CN114182041B - PARMS molecular marker related to number of ovules of rape per ovary and application - Google Patents

Abstract

The invention belongs to the technical fields of molecular biology and genetic breeding, and discloses a molecular marker obviously related to the number of ovules of brassica napus per ovary and application thereof. Sites significantly associated with the number of ovules per ovary of canolaqONPO.A3‑2And the peak SNP marker seq-new-rs32414 is positioned at 16,137,692 base of the A03 chromosome of the rape DarmorV4.1 reference genome, and can explain 8.0% of phenotype variance on average and has an average additive effect of 1.01. The PARMS marker designed by the SNP is used for detecting the rape related population, and the PARMS marker is found to be simple and convenient to operate, clear in typing and good in selection effect on the number of ovules of each ovary of rape.

Description

A PARMS molecular marker associated with the number of ovules per ovary in rapeseed and its application

technical field

The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker significantly related to the number of ovules per ovary of Brassica napus and its application.

Background technique

Rapeseed oil is the largest source of domestic edible vegetable oil, accounting for more than 55% of my country's total vegetable oil production (Wang Hanzhong, 2018). However, the self-sufficiency rate of domestic vegetable oil in my country is less than 35%, which seriously threatens its supply security. In order to ensure the effective supply of domestic vegetable oil in our country, in the case of sluggish planting area growth, the only way out is to continuously increase the oil production per unit area (=unit yield×oil content). In recent years, breakthroughs have been made in the breeding of rapeseed with high oil content in my country (Fu Tingdong, 2014), but the yield per unit area is still lower than the world average (http://apps.fas.usda.gov/psdonline/) and the increase is very slow, which seriously affects the cultivation of rapeseed Benefits and international competitiveness of the rapeseed industry. Therefore, my country's rapeseed production needs to be improved urgently (Yin Yan and Wang Hanzhong, 2012).

Under the condition of the same planting density, the yield of rapeseed depends on the yield per plant, and the yield per plant directly depends on the three components of the number of siliques in the whole plant, the number of grains per horn and the weight of grains. Although there is a certain degree of negative correlation among the three constituent factors of rapeseed yield, the coefficients are often small, so the yield can be increased by increasing the yield constituent factors (such as the number of seeds per corner). Studies have shown that the number of grains per horn can be further decomposed into the product of four sub-traits: the number of ovules per ovary, the ratio of fertile ovules, the fertilization rate of fertile ovules, and the development rate of fertilized ovules (Yang Yuhua, 2017). Therefore, the number of ovules per ovary of rapeseed is the upper limit of the number of seeds per horn, which determines its maximum potential. Yang et al. (2017) conducted systematic genetic analysis and cytological observations using 9 materials with extreme number of grains per horn. The results showed that the number of ovules per ovary and the development rate of fertilized ovules were the main factors affecting the number of grains per horn. Compared with the three factors constituting the yield of rapeseed, the identification of the ovule number phenotype per ovary cannot be carried out with the naked eye, and must go through tedious early cytological processing and then observe and count under a stereomicroscope. Therefore, for accurate and high-throughput screening of ovule number per ovary, it is necessary to develop reliable and practical molecular markers for assisted selection.

With the continuous development of molecular marker technology, its application in crops is becoming more and more extensive. Grodzicker et al. (1974) created the restriction fragment length polymorphism (restriction fragment length polymorphism, RFLP) marker technology. RFLP is the first-generation molecular marker, which has the characteristics of abundant quantity, stable inheritance, specificity, good repeatability, and co-dominance. However, the amount of DNA required for this labeling is relatively large; the operation procedures are cumbersome, time-consuming and labor-intensive, and the cycle is long; radioactive isotopes are also required to label the probes. These factors limit the widespread use of RFLP labeling. AFLP marker combines PCR and RFLP marker technology, and has been widely used in crop genetic diversity research, cytology research, variety purity identification and disease resistance research (Song Shunhua et al., 2006; Yuan Suxia, 2009; Wang Xue, 2004). However, AFLP markers also have some disadvantages: high cost, complicated process, and technical difficulty; most of the markers are dominant markers; and they have high requirements for DNA quality and restriction endonuclease quality. SSR markers, also known as microsatellite DNA markers (microsatellite DNA), have been widely used in crop gene mapping, molecular marker-assisted selection, DNA fingerprinting, variety purity identification, preservation and utilization of germplasm resources, and genetic diversity analysis. In research (Chen Yeli, 2010; Miao Tiyun, 2007; Jing Zange, 2010; Wang Dongmei, 2011). SSR markers have the advantages of abundant quantity, high polymorphism, simple operation, and low cost, but it is difficult to achieve high-throughput batch detection. In the past decade, with the continuous advancement of sequencing technology, it has become possible to develop molecular markers based on genome sequence information, such as SNP markers and InDel markers (Hyten et al., 2010). At present, genome-wide selective breeding chips have only been tried in rice (Yu et al., 2014), and other crops such as rape are still mainly based on molecular marker-assisted selection. At present, SNP detection methods are mainly divided into two categories: one category is based on single-strand conformation polymorphism (SS CP), denaturing gradient gel electrophoresis (DDGE), enzyme-cut amplified polymorphic sequence (CAPS), allele The traditional classic detection methods based on gel electrophoresis represented by gene-specific PCR (AS-PCR), and the other major detection methods are direct sequencing, DNA chips, denaturing high-performance liquid chromatography (DHPLC), and mass spectrometry detection technologies. High-throughput and highly automated detection methods represented by , high-resolution melting curve (HRM), etc. These two types of methods have their own advantages and disadvantages. At present, there are detection methods that combine the two, such as KASP (Lister et., 2013) and PARMS (Lu et al., 2020), which are not only easy to operate, low in cost, but also can achieve High-throughput detection.

The number of ovules per ovary is a typical complex quantitative trait controlled by multiple genes, and the phenotype is continuously distributed and easily affected by environmental conditions. The combination of quantitative genetics and molecular marker technology can decompose complex quantitative traits into a single quantitative trait loci (quantitative trait loci, QTL), and then study multiple genes controlling quantitative traits like studying qualitative traits. QTL mapping is based on the genetic segregation population, with the help of molecular markers and genetic maps, using QTL mapping software to analyze the quantitative trait phenotype data of the segregation population, so as to determine the position and effect of the quantitative trait gene on the chromosome. At present, using linkage mapping and association mapping methods, thousands of QTLs have been located in rapeseed, involving many important traits such as yield, plant type, quality and resistance, etc. (Hu et al., 2017). However, the QTL mapping research on the number of ovules per ovary in rapeseed has just begun. Khan et al. (2019) used 521 rapeseed related populations and 60K rapeseed SNP chips to conduct genome-wide association analysis and obtained 8 QTLs that were significantly associated with the number of ovules per ovary. SNP markers. The present invention conducts genome-wide association analysis on the number of ovules per ovary of rapeseed under four environments, aiming to find stable loci that have an improvement effect on the number of ovules per ovary of rapeseed, and develop a practical high-throughput low-efficiency Molecular markers of cost for selection on ovule number in rapeseed.

Contents of the invention

The purpose of the present invention is to provide a stable site qONPO.A3-2 on the rape A03 chromosome that is significantly associated with the number of ovules per ovary.

Another object of the present invention is to provide PARMS detection primers designed for the ovule number per ovary associated locus qONPO.A3-2 peak SNP marker seq-new-rs32414.

Another object of the present invention is to provide the application of the above detection primers in the selective breeding of the number of ovules per ovary of rapeseed. In order to achieve the above object, the present invention takes the following technical measures:

The number of ovules per ovary in rapeseed is significantly associated with the acquisition of PARMS markers

(1) Collect 331 rapeseed total DNA, and use the rapeseed 60K SNP chip to perform genotype analysis on each sample.

(2) Use the Illumina BeadStudio genotyping software (http://www.illumina.com/) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each site Gene frequency (minor allele frequency). Removed no polymorphism, high deletion ratio, no homozygous genotype, low allele frequency, high heterozygous genotype frequency, uncertain position and multi-copy markers, and finally obtained 21242 high-quality SNPs from 327 lines markers for subsequent analysis.

(3) Plant 331 strains of the associated population in four environments (codenamed 20QH, 20YL, 21WC, 21YL) in 2020 Qinghai, 2020 Yangluo, 2021 Wuchang, and 2021 Yangluo, and select each strain of the associated population during the flowering period For 5 individual plants with uniform growth, 5 buds at the lower part of the main inflorescence were selected, and the ovary was stripped out. After the overall transparency of the ovary, photographs were taken under a stereomicroscope, and the ovules were counted (Zhu Yaoyao, 2019).

(4) Combining the ovule number per ovary phenotype data, genotype data and population structure of the associated population, use TASSEL5.0 software (Bradbury et al., 2007) for association analysis. Finally, the locus qONPO.A3-2 significantly associated with the number of ovules per ovary was obtained on the A03 chromosome of the rapeseed DarmorV4 reference genome, and its peak SNP marker seq-new-rs32414 was located at the 16th, 137,692th base (the base is T/A or C/G), which could be detected repeatedly in both 20YL and 21YL environments and multiple models.

(5) Extract the sequences of 100 bp upstream and downstream of the 14th, 943, and 779th base of rape A03 chromosome, and obtain the PARMS detection primer sequence according to the primer design principle: qONPO.A3-2Ft: GAAGGTGACCAAGTTCATGCT TTGGACTCTTGTTAAGGTAATAATATATAAGT; qONPO.A3-2Fc: GAAGGTCGGAGTCAACGGATT TGGACTCTTGT TAAGGTAATAATATATAAGC;qONPO.A3 -2R: AATTTATGAAGTCAATTGTTGACTAAAAT.

The protection content of the present invention includes: the application of the reagent for detecting the above-mentioned molecular marker in selective breeding for the number of ovules per ovary of Brassica napus.

Compared with the prior art, the present invention has the following advantages:

(1) The present invention obtains the locus qONPO.A3-2 that is significantly associated with the number of ovules per ovary of rapeseed, and can be repeatedly detected. On average, it can explain 8.0% of the phenotypic variance, and the average additive effect is 1.01, which can be effective Genetic improvement of the number of ovules per ovary applied to rapeseed.

(2) The present invention obtains PARMS markers significantly associated with the number of ovules per ovary in rapeseed. The detection method is simple and low-cost, and high-throughput screening can be performed on the genomic haplotype region associated with the number of ovules per ovary to improve selection efficiency and accuracy.

Description of drawings

Figure 1 shows the phenotypic distribution of the number of ovules per ovary in 327 materials of rape related populations in four environments.

Detailed ways

The technical solutions of the present invention, if not specified, are conventional techniques in the art; the reagents or materials, if not specified, are all derived from commercial channels. The version number of the Brassica napus genome used in the present invention is Darmor-bzh (Version 4.1) https://www.genoscope.cns.fr/brassicanapus/ .

Example 1: Acquisition of SNP markers significantly associated with the number of ovules per ovary in rapeseed

(1) Collect 331 Brassica napus inbred lines from various countries in the world as the core related population of rapeseed, collect individual leaves of each strain of the related group, extract the total DNA by CTAB method, and use the rape 60K SNP chip to analyze each sample Genotype analysis was performed (Li et al., 2020).

(2) Use the Illumina BeadStudio genotyping software (http://www.illumina.com/) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each site Gene frequency (minor allele frequency). The genetic relationship among 331 Brassica napus germplasm resources was calculated by SPAGeDi software (Hardy and Vekemans, 2002). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally obtained 21,242 high-quality SNP markers from 327 materials for genome-wide association analysis.

(3) The 331 strains of the related population were planted in four environments of 2020 Qinghai, 2020 Yangluo, 2021 Wuchang, and 2021 Yangluo (code-named 20QH, 20YL, 21WC, 21YL). At the flowering stage, 5 individual plants with uniform growth of each line of the associated population were selected, and 5 buds were selected for each plant. After the ovary was stripped out for overall transparency, photographs were taken under a stereomicroscope and the ovules were counted to calculate the average value of each strain. By analyzing the data of the number of ovules per ovary in each environment of the associated population, the results show that the number of ovules per ovary in all four environments shows a large range of variation and is normally distributed (Figure 1), which can be directly for subsequent genome-wide association analysis.

(4) Combining the genotype data of the associated population and the phenotype data of the number of ovules per ovary, using the four models (GLM-PCA, GLM-Q, MIM-PCA+K) of TASSEL 5.0 software (Bradbury et al.2007) , MLM-Q+K) for genome-wide association analysis. By integrating the significantly associated SNP markers detected in different environments and models, the locus qONPO.A3-2, which is significantly associated with the number of ovules per ovary and has good repeatability, is obtained on chromosome A03, which can be used in both 20YL and 21YL It was repeatedly detected in the environment and four models, and its peak SNP marker seq-new-rs32414 was located at base 16,137,692 (T/A or C/G) of the Darmor V4.1 reference genome, with the highest significance level P=7.55E -06, 8.0% of the phenotypic variance can be explained on average, and the average additive effect is 1.01, so the theoretical difference in the number of ovules per ovary between the two homozygous genotypes is 2.02.

Table 1. The information of QTL-qONPO.A3-2 associated with the number of ovules per ovary

Example 2: Development of a PARMS marker significantly associated with the number of ovules per ovary

The associated markers obtained in Example 1 are derived from the SNP chip, and only have the sequence information of the probes used for molecular hybridization. Rapeseed SNP chip can detect tens of thousands of sites at a time, but its operation is cumbersome and requires special equipment. In addition, it is expensive to use rapeseed SNP chips to detect a large number of breeding intermediate materials, so it needs to be converted into a detection method based on PCR amplification that is simple to operate and low in cost, such as PARMS (Penta-primer Amplification Refractory Mutation System, Five-primer amplification hindered mutation system) marker. The labeling system includes a pair of fluorescent universal primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers and a reverse common primer, which can quickly and easily detect SNP alleles.

(1) For the peak SNP marker seq-new-rs32414 associated with qONPN.A3-2, extract the sequences of 100 bp upstream and downstream of bases 16, 137, and 692 on chromosome A03 of the rapeseed DarmorV4.1 reference genome. According to the primer design principle, the sequence of the PARMS marker detection primer is obtained as follows:

qONPO.A3-2Ft: gaaggtgaccaagttcatgct ttggactcttgttaaggtaataatatataagt;

qONPO.A3-2Fc: gaaggtcggagtcaacggatt tggactcttgttaaggtaataatatataagc;

qONPO.A3-2R: aatttatgaagtcaattgttgactaaaat.

(2) Using the genomic DNA of rape related populations as a template, the above primers were used for fluorescence quantitative PCR amplification, and Tecan F200 was used to scan the FAM, HEX and ROX signals and output the results, and finally converted into genotypes.

Example 3: Application of PARMS markers in the selection of the number of ovules per ovary in rapeseed

Among the 331 materials in the related population, 76 materials were genotyped as CC and 237 materials as genotype TT were detected by the PARMS marker qONPO.A3-2 provided in Example 2 (Table 2). The number of ovules per ovary of the two genotypes reached a very significant level in the three environments, the mean difference of the number of ovules per ovary between CC and TT genotypes ranged from 1.53 to 2.16, and the average value was 1.83.

Table 2. Comparison of the number of ovules per ovary of the PARMS marker qONPO.A3-2 two genotypes in the associated population four environments

genotype 20YL 21YL 21WC 21YL CC (n=76) 30.9 30.2 30.3 31.0 TT (n=237) 29.9 28.0 28.8 29.2 CC-TT 1.06 2.16*** 1.53*** 1.79***

*, ** and *** represent significance levels P=0.05, 0.01 and 0.001, respectively.

The above results are enough to show that the PARMS molecular marker qONPO.A3-2 prepared by us is highly correlated with the number of ovules per ovary of rapeseed, and has a good screening effect.

sequence listing

<110> Institute of Oil Crops, Chinese Academy of Agricultural Sciences

<120> A PARMS molecular marker associated with the number of ovules per ovary in rapeseed and its application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 53

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaaggtgacc aagttcatgc tttggactct tgttaaggta ataatatata agt 53

<210> 2

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaaggtcgga gtcaacggat ttggactctt gttaaggtaa taatatataa gc 52

<210> 3

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aatttatgaa gtcaattgtt gactaaaat 29

Claims (1)

1. Application of a reagent for detecting 14,943,779-base genotype of rape A03 chromosome in selective breeding of ovule number per ovary of brassica napus, wherein the Version number of the brassica napus genome is Darmor-bzh (Version 4.1) https:// www.genoscope.cns.fr/brassinana pus/, the reagent is a primer, and the primer is: qONPO.A3-2Ft:GAAGGTGACCAAGTTCATGCTTTGGACTCTTGTTAAGGTAATAATATATAAGT；qONPO.A3-2Fc：GAAGGTCGGAGTCAACGGATTTGGACTCTTGTTAAGGTAATAATATATAAGC；qONPO.A3-2R：AATTTATGAAGTCAATTGTTGACTAAAAT。

Images