CN116555476B - Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.C3-3 of rape - Google Patents
Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.C3-3 of rape Download PDFInfo
- Publication number
- CN116555476B CN116555476B CN202310504317.8A CN202310504317A CN116555476B CN 116555476 B CN116555476 B CN 116555476B CN 202310504317 A CN202310504317 A CN 202310504317A CN 116555476 B CN116555476 B CN 116555476B
- Authority
- CN
- China
- Prior art keywords
- rape
- qsw
- parms
- seed weight
- thousand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 239000003550 marker Substances 0.000 title abstract description 12
- 239000003147 molecular marker Substances 0.000 title abstract description 6
- 210000000349 chromosome Anatomy 0.000 claims abstract description 33
- 238000009395 breeding Methods 0.000 claims abstract description 14
- 230000001488 breeding effect Effects 0.000 claims abstract description 14
- 238000009394 selective breeding Methods 0.000 claims 1
- 230000000694 effects Effects 0.000 abstract description 8
- 241000196324 Embryophyta Species 0.000 description 14
- 238000001514 detection method Methods 0.000 description 12
- 239000000463 material Substances 0.000 description 8
- 108700028369 Alleles Proteins 0.000 description 7
- 235000004977 Brassica sinapistrum Nutrition 0.000 description 7
- 235000014698 Brassica juncea var multisecta Nutrition 0.000 description 6
- 235000006008 Brassica napus var napus Nutrition 0.000 description 6
- 240000000385 Brassica napus var. napus Species 0.000 description 6
- 235000006618 Brassica rapa subsp oleifera Nutrition 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 238000012098 association analyses Methods 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 5
- 240000002791 Brassica napus Species 0.000 description 4
- 238000013461 design Methods 0.000 description 4
- 230000002068 genetic effect Effects 0.000 description 4
- 238000013507 mapping Methods 0.000 description 4
- 238000012545 processing Methods 0.000 description 4
- 238000003860 storage Methods 0.000 description 4
- 238000011144 upstream manufacturing Methods 0.000 description 4
- 235000011293 Brassica napus Nutrition 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 239000000523 sample Substances 0.000 description 3
- 238000007844 allele-specific PCR Methods 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 230000005540 biological transmission Effects 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 238000012217 deletion Methods 0.000 description 2
- 230000037430 deletion Effects 0.000 description 2
- 238000003935 denaturing gradient gel electrophoresis Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 238000001035 drying Methods 0.000 description 2
- 230000004907 flux Effects 0.000 description 2
- 238000003306 harvesting Methods 0.000 description 2
- 238000011835 investigation Methods 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 238000000018 DNA microarray Methods 0.000 description 1
- 244000208060 Lawsonia inermis Species 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 208000005652 acute fatty liver of pregnancy Diseases 0.000 description 1
- 239000000654 additive Substances 0.000 description 1
- 230000000996 additive effect Effects 0.000 description 1
- 239000000470 constituent Substances 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 102000054766 genetic haplotypes Human genes 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 238000004128 high performance liquid chromatography Methods 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 230000004807 localization Effects 0.000 description 1
- 238000004949 mass spectrometry Methods 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B50/00—ICT programming tools or database systems specially adapted for bioinformatics
- G16B50/10—Ontologies; Annotations
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Theoretical Computer Science (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Medical Informatics (AREA)
- Evolutionary Biology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Bioethics (AREA)
- Databases & Information Systems (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biological breeding, in particular to application of a rape thousand seed weight associated PARMS molecular marker or marker combination, and applicant screens two thousand seed weight associated sitesqSW.A3‑3AndqSW.C3‑3the peak SNP markers Bn-A03-p14176469 and Bn-scaff_22067_1-p219321 of the rape A03 chromosome are located at base 13,373,806 and base 20,819,936 of the C03 chromosome, respectively, and an average of 6.3% and 8.6% of the phenotypic variation can be explained, with an average effect of 0.30 and 0.22 g. The PARMS markers developed by the two SNP are used for detecting the rape related population, the operation is simple and convenient, the typing is clear, the difference value of thousand grain weights of the two homozygous genotypes is 0.23 g and 0.30 g respectively, and the combination of the two homozygous genotypes is up to 0.46 g, so that the rape related population has good selection effect.
Description
Technical Field
The invention belongs to the technical field of biological breeding, and particularly relates to application of PARMS molecular markers or marker combinations of a locus qSW.C3-3 associated with thousand seed weight of rape.
Background
Under the same planting density condition, the single yield of rape depends on the single plant yield, and the single plant yield is directly determined by three constituent factors of the number of the whole plant fruits, the number of grains per corner and the grain weight. Although there is a negative correlation to some extent between the three components of rape yield, the coefficients are often not large, and thus yield can be increased by increasing the yield components (e.g. grain weight). From the practical aspect of breeding, the increase of rape unit yield can be realized by improving the constitution factors such as grain weight. At present, the thousand seed weight of rape varieties is generally lower than 4g, and the maximum value of the thousand seed weight in rape germplasm resources can exceed 8 g (Chen Wei and the like, 2011), which indicates that the rape seed weight still has a large lifting space.
With the rapid development of modern biotechnology, the molecular marker technology is also updated and iterated continuously, and the initial RFLP, RA PD/AFLP and SSR are gradually developed into the current SNP markers. The current SNP detection methods are mainly divided into two main categories: one general class is the traditional classical detection methods based on gel electrophoresis, represented by single-strand conformational polymorphism (SSCP), denaturing gradient gel electrophoresis (DDGE), cleaved Amplified Polymorphic Sequences (CAPS), allele-specific PCR (AS-PCR), etc.; another major class is high throughput, high degree of automation detection methods represented by direct sequencing, DNA chips, denaturing High Performance Liquid Chromatography (DHPLC), mass spectrometry detection techniques, high resolution dissolution profiles (HRM), and the like. The two methods have advantages and disadvantages, and detection methods combining the two methods, such as KASP (Lister et., 2013) and PARMS (Lu et al, 2020) are available at present, so that the method is simple to operate, low in cost and capable of realizing high-flux detection.
Grain weight is a complex quantitative trait typically controlled by multiple genes, and phenotypes are continuously distributed and susceptible to environmental conditions. The inheritance of grain weight is mainly additive, dominant and superior, so that its heterosis is weak, and the grain weight of hybrid F1 is generally between parents (Li Na, 2015). The combination of quantitative genetics and molecular marker technology can break down complex quantitative traits into individual quantitative trait loci (quantitative trait loci, QTL) and then study multiple genes that control quantitative traits as quality traits. QTL localization is based on genetic segregating populations, and quantitative trait phenotype data of segregating populations are analyzed by means of QTL mapping software by means of molecular markers and genetic maps, so that the position and effect of quantitative trait genes on chromosomes are determined. Currently, with the methods of linkage mapping (linkage ma mapping) and association mapping (association mapping), there are a limited number of QTLs that work in different populations and environments, but it is difficult to meet practical breeding requirements, when rape seeds have been mapped to more than one hundred thousand grain weight QTLs (quejada et al, undell et al, 2006;Radoev et al, 2008, shi et al, 2009, wang Feng et al, 2010;Basunanda et al, 2010, fan et al, 2010, zhang et al, 2011, zhao Weiguo et al, 2017).
The invention utilizes thousand seed weight data of 10 environments of rape natural population to carry out whole genome association analysis, aims at finding a new stable site with improvement effect on thousand seed weight of rape, develops a practical molecular marker with high flux and low cost for auxiliary selection according to the new stable site, and lays a foundation for subsequent whole genome selection breeding.
Disclosure of Invention
The invention aims at providing a locus qSW.C3-3 which is obviously related to the grain weight on a rape C03 chromosome, wherein a peak SNP marker Bn-scanff_22067_1-p 219321 is positioned at 20,819,936 th base of a rape DarmorV4.1 reference genome C03 chromosome.
Another object of the present invention is to provide a combination of loci qSW.A3-3 and qSW.C3-3 associated with thousand seed weight of rape, whose peak SNP markers Bn-A03-p14176469 and Bn-scaff_22067_1-p219321 are located at the 13,373,806 th base and 20,819,936 th base of chromosome A03 of the reference genome A03 of rape DarmorV4.1, respectively.
It is still another object of the present invention to provide a PARMS marker primer for the peak SNP described above.
The invention also provides an application of the PARMS marked primer in rape thousand seed weight selection breeding.
In order to achieve the above object, the present invention adopts the following technical measures:
acquisition of SNP loci related to thousand seed weight of rape:
(1) Total DNA of 331 lines of the canola associated population was extracted and genotyping was performed on each sample using a canola 60K SNP chip (Li et al 2020).
(2) The deletion rate (transmission rate), heterozygosity rate (heterozygous rate), secondary allele frequency (minor allele frequency) of the population material at each site was calculated using Illumina BeadStudio genotyping software (http:// www.illumina.com /).
(3) And (3) planting 331 strains of the related population in 10 environments respectively, picking 10 single plants with uniform growth vigor in each cell in the mature period, harvesting, threshing the single plants respectively, sun-drying seeds for thousand-grain weight investigation, and calculating the average value of each strain.
(4) Full genome association analysis was performed using the high density SNP genotype data of the associated population, thousand grain weight phenotype data of 10 environments, population structure and kindred relationship using TASSEL 5.0 software (braddury et al, 2007). Finally, the sites qSW.A3-3 and qSW.C3-3 with obvious correlation with the grain weight are obtained, the peak SNP markers Bn-A03-p14176469 and Bn-scaff_22067_1-p219321 are positioned at the 13373806 th base of the A03 chromosome and the 20819936 th base of the C03 chromosome of the reference genome A03 of rape DarmorV4.1, and can be repeatedly detected in two environments.
(5) Extracting the sequence of 100bp on the upstream and downstream of 13,373,806 th base of the rape A03 chromosome, and obtaining a primer sequence according to the PARMS primer design principle: qSW.A3-3F: GAATTAAGTAGAAGCTCGCAAACAC, qSW.A3-3Ra:GAAGGT GACCAAGTTCATGCTTGTTGATGGTTGACTTCTGGTGA、qSW.A3-3Rg:GAAGGTCGGAGTCAACGGATTTGTTGATGGTTGACTTCTGGTGG。
extracting the sequence of 100bp on the upstream and downstream of 20,819,936 th base of rape C03 chromosome, and obtaining a primer sequence according to the PARMS primer design principle: qSW.C3-3F: ATTTCATTCTTCGTTATAGCAGGC, qSW.C3-3Ra:GAAGGTGAC CAAGTTCATGCTGAGCAAATCTGGTCATAGAAAGAGA、qSW.C3-3Rg:GAAGGTCGGAGTCAACGGATTGAGCAAATCTGGTCATAGAAAGAGG。
the protection content of the invention comprises:
the application of a system for detecting 20,819,936 th base of C03 chromosome of a rape DarmorV4.1 reference genome in rape thousand seed weight selection breeding is disclosed, wherein the system is a reagent, a kit or an instrument.
Rape thousand seed weight selection breeding's device, its characterized in that: the device comprises a data receiving module and a data processing module, wherein the data receiving module is configured to receive the genotype of 20,819,936 th basic group of a C03 chromosome of a rape DarmorV4.1 reference genome to be detected; the data processing module is used for converting the genotype from the receiving module into a judging result of the rape to be detected.
A computer readable storage medium for thousand seed weight selection breeding of canola, characterized in that: the computer readable storage medium causes a computer to execute the steps of: detecting the genotype of 20,819,936 th basic group of the C03 chromosome of the DarmorV4.1 reference genome of the rape to be detected, and converting the genotype into a judging result for judging the rape to be detected.
In the application, the reagent is a primer for detecting 20,819,936 base of C03 chromosome of the rape DarmorV4.1 reference genome.
In the application, the primer is as follows: qSW.C3-3F: ATTTCATTCTTCGTTATAGCAGGC, qSW.C3-3Ra:GAAGGTGACCAAGTTCATGCTGAGCAAATCTGGTCATAGAAAGAGA、qSW.C3-3Rg:GAAGGTC GGAGTCAACGGATTGAGCAAATCTGGTCATAGAAAGAGG。
in the above application, the kit is a PARMS detection kit.
In the application, when the genotype of the rape to be detected is AA, the rape is judged to be plants with high thousand seed weight, and when the genotype of the rape to be detected is GG, the rape is judged to be plants with low thousand seed weight.
The protection scope of the invention also comprises:
the application of a system for detecting 13,373,806 th base of a chromosome A03 and 20819936 th base of a chromosome C03 of a rape DarmorV4.1 reference genome in rape thousand seed weight selection breeding is disclosed, wherein the system is a reagent, a kit or an instrument.
Rape thousand seed weight selection breeding's device, its characterized in that: the device comprises a data receiving module and a data processing module, wherein the data receiving module is configured to receive genotypes of 13,373,806 th basic group of a chromosome A03 and 20,819,936 th basic group of a chromosome C03 of a rape DarmorV4.1 reference genome to be tested; the data processing module is used for converting the genotype from the receiving module into a judging result of the rape to be detected.
A computer readable storage medium for thousand seed weight selection breeding of canola, characterized in that: the computer readable storage medium causes a computer to execute the steps of: detecting genotypes of 13,373,806 th basic group of the A03 chromosome and 20,819,936 th basic group of the C03 chromosome of the rape DarmorV4.1 reference genome to be detected, and converting the genotypes into a judging result for judging the rape to be detected.
In the application, the reagent is a primer for detecting 13,373,806 th base of the A03 chromosome and 20,819,936 th base of the C03 chromosome of the rape DarmorV4.1 reference genome.
In the application, the primer is qSW.A3-3F: GAATTAAGTAGAAGCTCGCAAACAC, qSW.A3-3Ra:GAAGGTGACCAAGTTCATGCTTGTTGATGGTTGACTTCTGGTGA、qSW.A3-3Rg:GAAGGTCGG AGTCAACGGATTTGTTGATGGTTGACTTCTGGTGG。qSW.C3-3F:ATTTCATTCTTCGTTATAGCAGGC、qSW.C3-3Ra:GAAGGTGACCAAGTTCATGCTGAGCAAATCTGGTCATAGAAAGAGA、qSW.C3-3Rg:GAAGGTC GGAGTCAACGGATTGAGCAAATCTGGTCATAGAAAGAGG。
in the above application, the kit is a PARMS detection kit.
In the application, when the genotype of the 13,373,806 th base of the rape A03 chromosome to be detected is AA and the genotype of the 20,819,936 th base of the C03 chromosome is AA, judging that the plants with higher thousand grain weight are plants; when the genotype of 13,373,806 th base of the rape A03 chromosome to be detected is GG and the genotype of 20,819,936 th base of the C03 chromosome is GG, judging that the plants with lower thousand grain weight are plants.
Compared with the prior art, the invention has the following advantages:
(1) The invention obtains the locus qSW.A3-3 which is obviously related to the thousand seed weight of the rape, can be repeatedly detected in two environments, can explain 6.3% of phenotype variance on average, has an average effect of 0.30 g, and can be effectively applied to genetic improvement of the thousand seed weight of the rape.
(2) The invention obtains the locus qSW.C3-3 obviously related to the thousand seed weight of the rape, can be repeatedly detected in two environments, can explain 8.6% of phenotype variance on average, has an average effect of 0.22 g, and can be effectively applied to genetic improvement of the thousand seed weight of the rape.
(3) The invention obtains the PARMS mark obviously associated with the thousand seed weight of the rape, and the detection method has simple operation, low cost and high flux, can select the genome haplotype region obviously associated with the thousand seed weight, and improves the selection efficiency and accuracy.
Drawings
FIG. 1 is a graph showing the frequency distribution of thousand seed weight phenotypes of 331 parts of material from a canola associated population in 10 environments.
Detailed Description
The technical scheme of the invention is conventional in the art unless specifically stated; the reagents or materials, unless otherwise specified, are commercially available. The Version number of the brassica napus genome used in the present invention is Darmor-bzh (Version 4.1).
Example 1: acquisition of SNP markers remarkably related to thousand seed weight of rape
(1) Leaves of 331 core lines of rape-associated groups were collected, total DNA was extracted by CTAB method, and genotype analysis was performed on each sample using a rape 60K SNP chip (Li et al 2020).
(2) The marker heterozygosity (heterozygous rate), loss rate (transmission rate), minimum allele frequency (minor allele frequency) was calculated for each locus using Illumina BeadStudio genotyping software (http:// www.illumina.com /). Filtering SNP markers by taking the deletion rate of less than or equal to 0.2, the heterozygosity rate of less than or equal to 0.2, the minimum allele frequency of more than 0.05 and the unique match of the SNP markers in the brassica napus genome as screening standards, and finally obtaining 24,508 high-quality SNP markers for whole genome association analysis. Group structure analysis was performed on 331 core lines using structure2.3 software (Pritchard et al, 2000), and the relationships between 331 core lines were calculated using SPAGeDi software (Hardy and Vekemans, 2002).
(3) 331 lines of the related population were planted in 2012 (W12), 2013 (Z13, W13, and N13), 2014 (Z14, W14, and N14), 2015 (W15), 2016 (W16), and 2017 (W17) at the academy of agricultural science in henna (Z), the institute of oil crops in china (Yang Luoji) and the base of red soil in the province in the west of the river (N), respectively, for a total of 10 environments. And (3) selecting 10 single plants with uniform growth vigor in each cell in the mature period, harvesting, threshing the single plants respectively, sun-drying the seeds for investigation of thousand seed weight, and calculating the average value of each plant line. By analyzing the thousand-grain weight data in each environment of the association population, the result shows that the thousand-grain weight data in all 10 environments are normally distributed and have large variation amplitude (figure 1), and the method can be used for subsequent whole genome association analysis.
(4) Full genome association analysis was performed using four models (GLM-PCA, GLM-Q, MIM-pca+k, MLM-q+k) of TASSEL 5.0 software (Bradburyet al 2007) in combination with genotype data and thousand grain weight phenotype data of the associated population. By integrating the significant association SNP markers detected in different environments and models, loci qSW.A3-3 and qSW.C3-3 associated with thousand kernel weight are obtained, which can be repeatedly detected in two environments respectively, the peak SNP markers Bn-A03-p14176469 and Bn-scaff_22067_1-p219321 are respectively positioned at 13,373,806 th base of the A03 chromosome and 20,819,936 th base of the C03 chromosome, and the average can explain 6.3% and 8.6% of phenotype variance, and the average effect is 0.30 and 0.22 g.
Table I, information on the grain weight-related sites qSW.A3-3 and qSW.C3-3
Example 2: development of PARMS markers markedly associated with thousand kernel weight
The relevant markers obtained in example 1 were derived from SNP chips, only probe sequence information for molecular hybridization. The rape SNP chip can detect tens of thousands of sites at a time, but the operation is complicated and special equipment is needed. In addition, the detection of a large number of breeding intermediate materials by using rape SNP chips is expensive, and therefore, it is necessary to convert them into a detection method based on PCR amplification, such as PARMS (Penta-primer Amplifica tion Refractory Mutation System, five-primer amplification-blocked mutation system) markers, which is simple to operate and low in cost. The labeling system comprises a pair of fluorescent universal primers (FAM and HEX are used as report fluorescence), a pair of SNP allele specific primers and a reverse common primer, so that SNP allele detection can be rapidly and simply performed.
(1) For the peak SNP marker Bn-A03-p14176469 associated with qSW.A3-3, 100bp sequences of the 13,373,806 th base upstream and downstream of the rape A03 chromosome are extracted. The primer sequences obtained according to the PARMS primer design principle are as follows: qSW.A3-3F: GAATTAAGTAGAAGCTCGCAAACAC, qSW.A3-3Ra:GAAGGTGACCAAGT TCATGCTTGTTGATGGTTGACTTCTGGTGA、qSW.A3-3Rg:GAAGGTCGGAGTCAAC GGATTTGTTGATGGTTGACTTCTGGTGG。
for the peak SNP marker Bn-scaff_22067_1-p219321 associated with qSW.C3-3, 100bp sequences of the 20,819,936 th base upstream and downstream of the rape C03 chromosome were extracted. The primer sequences obtained according to the PARMS primer design principle are as follows: qSW.C3-3F: ATTTCATTCTTCGTTATAGCAGGC, qSW.C3-3Ra:GAAGGTGACCAAGTTCATGCTGAGCAAATCTGGTCATAGAAAGAGA、qSW.C3-3Rg:GAAGGTCGGAGTCAACGGATTGAGCAAATCTGGTCATAGAAAGAGG。
(2) And (3) taking genome DNA of rape related population as a template, carrying out fluorescent quantitative PCR amplification by using the primer, scanning FAM, HEX and ROX signals by using TecanF200, outputting the results, and finally converting the results into genotypes.
Example 3: application of PARMS mark in rape thousand seed weight screening
Of 331 relevant populations (Li et al 2020), 79 parts of AA genotype material were detected with the PARMS marker qsw.a3-3 provided in example 2 and 240 parts of GG genotype (table two). The thousand grain weight difference between the two genotypes reached a significant level in nine environments, with the thousand grain weight difference between the two genotypes AA and GG ranging from 0.18 to 0.34, on average 0.23 grams.
Comparison of thousand-grain weights of two genotypes of Table II and PARMS marker qSW.A3-3 in ten environments of related populations
Genotype of the type | N13 | N14 | W12 | W13 | W14 | W15 | W16 | W17 | Z13 | Z14 |
AA(n=79) | 4.91 | 4.37 | 4.48 | 3.95 | 4.09 | 4.35 | 3.78 | 3.94 | 3.87 | 4.19 |
GG(n=240) | 4.72 | 4.09 | 4.14 | 3.77 | 3.89 | 4.10 | 3.56 | 3.72 | 3.68 | 4.09 |
AA-GG | 0.19* | 0.28** | 0.34** | 0.18* | 0.20* | 0.25* | 0.22* | 0.22* | 0.18* | 0.10 |
* And represents significance levels p=0.05 and 0.01, respectively.
Of 331 relevant populations, 66 were detected for materials with genotype AA and 262 for genotype GG with the PARMS marker qsw.c3-3 provided in example 2 (table three). The thousand grain weight difference of the two genotypes reached a significant level in seven environments, with the thousand grain weight difference of the two genotypes AA and GG ranging from 0.19 to 0.41, on average 0.30 grams.
Comparison of thousand grain weights of two genotypes of table three and PARMS marked qSW.C3-3 in ten environments of related populations
Genotype of the type | N13 | N14 | W12 | W13 | W14 | W15 | W16 | W17 | Z13 | Z14 |
AA(n=66) | 4.77 | 4.35 | 4.57 | 3.99 | 4.20 | 4.47 | 3.89 | 3.94 | 3.81 | 4.14 |
GG(n=262) | 4.64 | 4.11 | 4.16 | 3.76 | 3.89 | 4.10 | 3.54 | 3.75 | 3.69 | 4.09 |
AA-GG | 0.13 | 0.24* | 0.41*** | 0.22* | 0.31** | 0.37** | 0.34** | 0.19* | 0.12 | 0.05 |
* Sum represents significance levels p= 0.05,0.01 and 0.001, respectively.
Of 331 relevant populations, the primers providing PARMS markers qSW.A3-3 and qSW.C3-3 of example 2 were used to combine 23 parts of the material with genotype AA in qSW.A3-3 and genotype AA in qSW.C3-3, 175 parts of the material with genotype GG in qSW.A3-3 and genotype GG in qSW.C3-3, and the thousand-grain weight difference of both genotypes reached a significance level in nine environments. Wherein the difference in 5 environments reaches an extremely significant level, ranging from 0.41 to 0.56, with an average of 0.46 grams.
Comparison of thousand-grain weights of two genotypes of Table four, PARMS markers qSW.A3-3 and qSW.C3-3 in ten environments of the related population
* Sum represents significance levels p= 0.05,0.01 and 0.001, respectively.
The above results are sufficient to demonstrate that the PARMS markers qSW.A3-3 and qSW.C3-3 prepared by us are highly correlated with thousand seed weight of canola, and have good selection effect both alone and in combination.
Claims (2)
1. Application of primer for detecting 20,819,936 th base of C03 chromosome of rape DarmorV4.1 reference genome in rape thousand seed weight selection breeding, wherein the primer is as follows:qSW.C3-3F:ATTTCATTCTTCGTTATAGCAGGC、qSW.C3- 3ra: GAAGGTGACCAAGTTCATGCTGAGCAAATCTGGTCATAGAAAGAGA and is provided withqSW.C3-3Rg: GAAGGTCGGAGTCAACGGATTGAGCAAATCTGGTCATAGAAAGAGG。
2. Application of primer for detecting 13,373,806 th base of rape DarmorV4.1 reference genome A03 chromosome and 20,819,936 th base of rape C03 chromosome in thousand seed weight selective breeding of rape, wherein the primer is as follows:qSW.A3-3F:GAATTAAGTAGAAGCTCGCAAACAC、qSW.A3-3ra: GAAGGTGACCAAGTTCATGCTTGTTGATGGTTGACTTCTGGTGA and is provided withqSW.A3-3Rg: GAAGGTCGGAGTCAACGGATTTGTTGATGGTTGACTTCTGGTGG;qSW.C3-3F:ATTTCATTCTTCGTTATAGCAGGC、qSW.C3-3Ra: GAAGGTGACCAAGTTCATGCTGAGCAAATCTGGTCATAGAAAGAGA and is provided withqSW.C3-3Rg: GAAGGTCGGAGTCAACGGATTGAGCAAATCTGGTCATAGAAAGAGG。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202310504317.8A CN116555476B (en) | 2023-05-07 | 2023-05-07 | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.C3-3 of rape |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202310504317.8A CN116555476B (en) | 2023-05-07 | 2023-05-07 | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.C3-3 of rape |
Publications (2)
Publication Number | Publication Date |
---|---|
CN116555476A CN116555476A (en) | 2023-08-08 |
CN116555476B true CN116555476B (en) | 2023-12-01 |
Family
ID=87497613
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202310504317.8A Active CN116555476B (en) | 2023-05-07 | 2023-05-07 | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.C3-3 of rape |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN116555476B (en) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110157829A (en) * | 2019-04-16 | 2019-08-23 | 中国农业科学院油料作物研究所 | A kind of and the associated molecular marker SNP A9-5 of rape mass of 1000 kernel and application |
CN110184373A (en) * | 2019-04-16 | 2019-08-30 | 中国农业科学院油料作物研究所 | A kind of and the associated molecular labeling of rape mass of 1000 kernel and application |
CN114182041A (en) * | 2021-12-23 | 2022-03-15 | 中国农业科学院油料作物研究所 | PARMS molecular marker associated with number of ovules per ovary of rape and application |
CN114231654A (en) * | 2021-12-23 | 2022-03-25 | 中国农业科学院油料作物研究所 | PARMS molecular marker associated with thousand grain weight of rape and application thereof |
CN114854894A (en) * | 2022-05-10 | 2022-08-05 | 贵州省油菜研究所 | SNP molecular marker of main effect QTL site of thousand grain weight trait of brassica napus, related detection primer or probe and application |
-
2023
- 2023-05-07 CN CN202310504317.8A patent/CN116555476B/en active Active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110157829A (en) * | 2019-04-16 | 2019-08-23 | 中国农业科学院油料作物研究所 | A kind of and the associated molecular marker SNP A9-5 of rape mass of 1000 kernel and application |
CN110184373A (en) * | 2019-04-16 | 2019-08-30 | 中国农业科学院油料作物研究所 | A kind of and the associated molecular labeling of rape mass of 1000 kernel and application |
CN114182041A (en) * | 2021-12-23 | 2022-03-15 | 中国农业科学院油料作物研究所 | PARMS molecular marker associated with number of ovules per ovary of rape and application |
CN114231654A (en) * | 2021-12-23 | 2022-03-25 | 中国农业科学院油料作物研究所 | PARMS molecular marker associated with thousand grain weight of rape and application thereof |
CN114854894A (en) * | 2022-05-10 | 2022-08-05 | 贵州省油菜研究所 | SNP molecular marker of main effect QTL site of thousand grain weight trait of brassica napus, related detection primer or probe and application |
Non-Patent Citations (2)
Title |
---|
Identification of Putative Candidate Genes for Water Stress Tolerance in Canola(Brassica napus);Zhang J.等;《Front.Plant Sci.》;第6卷;摘要,第 2页,补充表 2 * |
甘蓝型油菜千粒重全基因组关联分析;张春等;《作物学报》;第47卷(第04期);第650-659页 * |
Also Published As
Publication number | Publication date |
---|---|
CN116555476A (en) | 2023-08-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN114231654B (en) | PARMS molecular marker associated with thousand grain weight of rape and application thereof | |
CN101970669B (en) | Gray leaf spot tolerant maize and methods of production | |
CN110157829B (en) | Molecular marker SNPA9-5 associated with thousand seed weight of rape and application | |
CN110184373B (en) | Molecular marker associated with thousand seed weight of rape and application thereof | |
CN111893209B (en) | Indel site detection marker related to thousand grain weight of wheat and application thereof | |
Mei et al. | pms 3 is the locus causing the original photoperiod-sensitive male sterility mutation of’Nongken 58S’ | |
CN114182041B (en) | PARMS molecular marker related to number of ovules of rape per ovary and application | |
CN109762926B (en) | Molecular marker primer related to rape pod number and application | |
CN117737279A (en) | Cadmium low-accumulation hybrid rice molecular marker, rice mutant OsNramp5 gene, and identification method, application and primer thereof | |
CN105603083B (en) | Method for carrying out corn-assisted efficient breeding by using two molecular markers including SSR (simple sequence repeat) and SNP (Single nucleotide polymorphism) | |
CN116926229A (en) | Molecular marker closely linked with high-vitamin E main effect QTL locus qVE.C02 of rape seed and application | |
CN116790797A (en) | KASP primer group related to wheat grain weight and application thereof | |
CN116555476B (en) | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.C3-3 of rape | |
CN116694809A (en) | KASP primer group related to wheat grain weight and application | |
CN116574833B (en) | Application of PARMS molecular marker or marker combination of rape thousand seed weight associated site qSW.A1-2 | |
CN116555474B (en) | Application of rape thousand seed weight-related PARMS molecular markers or marker combinations | |
CN116606950B (en) | Application of PARMS molecular marker or marker combination of thousand seed weight associated locus qSW.9-4 of rape | |
CN115029465B (en) | KASP and dCAPS markers coseparated with rape seed secondary dormancy main effect QTL and application thereof | |
CN107287210B (en) | Rice appearance quality gene qAQ7 and molecular marking method and application thereof | |
CN114703316A (en) | Development and application of KASP marker of tomato ps-2 gene | |
CN111118192B (en) | KASP molecular marker of wheat ear base small ear fruition main effect QTL and application thereof | |
CN111778348B (en) | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof | |
CN116479164B (en) | SNP locus, molecular marker, amplification primer and application of SNP locus and molecular marker related to soybean hundred-grain weight and size | |
CN116640878B (en) | Molecular marker of wheat floret number QTL per spike developed based on novel mode of multi-single-combined-standard-evidence and application thereof | |
CN117904360A (en) | Molecular marker closely linked with major site RT.A10 of rape root system and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |