplast ribosomal protein and coding gene and application thereof

Technical Field

The invention relates to the technical field of genetics, in particular to rice chloroplast ribosomal protein and a coding gene and application thereof.

Background

Rice is one of the most important food crops in the world, the yield of the rice is regulated and controlled by various factors, and photosynthesis is one of the key factors influencing the yield of the rice. Chloroplasts are the main sites for photosynthesis and the synthesis and accumulation of various metabolites, provide energy sources for the development of plants, and influence the growth of plants due to the blocked development of the chloroplasts. Chloroplast ribosomes are primarily responsible for transcription and translation of plastid-encoded proteins in chloroplasts, and studies have shown that chloroplast ribosomal proteins perform important functions in the processes of ribosome formation, plastid protein synthesis, chloroplast differentiation, and early chloroplast development. Some chloroplast encoded plastid proteins are important components of chloroplast ribosomes, photosystems I and II, and the like; researches have shown that genetic mutation encoding chloroplast ribosomal protein causes embryo development obstruction, seedling death, reduction of plant photosynthesis and the like, and the researches are helpful for better cognition of photosynthesis mechanism.

Chlorophyll deletion mutants are ideal materials for researching physiological processes such as photosynthesis, photomorphogenesis and the like, and are receiving more and more attention in application, and the mutant resources can be utilized to provide a basis for further cultivating high-photosynthetic-efficiency rice varieties through a genetic engineering means.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, provides a rice chloroplast ribosomal protein, a coding gene and application thereof, provides a novel protein related to rice chloroplast development and a gene thereof, and provides a basis for further recognizing a photosynthesis mechanism and cultivating a high-photosynthetic-efficiency crop variety.

The invention is realized by the following technical scheme:

the invention provides a rice chloroplast ribosomal protein, which has an amino acid sequence shown as SEQ ID No.1, or an amino acid sequence derived by substituting and/or deleting and/or inserting one or more amino acid residues of the amino acid sequence shown as SEQ ID No.1, and is named as ASL4 protein.

The invention also provides a coding gene of the rice chloroplast ribosomal protein, the DNA sequence of the coding gene is shown as SEQ ID NO.2, the total length is 3963bp, the coding gene comprises 7 sections of exons and 6 sections of introns, the CDS sequence of the coding gene is shown as SEQ ID NO.3, the total length is 1209bp, and the coding gene is named as ALS4 gene.

The invention also provides application of the coding gene in cultivating high-photosynthetic-efficiency crop varieties.

The invention also provides a plant expression vector which is a pCAMBIA1305 vector, wherein a promoter, the CDS sequence of the ALS4 gene and a terminator are sequentially connected to the region of the multiple cloning sites.

The invention also provides a gene sequence for killing the rice seedlings, which comprises the 37 th base of the 4 th intron of the ALS4 gene DNA sequence to the 2312 th base downstream of a termination codon (TGA) and has a total length of 2855bp, wherein the gene sequence is a single recessive nuclear gene, and the deletion of the gene sequence can cause that the synthesis of chlorophyll and carotenoid of a plant is blocked, the chloroplast cannot be differentiated and the plant is whitened and killed in the seedling stage.

The invention also provides a specific InDel marker for identifying the lethal gene sequence of the rice seedling, wherein the upstream nucleotide sequence of the marker is shown as SEQ ID NO.4, and the downstream nucleotide sequence of the marker is shown as SEQ ID NO. 5.

The invention also provides a method for identifying a lethal gene sequence of a rice seedling by using the specific InDel marker, which comprises the following steps: carrying out PCR amplification on rice genome DNA by using the specific InDel labeled primer, and if only a 3348bp nucleotide sequence shown as SEQ ID NO.6 is obtained, the rice is common rice without the seedling lethal gene sequence; if only the 493bp nucleotide sequence shown as SEQ ID NO.7 is obtained, the rice is homozygote containing the lethal gene sequence of the seedling, and the phenotype is albino at the seedling stage; if the 3348bp nucleotide sequence shown as SEQ ID NO.6 and the 493bp nucleotide sequence shown as SEQ ID NO.7 are obtained, the rice is a heterozygote containing the seedling lethal gene sequence, and the phenotype is consistent with that of common rice.

Compared with the prior art, the invention has the following advantages: the invention provides a rice chloroplast ribosome protein and a coding gene and application thereof, the protein is chloroplast ribosome small subunit protein S1, the coding gene of the protein is introduced into mutant plants with chloroplast dysplasia, and the plants with normal pigment and normal development can be cultivated; the invention also provides a lethal gene sequence of rice seedlings and a detection method thereof, which can quickly monitor rice plants containing the gene sequence; the protein, the coding gene thereof and the discovery of the gene sequence lethal to the seedlings have important significance for researching the growth, development, heredity and photosynthesis of plants, and provide potential application value for further utilizing a genetic engineering means to cultivate high-photosynthetic-efficiency crop varieties.

Drawings

FIG. 1 shows the results of analysis of the pigment contents in the aerial parts of wild type and mutant asl4 in the two-leaf and three-leaf phases, FW being the fresh weight;

FIG. 2 is an electron microscope image of the three-leaf stage wild type and mutant asl4 leaf chloroplast ultrastructure; wherein A is wild type three-leaf stage leaf chloroplast ultrastructure observation, B, C and D are mutant asl4 three-leaf stage leaf chloroplast ultrastructure observation, SG is starch granule, NC is normally developed chloroplast, UC is undifferentiated chloroplast, CW is cell wall, OG is osmyl granule;

FIG. 3 is the map-based cloning result of ASL4 gene; wherein, A is the initial positioning of ASL4 gene; b is the fine positioning of ASL4 gene; c is candidate gene prediction of a positioning interval; d is the candidate gene ORF3, i.e. the structure and mutation position of ASL 4;

FIG. 4 shows the PCR amplification result of specific InDel primer of rice seedling lethal gene ASL4, wherein 1 is PCR amplification product of common rice, and 2 is PCR amplification product of homozygous rice containing seedling lethal gene;

FIG. 5 is a vector map of pCAMBIA 1305;

FIG. 6 shows the result of transgene complementation of ASL 4; a is molecular detection and phenotype of wild type, mutant asl4 and transgenic plants; and B is the chlorophyll content analysis of wild type, mutant asl4 and transgenic plants. Com1 and Com2 represent transgenic positive plants, and Com-v is an empty vector transgenic control plant.

Detailed Description

Example 1

1. Material

The methods used in this example are all conventional methods known to those skilled in the art unless otherwise specified, and the materials used for reagents and the like are all commercially available products, and the crop varieties used are all commercially available conventional varieties or varieties preserved in national germplasm banks, if not specified.

2. Method of producing a composite material

2.1 acquisition and phenotypic analysis of lethal mutant asl4 from Rice seedlings

MNU (monomethyl nitrosourea) is used for chemically mutating the rice variety Nongchord 238 to obtain a MNU chemical mutation mutant library (the mutant library is stored and provided by the Rice research institute of agricultural academy of agricultural sciences of Anhui province) of the Nongchong 238, a seedling lethal mutant als4 is obtained from the mutant library, the two-leaf period and the three-leaf period of the mutant show obvious albino phenotype, and the mutant gradually shrinks and dies at the beginning of the four-leaf period. The mutant asl4 was shown to be almost incapable of synthesizing chlorophyll and carotenoids by pigment analysis of wild type and mutant aerial parts in the two-leaf and three-leaf phases (FIG. 1). The ultrastructure of chloroplasts in the three-leaf stage wild type and mutant leaves is observed by a transmission electron microscope, and the fact that the wild type leaves can develop chloroplasts containing normal lamellar structures is found (figure 2A), while the number of chloroplasts in the mutant leaves is reduced, the structures of the chloroplasts are abnormal and the chloroplasts cannot be normally differentiated (figures 2B-D).

The above-mentioned chlorophyll and carotenoid measurement methods are as follows:

① cutting leaves with the same weight from wild type and mutant aerial part leaves in two-leaf period and three-leaf period respectively, dark treating in 5mL 95% ethanol for 48h, and shaking upside down every 12h in the middle;

② 12000 centrifuging at 12000rpm for 2min, measuring absorbance of supernatant at 665nm, 649nm and 470nm with spectrophotometer, and repeating for 3 times;

③ calculating the concentration of each pigment according to the formula chlorophyll a concentration Ca-13.95X D665-6.88X D649, chlorophyll b concentration Cb-24.96X D649-7.32X D665, carotenoid X concentration Cx (1000X D470-2.05 Ca-114X Cb)/245 (wherein D665, D649 and D470 represent absorbance values at 665nm, 649nm and 470nm, respectively);

④ the content of each pigment in the tissue is finally calculated:

chloroplast pigment content (pigment concentration (C) × extract volume × dilution factor)/fresh weight of sample (mg/g).

The transmission electron microscope comprises the following specific operation steps:

① at trilobal stage, fresh leaves of wild type and mutant asl4 are cut into slices of about 2mm, and 2.5% glutaraldehyde solution (formula: 0.2M Na) is used₂HPO₄-NaH₂PO₄(pH 7.2)50mL, 25% (by volume) glutaraldehyde 10mL, ddH₂O is added to 100mL in constant volume, and is stored in dark at 4 ℃) and is fixed for 24 hours at room temperature;

② fixing with 1% (volume ratio) OsO4, dyeing with uranyl acetate, dehydrating with acetone (50% -70% -80% -90% (volume ratio), treating at each concentration for 15min, and dehydrating with 100% acetone for 3 times (30 min each time);

③ embedding the treated sample in resin, and storing in a desiccator;

④ sections were made at 50-90nm using a LEICA microtome, re-stained, and viewed under a Hitachi H-7650 transmission electron microscope.

2.2 genetic analysis and Gene mapping of mutant Gene asl4

The mutant asl4 is selected by multi-generation selfing, the character is stably inherited, because asl4 seedlings are dead and can not reproduce, the heterozygote parents are reserved, the current generation of the heterozygote parents shows a normal wild type phenotype, but the selfing progeny of the heterozygote parents shows the separation of normal and albino plants, and the ratio accords with 3: 1, which indicates that the mutant character is controlled by single recessive nuclear gene.

Utilizing 205 pairs of InDel markers covering 12 chromosomes of rice to screen polymorphism of parent asl4 and rice Nanjing 11 variety, and selecting asl 4/Nanjing 11F₂Performing linkage analysis on 10 albino seedlings in the population, and positioning a target gene on a third chromosome broken arm of the rice; further targeting the gene of interest to the 1.03M region between markers C3-16 and K5 with 92 extreme individuals with albino phenotype (FIG. 3A), expanding the mapping population, designing a new InDel marker, and finally targeting the gene of interest to the 50kb interval between markers K40 and K29 (FIG. 3B); the gene prediction of the localization interval is carried out by an RGAP database, and the localization interval is found to comprise three candidate genes (figure 3C), namely a retrotransposon protein coding gene (LOC _ Os03g20080) and a MYB family transcription factor coding gene(LOC _ Os03g20090) and chloroplast 30S ribosomal protein S1 encoding gene (LOC _ Os03g20100, namely ASL4), wherein the DNA sequence of the chloroplast 30S ribosomal protein S1 encoding gene is shown in SEQ ID No.2, the CDS sequence of the protein encoding gene is shown in SEQ ID No.3, and the amino acid sequence of the chloroplast 30S ribosomal protein S1 is shown in SEQ ID No. 1; further, genome sequencing finds that 2855bp sequence deletion exists in the DNA sequence corresponding to the chloroplast 30S ribosomal protein S1 from 37bp of the 4 th intron to 2312bp downstream of the termination codon TGA (figure 3D), and the deleted part is a key gene sequence causing albinism and death of rice seedlings.

The gene mapping method comprises the following steps:

(1) the extraction method of the total DNA of the plant comprises the following steps:

① at three-leaf stage of seedling stage, selecting extreme individual with albino phenotype from F2 population asl 4/Nanjing 11, sampling by individual plant, placing into 2.0mL EP tube, adding steel ball, freezing with liquid nitrogen, and grinding into powder with sample grinder;

② adding 400 μ L of 2 × CTAB extractive solution (the formula of extractive solution is CTAB 20g, NaCl 81.9g, 0.5M EDTA 40mL (pH8.0), 1M Tris-HCl 100mL (pH8.0), adding ddH2O to reach volume of 1L, sterilizing, and bathing at 65 deg.C for 30min, shaking every 10 min;

③ adding 400 μ L of 24: 1 (chloroform: isoamyl alcohol, v/v), shaking, mixing, and centrifuging at 12000rpm for 5 min;

④ sucking 200 μ L of supernatant into a 1.5mL EP tube, adding 400 μ L of precooled anhydrous ethanol, shaking gently, mixing, standing at-20 deg.C for 30min, centrifuging at 12000rpm for 5min, removing supernatant, air drying precipitate at room temperature, adding 200 μ L of sterilized ddH₂Dissolving O for more than 2h, and storing at 4 ℃ for later use.

(2) The InDel marker development method is as follows:

finding a positioning interval sequence according to a genome sequence of Nipponbare and 9311 of a rice variety published on the Internet, selecting an interval with a difference fragment of more than 3bp and less than 20bp, designing an InDel marker primer by using PrimerPremier5.0 software, and marking the amplified fragment with the size of 120-220 bp;

table 1: partial InDel marker for gene localization

Primer name	Forward sequence (5 '-3')	Reverse sequence (5 '-3')
			C3-16	CGAGGACAGCAGGAATAAGG	AGTTTACGAGTTGCCAAGCA
K5	CGGACTCCTCTGATACGATA	GGCATTTTGCACCATACA
			K20	GGTTTCAGATTTGCCACG	TTCATTCCGCATTTGGTC
K22	ACATCTGAATCTCACAACCGAA	AAAGATCCAAGGAGTATGACGA
			K27	TTGAGGGATACGATTTAGATTC	ATTCGACCTGCCCGTTAGT
K29	CCAACCGTTTCTACGTTGACT	TGTAGCCCGTATGCTCTTCTC
			K31	TTTACTCGCCGCTTTGGAC	CAGCAGGGAGGATTGGGAT
K40	CGGACGACGAGGCGAACC	AGGAGCAGCGTGCGGCTG

(3) The PCR amplification method is as follows:

the PCR reaction system was 10. mu.L, including 2. mu.L (about 20-200ng) of DNA template, 0.5. mu.L of each primer, 1. mu.L of 10 XPCR buffer, and 25mM MgCl₂0.6. mu.L of 1mM dNTP mixture 0.3. mu.L, rTaq 0.1. mu.L, ddH₂O is supplemented to 10 mu L; the PCR reaction program is: 5min at 94 ℃; 30s at 94 ℃, 30s at 55 ℃, 30s at 72 ℃ and 33 cycles; 5min at 72 ℃ and 10min at 4 ℃.

(4) The PCR product detection utilizes polyacrylamide gel electrophoresis, and the specific operation steps are as follows:

① 100mL of 8 mass% polyacrylamide gel electrophoresis working solution (20 mL of 40 mass% acrylamide, 10 XTBE 10mL, ddH)₂O70 mL, 10% by mass AP 1.2mL, TEMED 100. mu.L. Wherein the formula of 40 percent (mass) of acrylamide is as follows: acrylamide 380g, N, N-methylene bisacrylamide 20g, ddH₂O is subjected to constant volume to 1L, and is stored at 4 ℃ for later use after being filtered; 10 XTBE formulation Tris base 108g, boric acid 55g, 0.5MEDTA 40mL (pH8.0), ddH₂O is subjected to constant volume to 1L and is stored at 4 ℃ for later use; the 10% (by mass) AP formulation was ammonium persulfate 10g, ddH₂And (4) metering the volume of O to 100mL, and storing at 4 ℃ for later use.

② electrophoresis detection, pouring the gel working solution into a gel tank after preparation, inserting a comb, standing for more than 30min, adding 2 μ L of 6 × loading buffer solution into PCR product, mixing, loading 2 μ L, and performing 230V electrophoresis for 70 min.

③ silver staining and developing by ddH₂O configuration of one thousandth mass concentration of AgNO₃The volume of the staining solution (used as prepared) is 50-100mL per two pieces of glue; the rubber block is discharged into the prepared dyeing liquidGently shaking and dyeing at 30rpm for 12 min; pouring off the staining solution, ddH₂Rinsing with O for 2-3 times, removing residual liquid, adding color developing solution (100mL color developing solution formula: NaOH1.5g, formaldehyde solution 1mL, ddH) with the same volume as the dyeing solution₂Supplementing O to 100mL), and slightly shaking at 30rpm to develop color until a strip appears; removing color developing solution, cleaning the rubber block with tap water for 2-3 times, storing the rubber block with preservative film, air drying, and reading data.

2.3 cloning of the Gene encoding chloroplast ribosomal protein ASL4

Designing a cloning primer according to a rice Nipponbare sequence published on the Internet and the coding gene of the ASL4 protein in the step 2.2:

SEQ ID NO.8：ASL4-F：5’-ATGGCGTCCCTGGCGCAGCACGT-3’

SEQ ID NO.9：ASL4-R：5’-CTATTCATCTGTGGTTTGCCC-3’

respectively taking wild type genome DNA and cDNA as templates for PCR amplification, recovering the amplified product, connecting the amplified product to a blunt end vector pEasy for sequencing, and obtaining a genome sequence of ASL4 shown in SEQ ID NO.3 and a CDS sequence of ASL4 shown in SEQ ID NO.2, wherein the result is consistent with a prediction result.

2.4 cloning of lethal Gene sequences from Rice seedlings

Designing a plurality of pairs of primers according to a Nipponbare sequence published on the Internet and a gene sequence lethal to the rice seedlings obtained in the step 2.2, carrying out PCR amplification on the wild farm 238 and the mutant asl4, and selecting the primers capable of amplifying to obtain different fragments as InDel markers:

SEQ ID NO.4：asl4-F：TGTGGAGGTCGATGAGGAA

SEQ ID NO.5：asl4-R：GAGGGAGTATAAGATTGGTGAGAA

2.5 detection of lethal Gene sequence of Rice seedling

The nucleotide sequences SEQ ID NO.4 and SEQ ID NO.5 are used as front and rear primers for gene detection, the genomic DNA of the common rice and the genomic DNA containing the rice seedling lethal gene is amplified by PCR and is subjected to agarose gel electrophoresis detection, and the nucleotide sequence with the size of 3348bp shown as SEQ ID NO.6 and the nucleotide sequence with the size of 493bp shown as SEQ ID NO.7 are obtained (figure 4).

The gene detection method comprises the following steps:

① PCR reaction system is 50 μ L, DNA template is 3 μ L (50-200ng), front and back primers (10pM) are 2.5 μ L each, KOD buffer is 25 μ L, 2mM dNTP mixture is 10 μ L, KOD enzyme is 1 μ L, ddH2O is added to make up to 50 μ L, reaction program is 94 ℃ 3min, 98 ℃ 10s, 60 ℃ 30s, 68 ℃ 1-4min (1kb/min), 33 cycles, 68 ℃ 7min, 4 ℃ 10 min.

② electrophoresis detection, weighing 1g agarose, adding 100mL 1 XTBE buffer solution, mixing uniformly, heating by a microwave oven until the solid is completely dissolved, adding 5uL Genecoour nucleic acid fuel, shaking gently and mixing uniformly, pouring into a gel tank, placing for 30min after gel preparation, adding 2-4uL 6 × loading buffer into PCR products, mixing uniformly, loading for 5uL electrophoresis at 160V for 40min, observing recorded data, and recording data by photographing by a Bio-RAD gel imaging system.

And (3) carrying out genotype identification according to an agarose gel electrophoresis result of the PCR product, wherein the rice is wild type common rice if only containing 3348bp strips, is homozygous als4 genotype rice if only containing 493bp strips, and is heterozygous rice containing rice seedling lethal genes if containing 3348bp and 493bp strips.

2.6 functional verification of ASL4 Gene

The genome sequence 6124bp (comprising 1523bp promoter region, complete coding region and 638bp termination region) of wild-type ASL4 is homologously recombined into a vector pCAMBIA1305 (the vector map is shown in figure 3), and a plant expression vector pCAMBIA1305-gASL4 containing ASL4 gene is obtained.

Preparing callus by using the heterozygote parent seeds, detecting the genotype of the callus by using the method in the step 2.5, selecting the callus containing the homozygous asl4 genotype, and transforming pCAMBIA1305-gASL4 into the callus by using an agrobacterium-mediated method; at the same time, the empty vector pCAMBIA1305 was transformed into a callus containing homozygous asl4 genotype in the same manner as a control to obtain transgenic plants.

Further detecting the transgenic single plant by using molecular marker KF, wherein the result shows that no wild type band is detected in the transgenic control plant, and the phenotype and chlorophyll content have no obvious difference with the mutant; however, wild-type bands were detected in pCAMBIA1305-gASL4 transgenic plants, these individuals were positive plants, and analysis showed that the phenotype of these positive plants was restored to normal levels (FIG. 6A) and chlorophyll content was restored to normal levels (FIG. 6B).

The molecular marker KF sequence is:

SEQ ID NO.10：KF-F：5’-TGCAACCAGGAGATACGCTCA-3’

SEQ ID NO.11：KF-R：5’-CTAAGATGCCCTCTGAACTGA-3’

3. conclusion

The present invention utilizes MNU chemical mutation mutant library of farm yard 238 to obtain lethal rice seedling mutant material, and through multiple generation selfing selection, stable character inheritance is obtained. The mutant is subjected to genetic mapping and gene prediction, and as a result, a novel functional gene of the invention is found, wherein the gene is a gene encoding chloroplast 30S ribosomal protein S1. Further genome sequencing was performed on the mutant, and as a result, it was found that the sequence of 2855bp from 37bp of intron 4 to 2312bp downstream of TGA of the DNA sequence of the gene was deleted. Finally, an ASL4 genome complementary vector (pCAMBIA1305-gASL4) is constructed by utilizing a transgenic technology and is transformed into a homozygous ASL4 deletion mutant, the phenotype and the chlorophyll content of a transgenic positive plant are found to be recovered to a normal level, and the ASL4 gene is further proved to be a new gene (chloroplast 30S ribosomal protein S1 encoding gene) related to chlorophyll synthesis and chloroplast development, so that a basis is provided for researching the growth, development, heredity and photosynthesis principles of plants and further utilizing a genetic engineering means to cultivate high-photosynthetic-efficiency crop varieties.

The above is a detailed embodiment and a specific operation process of the present invention, which are implemented on the premise of the technical solution of the present invention, but the protection scope of the present invention is not limited to the above-mentioned examples.

SEQUENCE LISTING

<110> institute of Paddy Rice of agricultural science institute of Anhui province

<120> rice chloroplast ribosomal protein and coding gene and application thereof

<130>/

<160>11

<170>PatentIn version 3.3

<210>1

<211>402

<212>PRT

<213>Oryza sativa

<400>1

Met Ala Ser Leu Ala Gln His Val Ala Gly Leu Ala Ser Pro Pro Leu

1 5 10 15

Ser Gly Ala Pro Arg Arg Arg Pro Ala Ala Pro Thr Arg Pro Ser Ala

20 25 30

Leu Val Cys Gly Thr Tyr Ala Leu Thr Lys Glu Glu Arg Glu Arg Glu

35 40 45

Arg Met Cys Gln Leu Phe Asp Glu Ala Ser Glu Arg Cys Arg Thr Ala

50 55 60

Pro Met Glu Gly Val Ser Phe Ser Pro Glu Asp Leu Asp Ser Ala Val

65 70 75 80

Glu Ser Thr Asp Ile Asp Thr Asp Ile Gly Ser Leu Ile Lys Gly Thr

85 90 95

Val Phe Met Thr Thr Ser Asn Gly Ala Tyr Val Asp Ile Gln Ser Lys

100 105 110

Ser Thr Ala Phe Leu Pro Leu Asp Glu Ala Cys Leu Leu Asp Val Asn

115 120 125

His Ile Glu Glu Ala Gly Ile Arg Ala Gly Leu Val Glu Glu Phe Met

130 135 140

Ile Ile Asp Glu Asn Pro Gly Asp Glu Thr Leu Ile Leu Ser Leu Gln

145 150 155 160

Ala Ile Gln Gln Asp Leu Ala Trp Glu Arg Cys Arg Gln Leu Gln Ala

165 170 175

Glu Asp Val Val Val Thr Gly Lys Val Ile Gly Gly Asn Lys Gly Gly

180 185 190

Val Val Ala Leu Val Glu Gly Leu Lys Gly Phe Val Pro Phe Ser Gln

195 200 205

Val Ser Ser Lys Ser Thr Ala Glu Glu Leu Leu Asp Lys Glu Leu Pro

210 215 220

Leu Lys Phe Val Glu Val Asp Glu Glu Gln Gly Arg Leu Val Leu Ser

225 230 235 240

Asn Arg Lys Ala Met Ala Asp Ser Gln Ala Gln Leu Gly Ile Gly Ser

245 250 255

Val Val Leu Gly Thr Val Glu Ser Leu Lys Pro Tyr Gly Ala Phe Ile

260 265 270

Asp Ile Gly Gly Ile Asn Gly Leu Leu His Val Ser Gln Ile Ser His

275 280 285

Asp Arg Val Ala Asp Ile Ser Thr Val Leu Gln Pro Gly Asp Thr Leu

290 295 300

Lys Val Met Ile Leu Ser His Asp Arg Glu Arg Gly Arg Val Ser Leu

305 310 315 320

Ser Thr Lys Lys Leu Glu Pro Thr Pro Gly Asp Met Ile Arg Asn Pro

325 330 335

Lys Leu Val Phe Glu Lys Ala Asp Glu Met Ala Gln Ile Phe Arg Gln

340 345 350

Arg Ile Ala Gln Ala Glu Ala Met Ala Arg Ala Asp Met Leu Arg Phe

355 360 365

Gln Pro Glu Ser Gly Leu Thr Leu Ser Ser Glu Gly Ile Leu Gly Pro

370 375 380

Leu Ser Ser Asp Thr Pro Ser Glu Gly Ser Gly Glu Gly Gln Thr Thr

385 390 395 400

Asp Glu

<210>2

<211>3963

<212>DNA

<213>Oryza sativa

<400>2

atggcgtccc tggcgcagca cgtcgcgggg ctggcgagcc cgccgctctc cggcgcgccg 60

cggcgccgcc ccgcggcgcc cacgcggccg tcggcgctgg tgtgcgggac gtacgcgctc 120

accaaggagg agcgggagcg ggagcggatg tgccagctgt tcgacgaggc ctccgagcgc 180

tgccgcaccg cgcccatgga gggcgtctcc ttctcgcccg aggacctcga ctccgccgtc 240

gagtccaccg acatcgacac cgatatcggc tcactcgtaa tccacccccc gcaaccttcc 300

tcctgttctt ctcaatcgtc cttgctcgct cgtatgatgt gaaacagata gtagcaattg 360

gtgcttaaaa acaggcttaa ctttcagtag gtgatgcctc gttttcctgc aagtcacttg 420

agtcttacct tgtgctcaat tggatacggc ttgcgggaga ttggagtcac ttgccctgta 480

tatgtcacta gttgttacat ttcggtttgc tagttgtttt aggctatcaa caacaaggtg 540

attggttact gaaagttacc caactagaat tctattgttt gcttgcttgg aatgtgctct 600

gcgcatcatg attcgtctat aatgtgttac tcccctaagg tacaagcgaa agaatgttca 660

gtttactaca agtacctctt ccattttctg acctgctcat agtggtagca ggtatagtga 720

taatcaggaa tagtagtttc attagccctt acctgttatg ttttgccttt tgtgaaacta 780

gttgaacgct agaactcacg caattgtgtg gcttcatcta aataatttag ttgttttttc 840

aataatgttt actaaaaaaa tatatatgta ggtctgatac ttcaaataag agcaatacat 900

ggccatatca tattcctcta taggctggag atttatacga tagctatgta ttcagtgtaa 960

gctagagtag ttcatattaa tttgatgtac tttaaattaa gcttgacttt tgattcaatt 1020

ctggtgaatt agacttgaac ggcgaattcc cttttttacc tccttgggga tgatacctta 1080

ttggaggctt ggagcaagag tttgatctac caaaagcgtg tggtttttat ttgtgtttgc 1140

tacatcctct ctttgattgc ttccgcacgt gtaccaagtt atacgaacat catacatatg 1200

cctacctcac cctcatggcc tcacaccggt caccaatcca tcagggcata gatatttctt 1260

tgaagcatga atatgcataa ggtccaaagc acatgtagga tgttcatgta catgtaattt 1320

ccatcaaaaa ggggtttccc cttcaaaaga tagaaatgtc cttgaaatgt catacaggtg 1380

gggtctgttt ttcttcttta tatagttatt ttctcctttt ttttaaaaaa aaaacaaagc 1440

caaattcaca ttaaatgata gttaaagtaa gctggagttg atccattgat ccattccctg 1500

tagtaactag ctgaccatgg taaccccaaa ctcgatgaga tttcagttac tgaccgattg 1560

ctgcttgtct tgactgtaat tatttatgtc tatttaaata agaattgctt actatttatc 1620

aaccaatatt atactcaata atcagctata catctcttat acgttacaaa tgcacatgga 1680

cacaaaaact cattttgtcc agctgccaga tttgcattga tccttagaat tttgctctgt 1740

tagcaatgat tctgctgtta gtatctcctt ttgggcatgc agtactgtta tctttgctgc 1800

aatattttgt gctatgttgg tattataaga tactgttcat attgcaaatt ttgtatagtt 1860

tctcatatat tgtattattc tatccttttt ttttgaaacg atgtattact ctatccttaa 1920

catctaaaaa ctatcatgtt cttgcaatct ctacagatta aaggaacagt gttcatgacc 1980

acttcaaatg gtgcatatgt tgatatccaa tcgaagtcta ctgctttctt gcctttggat 2040

gaggcatgcc ttctcgatgt caaccatata gaagaggcag ggatccgtgc aggtttggta 2100

gaagagttca tgattattga cgagaatcct ggtgatgaaa ctttgatttt gagcttacaa 2160

gcaattcagc aagaccttgc ctgggaaagg tgcagacagc ttcaagcaga agatgttgtt 2220

gtcacgggta aagtgagtaa aaatacttgc agaaggaaat atttctgtgc tattactatt 2280

gttcttcact actcctttaa tagcttgctg ttgttaaact tgtaaccaaa tgtttgttaa 2340

gcactacttc ttcttgccca ccgtttcggt tctaacaatc aggctttgtc cttgaatcta 2400

tccctcacag cagcagccat tgtcctttaa tgaaaagaaa ttattcaagt ggtaatttat 2460

ggtgtacata ttttatgaca tccaacccat gatttcataa tttctatatt tgtgctgctg 2520

tttacttggt agagcttact gatcaggtac tgagatcgtc tatagatgcg acaatgacca 2580

gaaatttttt gtttttattg gactattgtg attttgttgg tttgttcctg tgcaactagc 2640

aatgaactcc tgaagtctag accagtcact ttgtaacaac atatcaaaaa atccttttgc 2700

aagagcttat atgattgtat gcttagtttt attgggatga atttgctgta atgtattagt 2760

ctgcggttac ctgacttgtt catttggcaa tgttgccccg caggtaattg gtggaaacaa 2820

aggaggtgtg gtagctcttg tggagggcct taagggattt gttccatttt cacaagtgtc 2880

atcggttggt tctcaatctt attagttact acaaaacttt cttgcatcct atggttttag 2940

gtgtatgtgc atgtgcatgg catgagctgc ctttcatctg caggtcaaag ttgttatgca 3000

gataactgaa catttgatcc tagtttccaa tgcttagttc tcaatcacat tgtaaacact 3060

agctgcccac tattttacaa accacttctt gaccttgatc agaaatcaac tgctgaagaa 3120

ctgcttgaca aagaactacc tctgaagttt gtggaggtcg atgaggaaca aggcaggctt 3180

gtcctcagta accgcaaggc aatggcagat agtcaagctc agcttggtat tggttcagtt 3240

gtcttgggaa ctgtcgagag cctgaaacct tatggtgcat ttatcgacat tggtggaatc 3300

aatggccttc tccatgtcag ccagattagt catgaccgtg ttgcggacat ctcgacagtt 3360

ctgcaaccag gagatacgct caaggtattt tttgcattcg tacttgagaa aagtatacta 3420

tctaaagttt atagagctaa ggccagagta ttttttttaa atgctattag gttatgattc 3480

taagccatga ccgtgaaaga ggccgtgtta gtctttctac taaaaagctt gagccgacac 3540

ctggtgacat gattcgcaat ccaaagcttg tttttgagaa ggtaagtttg aaagcaatat 3600

tccttgatct ggtccatctg gaatgtatac aaactgacat actgttttct ctgtctcaaa 3660

acaggctgat gagatggctc agatattcag gcagaggata gctcaagcag aggcaatggc 3720

tcgtgctgat atgttaagat tccagcctga ggtactgcca tcatcatttt attgaggctg 3780

caaaatgaaa tttatctgac attattcata agccactgca gtaacatttg gctgaattaa 3840

attgtttctc cctgtatctc ttcacagagt ggattaactc tcagttcaga gggcatctta 3900

gggccattat catcagacac accttctgag ggctcgggag aagggcaaac cacagatgaa 3960

tag 3963

<210>3

<211>1209

<212>DNA

<213>Oryza sativa

<400>3

atggcgtccc tggcgcagca cgtcgcgggg ctggcgagcc cgccgctctc cggcgcgccg 60

cggcgccgcc ccgcggcgcc cacgcggccg tcggcgctgg tgtgcgggac gtacgcgctc 120

accaaggagg agcgggagcg ggagcggatg tgccagctgt tcgacgaggc ctccgagcgc 180

tgccgcaccg cgcccatgga gggcgtctcc ttctcgcccg aggacctcga ctccgccgtc 240

gagtccaccg acatcgacac cgatatcggc tcactcatta aaggaacagt gttcatgacc 300

acttcaaatg gtgcatatgt tgatatccaa tctaagtcta ctgctttctt gcctttggat 360

gaggcatgcc ttctcgatgt caaccatata gaagaggcag ggatccgtgc aggtttggta 420

gaagagttca tgattattga cgagaatcct ggtgatgaaa ctttgatttt gagcttacaa 480

gcaattcagc aagaccttgc ctgggaaagg tgcagacagc ttcaagcaga agatgttgtt 540

gtcacgggta aagtaattgg tggaaacaaa ggaggtgtgg tagctcttgt ggagggcctt 600

aagggatttg ttccattttc acaagtgtca tcgaaatcaa ctgctgaaga actgcttgac 660

aaagaactac ctctgaagtt tgtggaggtc gatgaggaac aaggcaggct tgtcctcagt 720

aaccgcaagg caatggcaga tagtcaagct cagcttggta ttggttcagt tgtcttggga 780

actgtcgaga gcctgaaacc ttatggtgca tttatcgaca ttggtggaat caatggcctt 840

ctccatgtca gccagattag tcatgaccgt gttgcggaca tctcgacagt tctgcaacca 900

ggagatacgc tcaaggttat gattctaagc catgaccgtg aaagaggccg tgttagtctt 960

tctactaaaa agcttgagcc gacacctggt gacatgattc gcaatccaaa gcttgttttt 1020

gagaaggctg atgagatggc tcagatattc aggcagagga tagctcaagc agaggcaatg 1080

gctcgtgctg atatgttaag attccagcct gagagtggat taactctcag ttcagagggc 1140

atcttagggc cattatcatc agacacacct tctgagggct cgggagaagg gcaaaccaca 1200

gatgaatag 1209

<210>4

<211>19

<212>DNA

<213> Artificial sequence

<400>4

tgtggaggtc gatgaggaa 19

<210>5

<211>24

<212>DNA

<213> Artificial sequence

<400>5

gagggagtat aagattggtg agaa 24

<210>6

<211>3348

<212>DNA

<213>Oryza sativa

<400>6

tgtggaggtc gatgaggaac aaggcaggct tgtcctcagt aaccgcaagg caatggcaga 60

tagtcaagct cagcttggta ttggttcagt tgtcttggga actgtcgaga gcctgaaacc 120

ttatggtgca tttatcgaca ttggtggaat caatggcctt ctccatgtca gccagattag 180

tcatgaccgt gttgcggaca tctcgacagt tctgcaacca ggagatacgc tcaaggtatt 240

ttttgcattc gtacttgaga aaagtatact atctaaagtt tatagagcta aggccagagt 300

atttttttta aatgctatta ggttatgatt ctaagccatg accgtgaaag aggccgtgtt 360

agtctttcta ctaaaaagct tgagccgaca cctggtgaca tgattcgcaa tccaaagctt 420

gtttttgaga aggtaagttt gaaagcaata ttccttgatc tggtccatct ggaatgtata 480

caaactgaca tactgttttc tctgtctcaa aacaggctga tgagatggct cagatattca 540

ggcagaggat agctcaagca gaggcaatgg ctcgtgctga tatgttaaga ttccagcctg 600

aggtactgcc atcatcattt tattgaggct gcaaaatgaa atttatctga cattattcat 660

aagccactgc agtaacattt ggctgaatta aattgtttct ccctgtatct cttcacagag 720

tggattaact ctcagttcag agggcatctt agggccatta tcatcagaca caccttctga 780

gggctcggga gaagggcaaa ccacagatga atagcttcaa taggaagatt acgtctgagt 840

agaaagctgt gatggtagct catcaactca ttttcccacg atctaaaagg catgaagaag 900

acctattgta ttccaaccat ttcccatctt cgatctgtgc ttgtatcaat caatgtgtat 960

gaaagtaaag ttactgaaag aaatggatgt tgcttccctg ttgtaaagtt gtccaacact 1020

tgcagaaagg cctcccaaag gcccaattgt agttggactt tcagttcagc atctctattt 1080

cctgcactat agccttttct ggattaggcg tctatttctg ctcaaaatgg agagcaaaca 1140

gtggagagat ttgcaacgta gaccagtttt cgggtaggta acctgtgtaa agttcaaaca 1200

gcaagtagtt cacggaagcc atcaacacaa gccaagtttg cctgctacgc ctggttgtag 1260

aagacggtct ggtgttaatc cctacaggtg aaaaagggat aggagacttg ttttagttgg 1320

ctacaatccc agcagcacgt tgtcatccca ggtgtccaca aaagggcaat gctgtttcac 1380

caaagagagg accataaatt aaagcaaaga gagaaccaaa ctcgatcgct tttgtaactt 1440

cgcaggttga cattggataa acccttcctt ttcatggcac aggaacagaa actatttaaa 1500

accgcttaaa aaccgtttgc ttgtgtgtgc aaaccctcgc cctttaattt gttcaaacat 1560

atcaagctgc caaacctgac aagtttcact gaaagcgcca tccactattt tcactctcac 1620

gtaccaaaca tcaaattgtt ttttcttctc ctcacagcag cagcatagct atctatcaag 1680

ccggccagcc acacagaaaa tgcatgtcaa ctctgcttaa ccatccgctt tctcaaaaaa 1740

gggatttgac gtacgtcttc gcctccatgc tcagtagtac tgatctatcc ggtttgatca 1800

acttgggtac ggtgtgtgtc ataccgtcat tgtgtcaatt acgctcaatc acgcgtcctg 1860

aaccaaacca aaccaggaga gctaccaaac tctgaaacag atagcagcaa gctgaacttt 1920

ttatgttttg gctctttttt aaaacttatt ttacatacgg ccctatgaga aacttatttt 1980

agaaattaat ccttttttga cgccagtggt ccaatgcctc gacaccaatg acgctggtgt 2040

caacaccctc gccccctata gccaagatat aggggataac actaatctct ttagtgttgt 2100

gaacctattt gtacaatgat cttttaaaat ggtcaaaaca taaatacttt tattataatt 2160

aggttctcga cgtaaaaaag ctagtacaga gagactataa aaatatttac atttgaacct 2220

ttttgaaaac tttttttaca aataagtcct cggttccaac acccatcaca ttagcgactt 2280

agatatccag agagctaggg tatcggtgct aagatattgg accttgatgt tgagaaaaca 2340

ggatccattt ttaaaataag ttttgtcgta gggaaataaa ttttcaaaaa accaaaacat 2400

aaaaaaaaaa tccagtagca gcaagcatgg atgagctagc cgctgctggt ggtgtcagtc 2460

actttcccaa ggcgcgtttt ttctaagccc ttgtctccac tgcagattaa tcaatccagt 2520

tttgagctct ctgattctga tcaagtgctt tccccccggt aatggcatct tcaggtggac 2580

ctactgttca cgcacgctcg ctctcacgtc gtcggtccgt ccgtcgcccg ccgacgcgtc 2640

gtcgatcgac cgatcagtcg tacgtctccg ccgccccccc cccccccccc cggcgcgcat 2700

ccgccggccc gtgcgtgagt gggggttgga attcaggata agccacgtac caccttctct 2760

cgcctgcaac ttgccgcgca agatgaggcc gatcgacggc gacggcgacg agatcatgca 2820

ggcagcaacg gagagacgag gccggcccgg ggctttctcc gtgcgtggca atgtcgtcgt 2880

gtggatcgta gtagctgtca gctcaaagcc gccgtgcaag tgtgtacttg cctggccgtg 2940

tcgatcagtc acaaagctaa gctattggct cggccctgtg catccccagg ggtcactact 3000

cactagcgat ggctaattgg cttggctttg gctggtgttt agtttgacca cgcacagtgt 3060

agctatagtt tagcttagct tagctaggcc actgctctgc ttgcctgcat gatagcctgc 3120

tcgataatta gcattagaca aacggtgagt acgttgatca tccaggaacc gaagagggat 3180

taggtcccat tgcacaacat acgcatacag agaacgatac gggtcataca gtctatgcaa 3240

gtaatcagcc gcagactttt ttactcctca gaaaacaata aaaaagaaag gcacacactt 3300

ttcagttgct atttgatcac tttcttctca ccaatcttat actccctc 3348

<210>7

<211>493

<212>DNA

<213>Oryza sativa

<400>7

tgtggaggtc gatgaggaac aaggcaggct tgtcctcagt aaccgcaagg caatggcaga 60

tagtcaagct cagcttggta ttggttcagt tgtcttggga actgtcgaga gcctgaaacc 120

ttatggtgca tttatcgaca ttggtggaat caatggcctt ctccatgtca gccagattag 180

tcatgaccgt gttgcggaca tctcgacagt tctgcaacca ggagatacgc tcaaggtatt 240

ttttgcattc gtacttgaga aaagtatact aattagcatt agacaaacgg tgagtacgtt 300

gatcatccag gaaccgaaga gggattaggt cccattgcac aacatacgca tacagagaac 360

gatacgggtc atacagtcta tgcaagtaat cagccgcaga cttttttact cctcagaaaa 420

caataaaaaa gaaaggcaca cacttttcag ttgctatttg atcactttct tctcaccaat 480

cttatactcc ctc 493

<210>8

<211>23

<212>DNA

<213> Artificial sequence

<400>8

atggcgtccc tggcgcagca cgt 23

<210>9

<211>21

<212>DNA

<213> Artificial sequence

<400>9

ctattcatct gtggtttgcc c 21

<210>10

<211>21

<212>DNA

<213> Artificial sequence

<400>10

tgcaaccagg agatacgctc a 21

<210>11

<211>21

<212>DNA

<213> Artificial sequence

<400>11

ctaagatgcc ctctgaactg a 21

Claims (5)

1. The application of the coding gene of the rice chloroplast ribosomal protein in cultivating high-photosynthetic-efficiency crop varieties is characterized in that the amino acid sequence of the rice chloroplast ribosomal protein is shown as SEQ ID No. 1.

2. The application of the coding gene of the rice chloroplast ribosomal protein in cultivating high photosynthetic efficiency crop varieties according to claim 1, wherein the DNA sequence of the coding gene of the rice chloroplast ribosomal protein is shown as SEQ ID No.2, and the CDS sequence of the coding gene is shown as SEQ ID No. 3.

3. A seedling lethal gene of rice, wherein the seedling lethal gene has a sequence from the 37 th base of the 4 th intron of the DNA sequence of the coding gene of claim 2 to the 2312 th base downstream of the stop codon.

4. A specific InDel marker for identifying a gene sequence lethal to rice seedlings according to claim 3, wherein the upstream nucleotide sequence of the InDel marker is shown as SEQ ID No.4, and the downstream nucleotide sequence is shown as SEQ ID No. 5.

5. A method for identifying a gene sequence lethal to rice seedlings according to claim 3, comprising the steps of: the specific InDel labeled primer is used for carrying out PCR amplification on rice genome DNA, and if a 493bp nucleotide sequence shown as SEQ ID No.7 is obtained, the rice contains the seedling lethal gene sequence.

Images