CN107267660B - SSR molecular marker for detecting fertility of beet stamens and application thereof - Google Patents

Abstract

The invention discloses an SSR molecular marker for detecting the stamen fertility of sugar beet and its application, and relates to an SSR molecular marker for detecting the stamen fertility of sugar beet and its application. The invention aims to solve the problem that the existing molecular markers related to the stamen fertility of sugar beet are not easy to identify. The primer pairs used for PCR amplification of the molecular marker were BvRE051-S and BvRE051-A. The SSR molecular marker was used to identify the stamen fertility of sugar beet. The consistency of the SSR molecular marker detection results of the present invention and the performance of the stamen fertility traits of sugar beet reaches 70%, and reaches 63.33% and 76.67% in fertile and sterile individuals, respectively. It shows that the marker has a linkage relationship with stamen fertility and can be used for the detection of stamen fertility. The invention is used for the stamen fertility detection of sugar beet.

Description

SSR Molecular Markers for Detecting Stamen Fertility of Sugar Beet and Its Application

technical field

The invention belongs to the technical field of molecular markers, and relates to an SSR molecular marker for detecting the stamen fertility of sugar beet and its application.

Background technique

Sugar beet (Beta Vulgaris) has dual pollination pathways of wind-borne and insect-borne, and is very prone to hybridization. Therefore, it is very important to identify the fertility of stamens and obtain male-sterile germplasm for cross-breeding of sugar beet. The male-sterile line is used as the female parent. Hybridization can ensure the accuracy of the hybridization results, save labor and improve the success rate. However, the acquisition of beet male sterile lines and corresponding maintainer lines is time-consuming, labor-intensive and lack of germplasm resources. The male sterile materials in my country mainly come from five ways: foreign introduction, natural mutation of male sterile plants, hybrid offspring separation, chemical mutagenesis and physical mutagenesis.

With the acquisition of male sterility germplasm, the genetic mechanism of male sterility is also under study. Male sterility is divided into two types according to the cause of formation: cytoplasmic male sterility and cytoplasmic male sterility (also called cytoplasmic male sterility). In application, plasmon-nucleus interaction type male sterility is theoretically easier to operate by matching with maintainer lines. For sugar beet, the germplasm of sterile lines and maintainer lines is still relatively lacking, and the current method for identifying stamen fertility is still dominated by classical morphological observation, which is difficult and inefficient, and is limited by the growth stage of the plant. , Beet is mostly biennial growth habit, fertility identification workload is large and the cycle is long.

Owen and Bliss successively put forward the hypothesis of the genetic mechanism of male sterility with cytoplasmic-nucleus interaction in sugar beet. They believe that there are alleles that control fertility in the cytoplasm and nucleus of sugar beet, and the existence and interaction of different alleles affect the stamens of sugar beet. Fertility, and there are different degrees of influence, making sugar beet appear fertile, sterile, semi-fertile, semi-sterile and other different types. However, these genes encoding fertility control have not yet been identified, and the molecular mechanism is still unclear.

Under the circumstance that the character detection cycle is long, difficult, and the molecular mechanisms controlling the characters are unknown, molecular markers play an important role in the study of sugar beet fertility in two aspects: on the one hand, they can be directly used as tools to predict sugar beet fertility, Molecular marker-assisted selection is used to improve the accuracy of results and reduce workload; on the other hand, as sequence information and starting material, fertility-related genes are mined by methods such as genome walking.

At present, very few molecular markers related to fertility have been developed in sugar beet. Most of the researches focus on one allelic locus Rf1, and the research focuses on the genetic mechanism of the existing sterile lines and maintainer lines, and the identification of fertility. The auxiliary role is very limited. Therefore, the independent development of fertility-related molecular markers is beneficial to the development and utilization of male-sterile germplasm of sugar beet in my country.

SUMMARY OF THE INVENTION

The present invention aims to solve the problem of lack of molecular markers related to the stamen fertility of sugar beet, and it is difficult to identify the stamen fertility of sugar beet, and provides an SSR molecular marker for detecting the stamen fertility of sugar beet and its application.

In the present invention, a simple sequence repeat (SSR) candidate marker is developed by using high-throughput sequencing technology, and the SSR molecular marker BvRE051 related to the stamen fertility of sugar beet is screened out from the F ₂ segregated population, and the marker amplification region is obtained. sequence and genome mapping. The molecular marker can be used to detect male sterile individuals in sugar beet.

The present invention detects the SSR molecular marker of the stamen fertility of sugar beet, and the primer pairs used for PCR amplification of the molecular marker are BvRE051-S and BvRE051-A, and the specific sequences are:

BvRE051-S: 5'-TCCAACTTTGGGACTCTAAATTAAC-3'

BvRE051-A: 5'-GAAAGTGACGGCGAGAATGT-3'.

The application of the above SSR molecular marker for detecting the stamen fertility of sugar beet is used to identify the stamen fertility of sugar beet.

The specific identification method is:

1. Isolate and extract total DNA from young beet leaves. If it is difficult to obtain leaves, other parts can be used instead;

2. Taking the DNA obtained in step 1 as a template, using primers BvRE051-S and BvRE051-A to carry out PCR amplification,

3. Separate the PCR amplification products obtained in step 2 by polyacrylamide gel electrophoresis (PAGE), and determine the results according to the size of the amplification products. If only a 172bp band is detected, it is determined that the stamens are sterile. ; If in addition to the 172bp band, the 232bp band and the 274bp band are also detected, the stamens are judged to be fertile.

In step 2, the primer BvRE051-S is 5'-TCCAACTTTGGGACTCTAAATTAAC-3', and the primer BvRE051-A is 5'-GAAAGTGACGGCGAGAATGT-3'.

Further, the conditions of the PCR amplification reaction described in step 2 are: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 57 °C for 1 min, extension at 72 °C for 1 min, a total of 30 cycles, and a final extension at 72 °C for 5 min.

Beneficial effects of the present invention:

The invention provides an SSR molecular marker for identifying the stamen fertility of sugar beet, realizes rapid and accurate identification of the stamen fertility of sugar beet, overcomes the shortcomings of the prior art, and has high repeatability and stable PCR reaction system and reaction conditions. The performance is good, the identification time is effectively shortened, and the identification method is accurate.

The consistency of the SSR molecular marker detection results of the present invention and the performance of the stamen fertility traits of sugar beet reaches 70%, and reaches 63.33% and 76.67% in fertile and sterile individuals, respectively. It shows that the marker has a linkage relationship with stamen fertility and can be used for the detection of stamen fertility.

The sequences of the amplified regions of the markers were aligned with the sugar beet genome, and genomic localization of the markers was performed. The results show that the molecular marker BvRE051 of the present invention is located in the 56139357-56139534 region of chromosome 6 in the sugar beet genome.

The molecular marker is used for the auxiliary selection of sugar beet male sterility or maintainer line and the prediction of the fertility potential of sugar beet germplasm, and assists the research on the mechanism of sugar beet male sterility and the mining of sugar beet fertility related genes.

Description of drawings

Fig. 1 is the genotyping results of fertile individuals of sugar beet;

Figure 2 shows the genotyping results of infertile individuals in sugar beet.

Detailed ways

The technical solutions of the present invention are not limited to the specific embodiments listed below, but also include any combination of specific embodiments.

Embodiment 1: This embodiment detects the SSR molecular marker of the stamen fertility of sugar beet, and the primer pairs used for PCR amplification of the molecular marker are BvRE051-S and BvRE051-A, and the specific sequences are:

BvRE051-S: 5'-TCCAACTTTGGGACTCTAAATTAAC-3'

BvRE051-A: 5'-GAAAGTGACGGCGAGAATGT-3'.

In this embodiment, SSR molecular markers related to the stamen fertility of sugar beet are obtained, which can be used alone or in combination with other primers, and the stamen fertility of sugar beet can be pre-judged by PCR detection, and genomic DNA can be extracted at any growth stage of sugar beet as a material , reduce the workload and shorten the cycle of fertility judgment.

Markers can be used to determine the fertility of a germplasm or individual. When judging the fertility of the entire germplasm, it can be directly judged based on the PCR results combined with statistical analysis, or the trait investigation of key individuals can be used as a supplement, without the need for two-year-long sowing-mother roots for all individuals. Cultivation - female root planting - stamen fertility trait investigation - individual elimination; when it is used to judge the fertility of beet individuals, it can also be pre-judged before flowering and powdering according to the PCR results to narrow the range of individual characters for investigation.

The location information of markers can be used for the mining of fertility genes.

Specific embodiment 2: The application of the SSR molecular marker for detecting the stamen fertility of sugar beet in this embodiment is used to identify the stamen fertility of sugar beet.

Embodiment 3: The difference between this embodiment and Embodiment 2 is that the specific identification method is:

1. Isolation and extraction of total DNA from young leaves of sugar beet;

2. Taking the DNA obtained in step 1 as a template, using primers BvRE051-S and BvRE051-A to carry out PCR amplification,

3. Separate the PCR amplification products obtained in step 2 by polyacrylamide gel electrophoresis, and determine the results according to the size of the amplification products. If only a 172bp band is detected, it is determined that the stamens are sterile; In addition to the bands of 232bp and 274bp, it was determined that the stamens were fertile. Others are the same as in the second embodiment.

Embodiment 4: This embodiment differs from Embodiment 3 in that the primer BvRE051-S in step 2 is 5'-TCCAACTTTGGGACTCTAAATTAAC-3', and the primer BvRE051-A is 5'-GAAAGTGACGGCGAGAATGT-3'. Others are the same as the third embodiment.

Embodiment 5: The difference between this embodiment and Embodiment 3 or 4 is that the conditions of the PCR amplification reaction described in step 2 are: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30s, annealing at 57°C for 1 min, and annealing at 72°C for 1 min. A total of 30 cycles were performed for 1 min of extension, and the final extension was at 72°C for 5 min. Others are the same as the specific embodiment or four.

The embodiments of the present invention are described in detail below. The following embodiments are implemented on the premise of the technical solutions of the present invention, and provide detailed embodiments and specific operation processes, but the protection scope of the present invention is not limited to the following implementations example.

Example 1:

_A large number of sugarbeet sequences were obtained by high-throughput sequencing, unreported SSR markers were mined, and more than 100 candidate markers with good quality and polymorphism were screened. .

The fertile and sterile individuals were selected from the segregation generation to construct a mixed pool, and the candidate markers were screened by the method of bulk segregation analysis (BSA), and 8 SSR markers showing polymorphism among the mixed pools were obtained. . The SSR molecular marker related to the stamen fertility of sugar beet was selected and named as BvRE051.

After investigating the stamen fertility of the segregating generations, 30 sugar beet plants of fertile and sterile individuals were genotyped by markers according to the following methods:

1. Extract the DNA of 30 young leaves of sugar beet respectively;

2. Using the DNA obtained in step 1 as a template, use primers BvRE051-S and BvRE051-A to carry out PCR amplification, and the PCR reaction system is shown in Table 1:

Table 1

The PCR amplification reaction conditions were as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 57°C annealing for 1 min, 72°C extension for 1 min, a total of 30 cycles, and a final extension at 72°C for 5 min.

3. Result detection method: The PCR amplification product obtained in step 2 is separated by polyacrylamide gel electrophoresis, the gel cross-linking degree is 8%, the electrophoresis voltage is 100V, and the time is 4-5h. After electrophoresis, stain with 10 mg/L ethidium bromide (EB) solution for 15-20 min.

The genotyping results of fertile individuals are shown in Figure 1, where M represents DNA 50bp marker, P ₁ represents female parent (male sterile), P ₂ represents male parent (male fertile), number 1-30 is 30 Fertile individuals. The genotyping results of sterile individuals are shown in Figure 2, where M represents DNA 50bp marker, P ₁ represents female parent (male sterile), P ₂ represents male parent (male fertile), number 1-30 is 30 Infertile individuals.

Genotyping was performed on the fertile and sterile individuals of the segregation generation, respectively, to verify the consistency between the markers and the performance of fertility traits. It was found that the molecular marker BvRE051 was 70% consistent with the performance of stamen fertility in all individuals, 63.33% and 76.67% in fertile and sterile individuals, respectively. It shows that the marker has a linkage relationship with stamen fertility and can be used for the detection of stamen fertility.

Table 2 Detection results of stamen fertility-related markers on plants with different fertility

After sequencing, the amplified sequence of BvRE051 is as follows (the underlined part is the SSR repeat unit):

Sterility-related band (172bp):

GAAAGTGACGGCGAGAATGTCGCCGGAAAGTGCAGCGGCATTCGCCGGAAAAGAGGAGAGAGAAAGTAGAAAGCAGGAGAGAGAGAGTGAGGAGAGAGTGTAAAAATGGGGGAGA ATTTGTATTTGT ATAGTTGTAAATTAATAAGTTAATTTAGAGTCCCAAAGTTGGA

Fertility-related band 1 (232bp):

GAAAGTGACGGCGAGAATGTCGCCGGAAAGTGCAGCGGCATTCGCCGGAAAAGAGGAGAGAGAAAGTAGAAAGCAGGAGAGAGAGAGTGAGGAGAGAGTGTAAAAATGGGGGAGA ATTTGTATTTGTATTTGTATTTGTATTTG TATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGT ATAGTTGTAAATTAATAAGTTAATTTAGAGTCCCAAAGTTGGA

Fertility-related band 2 (274bp):

GAAAGTGACGGCGAGAATGTCGCCGGAAAGTGCAGCGGCATTCGCCGGAAAAGAGGAGAGAGAAAGTAGAAAGCAGGAGAGAGAGAGTGAGGAGAGAGTGTAAAAATGGGGGAGA ATTTGTATTTGTATTTGTATTTGTATTTG TATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGATTTGTATTTGTATTTGTATTTGTATTTGTATTTGAAGGATGTAGAGTAG

According to the result of the size determination of the amplified product, if only the 172bp band is detected, it is determined that the stamens are sterile; if in addition to the 172bp band, the 232bp band and the 274bp band are also detected, it is determined as Stamens are fertile.

The BlastN comparison analysis of the amplified product with the plant non-redundant nucleic acid database showed that the amplified product of BvRE051 was similar to a "serine-threonine kinase mRNA predicted to be a leucine receptor" in sugar beet, and the sequence similarity was 1-135bp of the amplified fragment, the sequence similarity of this part is 100%.

The marker was mapped based on sequence similarity and was located in the region 56139357-56139534 of chromosome 6 in the sugar beet genome.

sequence list

<110> Heilongjiang University

<120> SSR Molecular Markers for Detecting Stamen Fertility of Sugar Beet and Its Application

<160> 5

<210> 1

<211> 25

<212> DNA

<213> Artificial sequences

<220>

<223> PCR primer BvRE051-S

<400> 1

tccaactttgggactctaaattaac 25

<210> 2

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> PCR primer BvRE051-A

<400> 2

gaaagtgacggcgagaatgt 20

<210> 3

<211> 172

<212> DNA

<213> Artificial sequences

<220>

<223> Sterility-related band sequences

<400> 3

gaaagtgacg gcgagaatgt cgccggaaag tgcagcggca ttcgccggaa aagaggagag 60

agaaagtaga aagcaggaga gagagagtga ggagagagag tgtaaaaatg ggggagaatt 120

tgtatttgta tagttgtaaa ttaataagtt aatttagagt cccaaagttg ga 172

<210> 4

<211> 232

<212> DNA

<213> Artificial sequences

<220>

<223> Fertility Related Band 1 Sequence

<400> 4

gaaagtgacg gcgagaatgt cgccggaaag tgcagcggca ttcgccggaa aagaggagag 60

agaaagtaga aagcaggaga gagagagtga ggagagagag tgtaaaaatg ggggagaatt 120

tgtatttgta tttgtatttg tatttgtatt tgtatttgta tttgtatttg tatttgtatt 180

tgtatttgta tagttgtaaa ttaataagtt aatttagagt cccaaagttg ga 232

<210> 5

<211> 274

<212> DNA

<213> Artificial sequences

<220>

<223> Fertility Related Band 2 Sequence

<400> 5

gaaagtgacg gcgagaatgt cgccggaaag tgcagcggca ttcgccggaa aagaggagag 60

agaaagtaga aagcaggaga gagagagtga ggagagagag tgtaaaaatg ggggagaatt 120

tgtatttgta tttgtatttg tatttgtatt tgtatttgta tttgtatttg tatttgtatt 180

tgtatttgta tttgtatttg tatttgtatt tgtatttgta tttgtatttg tatagttgta 240

aattaataag ttaatttaga gtcccaaagt tgga 274

Claims (5)

1. detect the SSR molecular marker of beet stamen fertility, it is characterized in that the primer pair that is used for PCR amplification of this molecular marker is BvRE051-S and BvRE051-A, and the concrete sequence is: BvRE051-S: 5'-TCCAACTTTGGGACTCTAAATTAAC-3' BvRE051-A: 5'-GAAAGTGACGGCGAGAATGT-3'; The nucleotide sequences of the fertility-related molecular markers are shown in SEQ ID NO: 4 and SEQ ID NO: 5 in the sequence listing, and the nucleotide sequences of the sterility-related molecular markers are shown in SEQ ID NO: 3 in the sequence listing. . 2. The application of the SSR molecular marker for detecting the stamen fertility of sugar beet as claimed in claim 1, characterized in that it is used to identify the stamen fertility of sugar beet. 3. application according to claim 2 is characterized in that concrete identification method is: 1. Isolation and extraction of total DNA from young leaves of sugar beet; 2. Using the DNA obtained in step 1 as a template, use primers BvRE051-S and BvRE051-A to carry out PCR amplification; 3. Separate the PCR amplification products obtained in step 2 by gel electrophoresis, and determine the results according to the size of the amplification products. If only the 172bp band is detected, it is determined that the stamens are sterile; if only the 172bp band is detected In addition, a band of 232bp and a band of 274bp were also detected, and it was judged that the stamens were fertile. 4. The application according to claim 3, wherein the primer BvRE051-S in step 2 is 5'-TCCAACTTTGGGACTCTAAATTAAC-3', and the primer BvRE051-A is 5'-GAAAGTGACGGCGAGAATGT-3'. 5. The application according to claim 3, wherein the conditions of the PCR amplification reaction in step 2 are: 94°C pre-denaturation for 5 min, 94°C denaturation for 30s, 57°C annealing for 1 min, and 72°C extension for 1 min, a total of 30 cycles and a final extension at 72°C for 5 min.

Images