CN107267661B

CN107267661B - SSR molecular marker for detecting fertility of beet stamens and application thereof

Info

Publication number: CN107267661B
Application number: CN201710719514.6A
Authority: CN
Inventors: 陈丽; 王希; 赵春雷
Original assignee: Sugar Beet Research Institute Of Chinese Academy Of Agricultural Sciences; Heilongjiang University
Current assignee: Sugar Beet Research Institute of Chinese Academy of Agricultural Sciences
Priority date: 2017-08-21
Filing date: 2017-08-21
Publication date: 2020-10-09
Anticipated expiration: 2037-08-21
Also published as: CN107267661A

Abstract

An SSR molecular marker for detecting beet stamen fertility and application thereof relate to an SSR molecular marker for detecting beet stamen fertility and application thereof. The invention aims to solve the problem that the fertility of the beet stamens is not easy to identify due to the lack of the related molecular markers of the fertility of the beet stamens. The primer pairs used for PCR amplification of the molecular marker are BvRE033-S and BvRE 033-A. The SSR molecular marker is used for identifying the fertility of the stamens of the beet. The SSR molecular marker detection result of the invention has 71.67 percent of consistency with the fertility character expression of the beet stamen, and respectively reaches 53.33 percent and 90 percent in fertile and sterile individuals. The marker is shown to have a linkage relation with the stamen fertility and can be used for detecting the stamen fertility. The invention is used for detecting the fertility of the beet stamens.

Description

SSR molecular marker for detecting fertility of beet stamens and application thereof

Technical Field

The invention belongs to the technical field of molecular markers, and relates to an SSR molecular marker for detecting fertility of beet stamens and application thereof.

Background

The beet (Beta Vulgaris) has a dual pollination approach of aeolian pollination and entomophilous pollination and is very easy to hybridize, so that the fertility of stamens is identified, male sterile germplasm is obtained, the hybrid breeding of the beet is very important, the accuracy of a hybridization result can be ensured by hybridizing a male sterile line as a female parent, the labor amount is saved, and the success rate is improved. However, the acquisition of sugar beet male sterile lines and corresponding maintainer lines is time consuming and laborious and is deficient in germplasm resources. The male sterile material in China mainly comes from 5 approaches: foreign introduction, natural mutation of male sterile plants, hybrid progeny separation, chemical mutagenesis and physical mutagenesis.

With the acquisition of male sterile germplasm, the genetic mechanism of male sterility is also under study. Male sterility is classified into 2 types by the cause of formation: nuclear-type male sterility and cytoplasmic-nuclear interactive male sterility (also called cytoplasmic male sterility). In application, cytoplasmic-nuclear interaction male sterility is theoretically easier to operate by matching with a maintainer line. For beet, the germplasm of the sterile line and the germplasm of the maintainer line are still relatively deficient, and the current method for identifying the fertility of the stamens is mainly based on classical morphological observation, has high difficulty and low efficiency, is limited by the growth stage of plants, is mainly the growth habit of two years of beet, and has large workload and long period of fertility identification.

Owen and Bliss successively proposed the hypothesis of the genetic mechanism of sugar beet cytoplasmic-nuclear interaction type male sterility, and it is believed that both the cytoplasm and nucleus of sugar beet have alleles for controlling fertility, and the existence and interaction of different alleles affect the fertility of the stamen of sugar beet and influence the fertility to different degrees, so that the sugar beet has different types of fertility, sterility, semi-fertility, semi-sterility, etc. However, these genes encoding fertility control have not been identified so far, and the molecular mechanism has not been clarified.

Under the conditions of long character detection period, high difficulty and unknown molecular mechanism for controlling characters, the molecular marker plays an important role in researching beet fertility in two aspects: on one hand, the kit can be directly used as a tool for predicting the beet fertility, and the result accuracy is improved and the workload is reduced by the auxiliary selection of molecular markers; on the other hand, as sequence information and starting materials, fertility-related genes are mined by a method such as genome walking.

Currently, few molecular markers related to fertility are developed in beet, most researches are carried out around an allele locus Rf1, the researches focus on the genetic mechanism research of the existing sterile line and maintainer line, and the auxiliary effect on fertility identification is very limited. Therefore, the development of molecular markers related to fertility is self-determined, and the development and utilization of the beet male sterile germplasm in China are facilitated.

Disclosure of Invention

The invention provides an SSR molecular marker for detecting the fertility of beet stamens and application thereof, aiming at solving the problems that the fertility of the beet stamens is not easy to identify due to the lack of the existing molecular marker related to the fertility of the beet stamens.

The invention develops Simple Sequence Repeat (SSR) candidate markers by using a high-throughput sequencing technology and uses F₂Separating population screens SSR molecular marker BvRE033 related to beet stamen fertility, obtains the sequence of marker amplification region and carries out genome positioning. The molecular marker can be used for detecting beet male sterile individuals.

The invention discloses an SSR molecular marker for detecting beet stamen fertility, wherein primer pairs for PCR amplification of the molecular marker are BvRE033-S and BvRE033-A, and the specific sequence is as follows:

BvRE033-S：5'-ACGAGGCATGTAGGTTACCG-3'

BvRE033-A：5'-TCTCTCACGTTCTCCATCCC-3'。

the application of the SSR molecular marker for detecting the fertility of the beet stamens is used for identifying the fertility of the beet stamens.

The specific identification method comprises the following steps:

firstly, separating and extracting total DNA from young leaves of the beet, and if the leaves are difficult to obtain, replacing the leaves with other parts;

secondly, the DNA obtained in the step one is used as a template, primers BvRE033-S and BvRE033-A are adopted for PCR amplification,

thirdly, separating the PCR amplification product obtained in the second step by using polyacrylamide gel electrophoresis (PAGE), judging the result according to the size of the amplification product, and if only a band of 186bp is detected, judging that the stamen is sterile; if a band of 270bp and a band of 240bp are detected in addition to the band of 186bp, it is judged that the stamen is fertile.

In the second step, the primer BvRE033-S is 5'-ACGAGGCATGTAGGTTACCG-3', and the primer BvRE033-A is 5'-TCTCTCACGTTCTCCATCCC-3'.

Further, the conditions of the PCR amplification reaction in step two are: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 57 deg.C for 1min, extension at 72 deg.C for 1min, 30 cycles, and final extension at 72 deg.C for 5 min.

The invention has the beneficial effects that:

the SSR molecular marker for identifying the fertility of the beet stamens provided by the invention realizes the rapid and accurate identification of the fertility of the beet stamens, overcomes the defects of the prior art, has high repeatability and good stability of a PCR reaction system and reaction conditions, effectively shortens the identification time, and has an accurate identification method.

The SSR molecular marker detection result of the invention has 71.67 percent of consistency with the fertility character expression of the beet stamen, and respectively reaches 53.33 percent and 90 percent in fertile and sterile individuals. The marker is shown to have a linkage relation with the stamen fertility and can be used for detecting the stamen fertility.

And (3) comparing the sequence of the marker amplification region with the beet genome, and carrying out genome positioning on the marker. The results show that the molecular marker BvRE033 of the invention is positioned in the 31235466-31235674 region of chromosome 9 in the sugar beet genome.

The molecular marker is used for auxiliary selection of beet male sterility or maintainer lines and prediction of fertility potential of beet germplasm, and is also used for auxiliary research of beet male sterility mechanism and mining of beet fertility related genes.

Drawings

FIG. 1 shows the genotyping results of a fertile beet individual;

FIG. 2 shows the genotyping results of sterile individuals of sugar beet.

Detailed Description

The technical solution of the present invention is not limited to the following specific embodiments, but includes any combination of the specific embodiments.

The first embodiment is as follows: the SSR molecular marker for detecting the fertility of the beet stamens in the embodiment has the primer pairs BvRE033-S and BvRE033-A for PCR amplification of the molecular marker, and has the specific sequences as follows:

BvRE033-S：5'-ACGAGGCATGTAGGTTACCG-3'

BvRE033-A：5'-TCTCTCACGTTCTCCATCCC-3'。

the SSR molecular marker related to the fertility of the stamen of the beet is obtained in the embodiment, and the SSR molecular marker is used independently or is used together with other primers, the fertility of the stamen of the beet can be judged in advance through PCR detection, genomic DNA can be extracted as a material in any growth period of the beet, the workload is reduced, and the fertility judgment period is shortened.

The markers can be used to judge fertility of a germplasm or an individual. When the method is used for judging the fertility of the whole germplasm, the judgment can be directly carried out according to the PCR result and the statistical analysis, or the character investigation is carried out on key individuals to supplement the PCR result, and the method does not need to carry out two-year-consuming sowing, mother root cultivation, mother root planting, character investigation of stamen fertility and individual elimination on all individuals; when the method is used for judging the fertility of the beet individual, the method can also be used for pre-judging before blooming and pollen scattering according to the PCR result, so that the scope of character investigation individuals is narrowed.

The location information of the marker can be used for mining fertility genes.

The second embodiment is as follows: the application of the SSR molecular marker for detecting the fertility of the beet stamens in the embodiment is used for identifying the fertility of the beet stamens.

The third concrete implementation mode: the second embodiment is different from the first embodiment in that: the specific identification method comprises the following steps:

firstly, separating and extracting total DNA from young leaves of beet;

thirdly, separating the PCR amplification product obtained in the second step by polyacrylamide gel electrophoresis, and judging whether the male stamen is sterile if only a band of 186bp is detected according to the size judgment result of the amplification product; if a band of 270bp and a band of 240bp are detected in addition to the band of 186bp, it is judged that the stamen is fertile. The rest is the same as the second embodiment.

The fourth concrete implementation mode: the third difference between the present embodiment and the specific embodiment is that: in the second step, the primer BvRE033-S is 5'-ACGAGGCATGTAGGTTACCG-3', and the primer BvRE033-A is 5'-TCTCTCACGTTCTCCATCCC-3'. The rest is the same as the third embodiment.

The fifth concrete implementation mode: this embodiment is different from the third or fourth embodiment in that: the conditions of the PCR amplification reaction in the second step are as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 57 deg.C for 1min, extension at 72 deg.C for 1min, 30 cycles, and final extension at 72 deg.C for 5 min. The other is the same as the embodiment or the fourth.

The following examples are given to illustrate the present invention, and the following examples are carried out on the premise of the technical solution of the present invention, and give detailed embodiments and specific procedures, but the scope of the present invention is not limited to the following examples.

Example 1:

obtaining a large amount of beet sequences through high-throughput sequencing, excavating unreported SSR markers from the beet sequences, screening more than one hundred candidate markers with good quality and polymorphism, and constructing F of beet stamen fertility₂Isolating the population.

Fertile and sterile individuals are selected from the separation generations to construct a mixed pool, and candidate markers are screened by a group mixed segregation analysis (BSA) method, so that 8 SSR markers showing polymorphism among the mixed pool are obtained. And an SSR molecular marker related to the fertility of the beet stamens is selected from the SSR molecular markers and named as BvRE 033.

After investigating fertility of the stamens of the segregating generation, 30 beet of each fertile and sterile individual are marked according to the following method:

firstly, respectively extracting DNA of 30 young beet leaves;

secondly, using the DNA obtained in the first step as a template, and adopting primers BvRE033-S and BvRE033-A to perform PCR amplification, wherein a PCR reaction system is shown in Table 1:

TABLE 1

The conditions of the PCR amplification reaction are as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 57 deg.C for 1min, extension at 72 deg.C for 1min, 30 cycles, and final extension at 72 deg.C for 5 min.

Thirdly, a result detection method: and (3) separating the PCR amplification product obtained in the step two by using polyacrylamide gel electrophoresis, wherein the gel crosslinking degree is 8%, the voltage during electrophoresis is 100V, and the time is 4-5 h. And after electrophoresis, staining the membrane for 15-20 min by using 10mg/L Ethidium Bromide (EB) solution.

The genotyping results of fertile individuals are shown in FIG. 1, where M represents DNA 50bp marker, P₁Indicates female parent (Male sterility), P₂Represents the male parent(Male fertile), 30 fertile individuals are numbered 1-30. The genotyping results of the sterile individuals are shown in FIG. 2, where M represents DNA 50bp marker, P₁Indicates female parent (Male sterility), P₂Represents a male parent (male fertile), and 30 sterile individuals are numbered 1-30.

And (4) genotyping the fertile and sterile individuals of the separated generations respectively, and verifying the consistency of the marker and the fertility character expression. The molecular marker BvRE033 is found to be consistent with the performance of the fertility character of the stamen by 71.67 percent in all individuals, and respectively reach 53.33 percent and 90 percent in fertile and sterile individuals. The marker is shown to have a linkage relation with the stamen fertility and can be used for detecting the stamen fertility.

TABLE 2 detection results of stamen fertility-related markers on plants with different fertility

The sequences of BvRE033 amplification were sequenced as follows (the underlined parts are SSR repeats):

sterility-associated band (186 bp):

ACGAGGCATGTAGGTTACCGATCGAGTGGTGCAACATCGTAGGGCGGGTGATGTTAGTTGTTTTAGGATTTGGAGGGATTGATTTCGAGCCATTTTTTTTGATCCAGAATTTTGTGTTTAGTAATGGAGGAGAAAGAAAGGGTGAG AATGAGAATGAGAATTGGAGGGGATGGAGAACGTGAGAGA

fertile associated band 1(240 bp):

ACGAGGCATGTAGGTTACCGATCGAGTGGTGCAACATCGTAGGGCGGGTGATGTTAGTTGTTTTAGGATTTGGAGGGATTGATTTCGAGCCATTTTTTTTGATCCAGAATTTTGTGTTTAGTAATGGAGGAGAAAGAAAGGGTGAG AATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATTGGAGGGGATGGAGAACGTGAGAGA

fertile associated band 2(270 bp):

ACGAGGCATGTAGGTTACCGATCGAGTGGTGCAACATCGTAGGGCGGGTGATGTTAGTTGTTTTAGGATTTGGAGGGATTGATTTCGAGCCATTTTTTTTGATCCAGAATTTTGTGTTTAGTAATGGAGGAGAAAGAAAGGGTGAG AATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGAGAATGA GAATGAGAATGAGAATGAGAATTGGAGGGGATGGAGAACGTGAGAGA

judging whether the male stamen is sterile if only a 186bp strip is detected according to the size judgment result of the amplified product; if a band of 270bp and a band of 240bp are detected in addition to the band of 186bp, it is judged that the stamen is fertile.

The amplified product and a plant non-redundant nucleic acid database are subjected to blast N comparison analysis, and the result shows that the amplified product of BvRE051 is similar to a mitochondrial isocitrate dehydrogenase-NAD regulatory subunit mRNA of beet, the sequence similarity part is the 1 st-161 bp of the amplified fragment, and the sequence similarity of the part is 99%.

Markers were located based on sequence similarity and were located in the region 31235466 and 31235674 of chromosome 9 in the sugar beet genome.

Sequence listing

<110> university of Heilongjiang

<120> SSR molecular marker for detecting fertility of beet stamens and application thereof

<160>5

<210>1

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> PCR primer BvRE033-S

<400>1

acgaggcatgtaggttaccg 20

<210>2

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> PCR primer BvRE033-A

<400>2

tctctcacgttctccatccc 20

<210>3

<211>186

<212>DNA

<213> Artificial sequence

<220>

<223> sterility-related band sequence

<400>3

acgaggcatg taggttaccg atcgagtggt gcaacatcgt agggcgggtg atgttagttg 60

ttttaggatt tggagggatt gatttcgagc catttttttt gatccagaat tttgtgttta 120

gtaatggagg agaaagaaag ggtgagaatg agaatgagaa ttggagggga tggagaacgt 180

gagaga 186

<210>4

<211>240

<212>DNA

<213> Artificial sequence

<220>

<223> fertile related band 1 sequence

<400>4

acgaggcatg taggttaccg atcgagtggt gcaacatcgt agggcgggtg atgttagttg 60

ttttaggatt tggagggatt gatttcgagc catttttttt gatccagaat tttgtgttta 120

gtaatggagg agaaagaaag ggtgagaatg agaatgagaa tgagaatgag aatgagaatg 180

agaatgagaa tgagaatgag aatgagaatg agaattggag gggatggaga acgtgagaga 240

<210>5

<211>270

<212>DNA

<213> Artificial sequence

<220>

<223> fertile related band 2 sequence

<400>5

acgaggcatg taggttaccg atcgagtggt gcaacatcgt agggcgggtg atgttagttg 60

ttttaggatt tggagggatt gatttcgagc catttttttt gatccagaat tttgtgttta 120

gtaatggagg agaaagaaag ggtgagaatg agaatgagaa tgagaatgag aatgagaatg 180

agaatgagaa tgagaatgag aatgagaatg agaatgagaa tgagaatgag aatgagaatg 240

agaattggag gggatggaga acgtgagaga 270

Claims

1. An SSR molecular marker for detecting beet stamen fertility is characterized in that primer pairs for PCR amplification of the molecular marker are BvRE033-S and BvRE033-A, and the specific sequence is as follows:

BvRE033-S：5'-ACGAGGCATGTAGGTTACCG-3'

BvRE033-A：5'-TCTCTCACGTTCTCCATCCC-3'；

wherein the nucleotide sequence of the fertile related molecular marker is shown as SEQ ID NO: 4 and SEQ ID NO: 5, the nucleotide sequence of the sterility related molecular marker is shown as SEQ ID NO: 3, respectively.

2. Use of an SSR molecular marker for detecting fertility of a sugar beet stamen according to claim 1 for identifying fertility of a sugar beet stamen.

3. The use according to claim 2, characterized in that the specific identification method is:

firstly, separating and extracting total DNA from young leaves of beet;

secondly, performing PCR amplification by using the DNA obtained in the step one as a template and adopting primers BvRE033-S and BvRE 033-A;

thirdly, separating the PCR amplification product obtained in the second step by polyacrylamide gel electrophoresis, and judging whether the male stamen is sterile if only a band of 186bp is detected according to the size judgment result of the amplification product; if a band of 270bp and a band of 240bp are detected in addition to the band of 186bp, it is judged that the stamen is fertile.

4. The use according to claim 3, wherein in step two the primer BvRE033-S is 5'-ACGAGGCATGTAGGTTACCG-3' and the primer BvRE033-A is 5'-TCTCTCACGTTCTCCATCCC-3'.

5. The use according to claim 3, wherein the PCR amplification reaction conditions of step two are: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 57 deg.C for 1min, extension at 72 deg.C for 1min, 30 cycles, and final extension at 72 deg.C for 5 min.