CN114182041B - PARMS molecular marker related to number of ovules of rape per ovary and application - Google Patents
PARMS molecular marker related to number of ovules of rape per ovary and application Download PDFInfo
- Publication number
- CN114182041B CN114182041B CN202111590478.0A CN202111590478A CN114182041B CN 114182041 B CN114182041 B CN 114182041B CN 202111590478 A CN202111590478 A CN 202111590478A CN 114182041 B CN114182041 B CN 114182041B
- Authority
- CN
- China
- Prior art keywords
- ovules
- rape
- ovary
- parms
- per ovary
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Botany (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Theoretical Computer Science (AREA)
- Evolutionary Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Medical Informatics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical fields of molecular biology and genetic breeding, and discloses a molecular marker obviously related to the number of ovules of brassica napus per ovary and application thereof. Sites significantly associated with the number of ovules per ovary of canolaqONPO.A3‑2And the peak SNP marker seq-new-rs32414 is positioned at 16,137,692 base of the A03 chromosome of the rape DarmorV4.1 reference genome, and can explain 8.0% of phenotype variance on average and has an average additive effect of 1.01. The PARMS marker designed by the SNP is used for detecting the rape related population, and the PARMS marker is found to be simple and convenient to operate, clear in typing and good in selection effect on the number of ovules of each ovary of rape.
Description
Technical Field
The invention belongs to the technical fields of molecular biology and genetic breeding, and particularly relates to a molecular marker obviously related to the number of ovules of brassica napus per ovary and application thereof.
Background
Rapeseed oil is the first major source of domestic edible vegetable oil, and accounts for more than 55% of the total vegetable oil production in China (Wang Hanzhong, 2018). However, the self-supply rate of the domestic vegetable oil is less than 35%, and the supply safety of the domestic vegetable oil is seriously threatened. In order to ensure the effective supply of the domestic vegetable oil, the continuous increase of the oil yield per unit area (= unit yield x oil content) is the only way under the condition of increasing the planting area and lack of strength. In recent years, the high oil content breeding of rape in China has broken through (Fu Tingdong, 2014) and the unit yield is still lower than the world average level (http:// apps. Fas. Usda. Gov/psdonline /) and is very slow to increase, which seriously affects the rape planting benefit and the international competitiveness of the rape industry. Therefore, the rape unit yield in China needs to be improved (Yan Yan and Wang Hanzhong, 2012).
Under the same planting density condition, the single yield of rape depends on the single plant yield, and the single plant yield is directly determined by three constituent factors of the number of the whole plant fruits, the number of grains per corner and the grain weight. Although there is a negative correlation to some extent between the three factors of rape yield, the coefficients are often not large, and thus yield can be increased by increasing the yield factor (e.g. number of grains per corner). Studies have shown that the number of grains per horn can be further broken down into the product of four sub-traits, number of ovules per ovary, ratio of fertile ovules, rate of fertility of the fertile ovules, rate of development of the fertilized ovules (Yang Yuhua, 2017). Thus, the number of ovules per ovary of canola is the upper limit on the number of ovules per horn, determining its maximum potential. Yang et al (2017) have performed systematic genetic analysis and cytological observation using 9 material parts at the extreme per number of grains, and have shown that the number of ovules per ovary and the rate of fertilized ovule development are the major factors affecting the number of grains per corner. The identification of the number of ovules per ovary phenotype relative to rape yield constitutes a three factor and cannot be carried out visually, and the number must be counted by prior cumbersome cytologic treatment and observation under a split microscope. Therefore, in order to perform accurate and high throughput screening of ovule numbers per ovary, reliable and practical molecular markers must be developed for assisted selection.
With the continuous development of molecular marker technology, the application of the molecular marker technology in crops is becoming wider and wider. Grodzicker et al (1974) have established a restriction fragment length polymorphism (restriction fragment length polymorphism, RFLP) marker technique. RFLP is a first generation molecular marker and has the characteristics of abundant quantity, stable inheritance, good specificity, good repeatability, co-dominance and the like. However, the amount of DNA required for this labeling is relatively large; the operation procedure is tedious, time-consuming and labor-consuming, and the period is long; the need to label the probe with a radioisotope is also limited by the wide use of RFLP labels. AFLP markers combine PCR and RFLP marker technologies and find wide application in crop genetic diversity studies, cytology studies, variety purity identification, disease resistance and other studies (Song Shunhua et al, 2006; yuan Suxia, 2009; wang Xue, 2004). AFLP markers have some drawbacks: the cost is high, the process is complex, and the technical difficulty is high; most of the markers are dominant markers; the requirements on the quality of DNA and the quality of restriction endonuclease are high. SSR markers, also known as microsatellite DNA markers (microsatellite DNA), have been widely used in studies such as gene localization, molecular marker assisted selection, DNA fingerprinting, variety purity identification, preservation and utilization of germplasm resources, and genetic diversity analysis of crops (Chenli, 2010; miao Tiyun, 2007; jing Zange, 2010; wang Dongmei, 2011). SSR markers have the advantages of abundant quantity, high polymorphism, simple operation, lower cost and the like, but are difficult to realize high-throughput batch detection. Over the last decade, with continued advances in sequencing technology, molecular marker development based on genomic sequence information has become possible, such as SNP markers and InDel markers (Hyten et al, 2010). At present, a whole genome selective breeding chip only starts to try in rice (Yu et al, 2014), and other crops such as rape still mainly adopt molecular marker auxiliary selection. The current SNP detection methods are mainly divided into two main categories: one of the major classes is a conventional classical detection method based on gel electrophoresis, which is represented by single-strand conformation polymorphism (SS CP), denaturing gradient gel electrophoresis (DDGE), cleaved Amplified Polymorphic Sequences (CAPS), allele-specific PCR (AS-PCR), etc., and the other major class is a high throughput, high-automation detection method represented by direct sequencing, DNA chip, denaturing High Performance Liquid Chromatography (DHPLC), mass spectrometry, high resolution dissolution profile (HRM), etc. The two methods have advantages and disadvantages, and detection methods combining the two methods, such as KASP (Lister et., 2013) and PARMS (Lu et al, 2020) are available at present, so that the method is simple to operate, low in cost and capable of realizing high-flux detection.
The number of ovules per ovary is a typical complex quantitative trait controlled by multiple genes, the phenotype is continuously distributed and is susceptible to environmental conditions. The combination of quantitative genetics and molecular marker technology can break down complex quantitative traits into individual quantitative trait loci (quantitative trait loci, QTL) and then study multiple genes that control quantitative traits as quality traits. QTL localization is based on genetic segregating populations, and quantitative trait phenotype data of segregating populations are analyzed by means of QTL mapping software by means of molecular markers and genetic maps, so that the position and effect of quantitative trait genes on chromosomes are determined. Currently, thousands of QTLs have been located in canola, using linkage mapping (linkage mapping) and association mapping (association map ping), involving a number of important traits such as yield, plant type, quality and resistance etc. (Hu et al 2017). However, QTL localization studies on the number of ovules per ovary of canola were initiated just before, khan et al (2019) performed whole genome association analysis using 521 canola association populations and 60K canola SNP chips to obtain 8 SNP markers significantly associated with the number of ovules per ovary. The invention aims to find a stable site with an improved effect on the number of the ovules of the rape by carrying out whole genome association analysis on the number of the ovules of the rape in four environments, and develop a practical high-throughput low-cost molecular marker for selecting the number of the ovules of the rape according to the stable site.
Disclosure of Invention
The invention aims at providing a stable locus qO NPO.A3-2 which is obviously related to the number of ovules per ovary on a rape A03 chromosome.
Another object of the present invention is to provide a PARMS detection primer designed for the Single Nucleotide Polymorphism (SNP) marker seq-new-rs32414 of the number-associated site qONPO.A3-2 of ovules per ovary.
The invention also aims at providing the application of the detection primer in the selective breeding of the number of the ovules of rape per ovary. In order to achieve the above object, the present invention adopts the following technical measures:
obtaining of PARMS mark obviously related to number of ovules per ovary of rape
(1) 331 total rape DNAs were collected and genotyping was performed on each sample using a 60K SNP chip.
(2) The marker heterozygosity (heterozygous rate), loss rate (transmission rate), minimum allele frequency (minor allele frequency) of the population material at each locus was calculated using Illumina BeadStudio genotyping software (http:// www.illumina.com /). And removing the markers which are free of polymorphism, high in deletion proportion, free of homozygous genotype, low in allele frequency, high in heterozygosity genotype frequency, uncertain in position and multiple copies, and finally obtaining 21242 high-quality SNP markers of 327 strains for subsequent analysis.
(3) And (3) planting 331 parts of lines of the associated population in four environments (with codes of 20QH,20YL,21WC and 21 YL) of 2020 Qinghai, 2020 Yang Luo, 2021 Wuchang and 2021 Yang respectively, selecting 5 single plants with uniform growth vigor from each line of the associated population in a flowering period, selecting 5 buds at the lower part of a main inflorescence, and stripping an ovary. After the ovaries were totally transparent, pictures were taken under a stereoscopic microscope and ovules were counted (Zhu Yaoyao, 2019).
(4) Association analysis was performed using TASSEL 5.0 software (braddury et al, 2007) in combination with per-ovary ovule form data, genotype data, and population structure of the associated population. Finally, a locus qONPO.A3-2 with a significant relation with the number of ovules per ovary is obtained on the chromosome A03 of the rape Darmorv4 reference genome, and the peak SNP marker seq-new-rs32414 is positioned at 16,137,692 base (the base is T/A or C/G) and can be repeatedly detected in two environments of 20YL and 21YL and multiple models.
(5) Extracting the sequence of 100bp on the upstream and downstream of 14,943,779 th base of the rape A03 chromosome, and obtaining a PARMS detection primer sequence according to a primer design principle: qONPO.A3-2Ft:GAAGGTGACCAAGTTCATGCTTTGGACTCTTGTTAAGGTAATAATATATAAGT；qONPO.A3-2Fc：GAAGGTCGGAGTCAACGGATTTGGACTCTTGTTAAGGTAATAATATATAAGC；qONPO.A3-2R：AATTTATGAAGTCAATTGTTGACTAAAAT。
the protection content of the invention comprises: the application of the reagent for detecting the molecular marker in selective breeding of the number of ovules of brassica napus per ovary.
Compared with the prior art, the invention has the following advantages:
(1) The invention obtains the locus qONPO.A3-2 which is obviously related to the number of the ovule of rape per ovary, can be repeatedly detected, can explain 8.0% of phenotype variance on average, has an average additive effect of 1.01, and can be effectively applied to the genetic improvement of the number of the ovule of rape per ovary.
(2) The invention obtains the PARMS mark with obvious association of the number of the ovules of the rape per ovary, has simple detection method and low cost, can carry out high-throughput screening on the genome haplotype area with the association of the number of the ovules of the rape per ovary, and improves the selection efficiency and accuracy.
Drawings
FIG. 1 is a distribution of 327 parts of material per ovule of rape-associated population in four environments.
Detailed Description
The technical scheme of the invention is conventional in the art unless specifically stated; the reagents or materials, unless otherwise specified, are derived from commercial channelsA lane. The Version number of the brassica napus genome used in the present invention is Darmor-bzh (Version 4.1)https://www.genoscope.cns.fr/brassicanapus/。
Example 1: obtaining of SNP (Single nucleotide polymorphism) markers obviously related to number of ovules per ovary of rape
(1) 331 cabbage type rape inbred lines from various countries in the world are collected as rape core association groups, individual leaves of each strain of the association groups are collected, total DNA is extracted by a CTAB method, and genotype analysis is carried out on each sample by using a rape 60K SNP chip (Li et al 2020).
(2) The marker heterozygosity (heterozygous rate), loss rate (transmission rate), minimum allele frequency (minor allele frequency) of the population material at each locus was calculated using Illumina BeadStudio genotyping software (http:// www.illumina.com /). The genetic relationship between 331 brassica napus germplasm resources was calculated using SPAGeDi software (Hardy and Vekemans, 2002). Filtering SNP markers by taking the deletion rate of less than or equal to 0.2, the heterozygosity rate of less than or equal to 0.2, the minimum allele frequency of more than 0.05 and the unique matching of the SNP markers in the brassica napus genome as screening standards, and finally obtaining 327 parts of 21242 high-quality SNP markers for whole genome association analysis.
(3) 331 lines of the relevant population were planted in four environments (code 20QH,20YL,21WC,21 YL) respectively, qinghai 2020, yang Luo, 2021 Wuchang, 2021 Yangwort. And 5 single plants with uniform growth vigor of each plant line of the related population are selected in the flowering phase, and 5 buds are selected for each plant. After the ovary was peeled off for total transparency, the ovule was photographed under a stereoscopic microscope and counted, and the average value of each strain was calculated. By analyzing the number data of ovules per ovary in each environment of the associated population, the result shows that the ovules per ovary in all four environments show a large variation range and are normally distributed (figure 1), and the ovules per ovary in all four environments can be directly used for subsequent genome-wide associated analysis.
(4) The whole genome correlation analysis was performed using four models (GLM-PCA, GLM-Q, MIM-PCA+K, MLM-Q+K) of TASSEL 5.0 software (B radbury et al 2007) in combination with genotype data and ovule number per ovary phenotype data of the relevant population. By integrating the significant association SNP markers detected in different environments and models, a locus qonpo.a3-2 was obtained on the a03 chromosome that was significantly associated with the number of ovules per ovary and that was well reproducible, could be repeatedly detected in both 20YL and 21YL environments and four models, with the peak SNP marker seq-new-rs32414 located at base 16,137,692 (T/a or C/G) of the Darmor V4.1 reference genome, the highest level of significance p=7.55e-06, an average interpretable 8.0% phenotypic variance, and an average additive effect of 1.01, so there was a 2.02 difference per ovary ovule number between the two homozygous genotypes theoretically.
Information of association QTL-qONPO.A3-2 for number of ovules per ovary
Example 2: development of PARMS markers significantly associated with ovule number per ovary
The relevant markers obtained in example 1 were derived from SNP chips, only probe sequence information for molecular hybridization. The rape SNP chip can detect tens of thousands of sites at a time, but the operation is complicated and special equipment is needed. In addition, the detection of a large number of breeding intermediate materials by using rape SNP chips is expensive, and therefore, it is necessary to convert them into a detection method based on PCR amplification, such as PARMS (Penta-primer Amplifica tion Refractory Mutation System, five-primer amplification-blocked mutation system) markers, which is simple to operate and low in cost. The labeling system comprises a pair of fluorescent universal primers (FAM and HEX are used as report fluorescence), a pair of SNP allele specific primers and a reverse common primer, so that SNP allele detection can be rapidly and simply performed.
(1) For a peak SNP marker seq-new-rs32414 associated with qONPN.A3-2, extracting 100bp sequences of the upstream and downstream of 16,137,692 th basic groups of a chromosome A03 of a rape DarmorV4.1 reference genome. The PARMS mark detection primer sequence is obtained according to the primer design principle:
qONPO.A3-2Ft：gaaggtgaccaagttcatgctttggactcttgttaaggtaataatatataagt；
qONPO.A3-2Fc：gaaggtcggagtcaacggatttggactcttgttaaggtaataatatataagc；
qONPO.A3-2R：aatttatgaagtcaattgttgactaaaat。
(2) And (3) taking genome DNA of rape related population as a template, carrying out fluorescent quantitative PCR amplification by using the primer, scanning FAM, HEX and ROX signals by using Tecan F200, outputting the results, and finally converting the results into genotypes.
Example 3: application of PARMS mark in selection of number of ovules of rape per ovary
Of 331 parts of material in the association population, 76 parts of material with genotype CC and 237 parts of genotype TT were detected using PARMS marker qONPO.A3-2 provided in example 2 (Table two). The number of ovules per ovary of both genotypes reached an extremely significant level in three environments, and the number of ovules per ovary of both genotypes CC and TT were different from 1.53 to 2.16 with a mean of 1.83.
Comparison of the number of ovules per ovary of two genotypes of Table II, PARMS marker qONPO.A3-2 in four circumstances of the related population
| Genotype of the type | 20YL | 21YL | 21WC | 21YL |
| CC(n＝76) | 30.9 | 30.2 | 30.3 | 31.0 |
| TT(n＝237) | 29.9 | 28.0 | 28.8 | 29.2 |
| CC-TT | 1.06 | 2.16*** | 1.53*** | 1.79*** |
* Sum represents significance levels p= 0.05,0.01 and 0.001, respectively.
The above results are sufficient to demonstrate that the PARMS molecular marker qONPO.A3-2 prepared by us is highly correlated with the number of ovules of rape per ovary, and has good screening effect.
Sequence listing
<110> institute of oil crop and oil crop at national academy of agricultural sciences
<120> PARMS molecular marker related to number of ovules per ovary of rape and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 53
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gaaggtgacc aagttcatgc tttggactct tgttaaggta ataatatata agt 53
<210> 2
<211> 52
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gaaggtcgga gtcaacggat ttggactctt gttaaggtaa taatatataa gc 52
<210> 3
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
aatttatgaa gtcaattgtt gactaaaat 29
Claims (1)
1. Application of a reagent for detecting 14,943,779-base genotype of rape A03 chromosome in selective breeding of ovule number per ovary of brassica napus, wherein the Version number of the brassica napus genome is Darmor-bzh (Version 4.1) https:// www.genoscope.cns.fr/brassinana pus/, the reagent is a primer, and the primer is: qONPO.A3-2Ft:GAAGGTGACCAAGTTCATGCTTTGGACTCTTGTTAAGGTAATAATATATAAGT；qONPO.A3-2Fc：GAAGGTCGGAGTCAACGGATTTGGACTCTTGTTAAGGTAATAATATATAAGC；qONPO.A3-2R：AATTTATGAAGTCAATTGTTGACTAAAAT。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111590478.0A CN114182041B (en) | 2021-12-23 | 2021-12-23 | PARMS molecular marker related to number of ovules of rape per ovary and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111590478.0A CN114182041B (en) | 2021-12-23 | 2021-12-23 | PARMS molecular marker related to number of ovules of rape per ovary and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114182041A CN114182041A (en) | 2022-03-15 |
| CN114182041B true CN114182041B (en) | 2023-04-28 |
Family
ID=80605962
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111590478.0A Active CN114182041B (en) | 2021-12-23 | 2021-12-23 | PARMS molecular marker related to number of ovules of rape per ovary and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114182041B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116606950B (en) * | 2023-04-29 | 2023-11-24 | 中国农业科学院油料作物研究所 | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.9-4 of rape |
| CN116555476B (en) * | 2023-05-07 | 2023-12-01 | 中国农业科学院油料作物研究所 | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.C3-3 of rape |
| CN118222751B (en) * | 2024-04-23 | 2024-09-27 | 中国农业科学院油料作物研究所 | Molecular marker closely linked with main effect QTL-qON.A7 of number of ovules per ovary of rape and application |
| CN118166154A (en) * | 2024-04-23 | 2024-06-11 | 中国农业科学院油料作物研究所 | Molecular marker closely linked with main effect QTL-qON.C2 of number of ovules per ovary of rape and application |
| CN118326074A (en) * | 2024-05-06 | 2024-07-12 | 中国农业科学院油料作物研究所 | Molecular marker of locus qFAC.A9-1 obviously related to fatty acid component of brassica napus seed and application |
-
2021
- 2021-12-23 CN CN202111590478.0A patent/CN114182041B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114182041A (en) | 2022-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114182041B (en) | PARMS molecular marker related to number of ovules of rape per ovary and application | |
| CN109825621B (en) | Wheat spikelet number QTL (quantitative trait locus) linked SNP (single nucleotide polymorphism) molecular marker and application thereof | |
| CN114231654B (en) | PARMS molecular marker associated with thousand grain weight of rape and application thereof | |
| WO2018085971A1 (en) | Cotton whole genome snp chip and application thereof | |
| CN108060261B (en) | Method for capturing and sequencing corn SNP marker combination and application thereof | |
| CN107937397B (en) | SNP molecular marker closely linked with tomato male sterility gene and obtaining method and application thereof | |
| CN112779350A (en) | Molecular marker closely linked with wheat spikelet grain number QTLQGns | |
| CN109762926B (en) | Molecular marker primer related to rape pod number and application | |
| CN117604142A (en) | Specific primer of molecular marker linked with wheat grain related trait gene and application thereof | |
| CN105603083B (en) | Method for carrying out corn-assisted efficient breeding by using two molecular markers including SSR (simple sequence repeat) and SNP (Single nucleotide polymorphism) | |
| Li et al. | Rapid identification of Psathyrostachys huashanica Keng chromosomes in wheat background based on ND-FISH and SNP array methods | |
| CN109913575B (en) | KASP molecular marker for identifying CMS male sterility restoring gene of pepper, kit and application thereof | |
| CN116064583B (en) | Highland barley spike length regulating gene and KASP molecular marker and application thereof | |
| CN107365873B (en) | Molecular marker linked with foxtail sheath color characteristic of millet and application thereof | |
| CN112442544A (en) | Method and kit for auxiliary screening of tomato material with high sugar character and application | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN114703316A (en) | Development and application of KASP marker of tomato ps-2 gene | |
| CN118222751B (en) | Molecular marker closely linked with main effect QTL-qON.A7 of number of ovules per ovary of rape and application | |
| CN112195263A (en) | SNP (Single nucleotide polymorphism) locus and primer set for identifying purity of watermelon hybrid and application | |
| CN116555474B (en) | Application of rape thousand seed weight-related PARMS molecular markers or marker combinations | |
| CN116555476B (en) | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.C3-3 of rape | |
| CN116606950B (en) | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.9-4 of rape | |
| CN116574833B (en) | Application of PARMS molecular marker or marker combination of rape thousand seed weight associated site qSW.A1-2 | |
| CN118166154A (en) | Molecular marker closely linked with main effect QTL-qON.C2 of number of ovules per ovary of rape and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |