CN107267660B - SSR molecular marker for detecting fertility of beet stamens and application thereof - Google Patents
SSR molecular marker for detecting fertility of beet stamens and application thereof Download PDFInfo
- Publication number
- CN107267660B CN107267660B CN201710718808.7A CN201710718808A CN107267660B CN 107267660 B CN107267660 B CN 107267660B CN 201710718808 A CN201710718808 A CN 201710718808A CN 107267660 B CN107267660 B CN 107267660B
- Authority
- CN
- China
- Prior art keywords
- fertility
- beet
- bvre051
- molecular marker
- stamens
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An SSR molecular marker for detecting the fertility of beet stamens and application thereof relate to an SSR molecular marker for detecting the fertility of beet stamens and application thereof. The invention aims to solve the problem that the fertility of the beet stamens is not easy to identify due to the lack of the related molecular markers of the fertility of the beet stamens. The primer pair for PCR amplification of the molecular marker is BvRE051-S and BvRE 051-A. The SSR molecular marker is used for identifying the fertility of the stamens of the beet. The SSR molecular marker detection result of the invention has 70% consistency with the fertility character of the beet stamens, and respectively reaches 63.33% and 76.67% in fertile and sterile individuals. The marker is shown to have a linkage relation with the stamen fertility and can be used for detecting the stamen fertility. The invention is used for detecting the fertility of the beet stamens.
Description
Technical Field
The invention belongs to the technical field of molecular markers, and relates to an SSR molecular marker for detecting fertility of beet stamens and application thereof.
Background
The beet (Beta Vulgaris) has a dual pollination approach of aeolian pollination and entomophilous pollination and is very easy to hybridize, so that the fertility of stamens is identified, male sterile germplasm is obtained, the hybrid breeding of the beet is very important, the accuracy of a hybridization result can be ensured by hybridizing a male sterile line as a female parent, the labor amount is saved, and the success rate is improved. However, the acquisition of sugar beet male sterile lines and corresponding maintainer lines is time consuming and laborious and is deficient in germplasm resources. The male sterile material in China mainly comes from 5 approaches: foreign introduction, natural mutation of male sterile plants, hybrid progeny separation, chemical mutagenesis and physical mutagenesis.
With the acquisition of male sterile germplasm, the genetic mechanism of male sterility is also under study. Male sterility is classified into 2 types by the cause of formation: nuclear-type male sterility and cytoplasmic-nuclear interactive male sterility (also called cytoplasmic male sterility). In application, cytoplasmic-nuclear interaction male sterility is theoretically easier to operate by matching with a maintainer line. For beet, the germplasm of the sterile line and the germplasm of the maintainer line are still relatively deficient, and the current method for identifying the fertility of the stamens is mainly based on classical morphological observation, has high difficulty and low efficiency, is limited by the growth stage of plants, is mainly the growth habit of two years of beet, and has large workload and long period of fertility identification.
Owen and Bliss successively proposed the hypothesis of the genetic mechanism of sugar beet cytoplasmic-nuclear interaction type male sterility, and it is believed that both the cytoplasm and nucleus of sugar beet have alleles for controlling fertility, and the existence and interaction of different alleles affect the fertility of the stamen of sugar beet and influence the fertility to different degrees, so that the sugar beet has different types of fertility, sterility, semi-fertility, semi-sterility, etc. However, these genes encoding fertility control have not been identified so far, and the molecular mechanism has not been clarified.
Under the conditions of long character detection period, high difficulty and unknown molecular mechanism for controlling characters, the molecular marker plays an important role in researching beet fertility in two aspects: on one hand, the kit can be directly used as a tool for predicting the beet fertility, and the result accuracy is improved and the workload is reduced by the auxiliary selection of molecular markers; on the other hand, as sequence information and starting materials, fertility-related genes are mined by a method such as genome walking.
Currently, few molecular markers related to fertility are developed in beet, most researches are carried out around an allele locus Rf1, the researches focus on the genetic mechanism research of the existing sterile line and maintainer line, and the auxiliary effect on fertility identification is very limited. Therefore, the development of molecular markers related to fertility is self-determined, and the development and utilization of the beet male sterile germplasm in China are facilitated.
Disclosure of Invention
The invention provides an SSR molecular marker for detecting the fertility of beet stamens and application thereof, aiming at solving the problems that the fertility of the beet stamens is not easy to identify due to the lack of the existing molecular marker related to the fertility of the beet stamens.
The invention develops Simple Sequence Repeat (SSR) candidate markers by using a high-throughput sequencing technology and uses F2Separating the population, screening the SSR molecular marker BvRE051 related to the fertility of the beet stamens, obtaining the sequence of the marker amplification region and carrying out genome positioning. The molecular marker can be used for detecting beet male sterile individuals.
The invention discloses an SSR molecular marker for detecting the fertility of beet stamens, wherein the primer pairs for PCR amplification of the molecular marker are BvRE051-S and BvRE051-A, and the specific sequence is as follows:
BvRE051-S：5'-TCCAACTTTGGGACTCTAAATTAAC-3'
BvRE051-A：5'-GAAAGTGACGGCGAGAATGT-3'。
the application of the SSR molecular marker for detecting the fertility of the beet stamens is used for identifying the fertility of the beet stamens.
The specific identification method comprises the following steps:
firstly, separating and extracting total DNA from young leaves of the beet, and if the leaves are difficult to obtain, replacing the leaves with other parts;
secondly, taking the DNA obtained in the step one as a template, adopting primers BvRE051-S and BvRE051-A to carry out PCR amplification,
thirdly, separating the PCR amplification product obtained in the second step by using polyacrylamide gel electrophoresis (PAGE), judging the result according to the size of the amplification product, and if only a band of 172bp is detected, judging that the stamen is sterile; if a band of 232bp and a band of 274bp are detected in addition to the band of 172bp, it is judged that the stamen is fertile.
And in the second step, the primer BvRE051-S is 5'-TCCAACTTTGGGACTCTAAATTAAC-3', and the primer BvRE051-A is 5'-GAAAGTGACGGCGAGAATGT-3'.
Further, the conditions of the PCR amplification reaction in step two are: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 57 deg.C for 1min, extension at 72 deg.C for 1min, 30 cycles, and final extension at 72 deg.C for 5 min.
The invention has the beneficial effects that:
the SSR molecular marker for identifying the fertility of the beet stamens provided by the invention realizes the rapid and accurate identification of the fertility of the beet stamens, overcomes the defects of the prior art, has high repeatability and good stability of a PCR reaction system and reaction conditions, effectively shortens the identification time, and has an accurate identification method.
The SSR molecular marker detection result of the invention has 70% consistency with the fertility character of the beet stamens, and respectively reaches 63.33% and 76.67% in fertile and sterile individuals. The marker is shown to have a linkage relation with the stamen fertility and can be used for detecting the stamen fertility.
And (3) comparing the sequence of the marker amplification region with the beet genome, and carrying out genome positioning on the marker. The results show that the molecular marker BvRE051 is positioned in the 56139357 and 56139534 regions of the 6 th chromosome in the beet genome.
The molecular marker is used for auxiliary selection of beet male sterility or maintainer lines and prediction of fertility potential of beet germplasm, and is also used for auxiliary research of beet male sterility mechanism and mining of beet fertility related genes.
Drawings
FIG. 1 shows the genotyping results of a fertile beet individual;
FIG. 2 shows the genotyping results of sterile individuals of sugar beet.
Detailed Description
The technical solution of the present invention is not limited to the following specific embodiments, but includes any combination of the specific embodiments.
The first embodiment is as follows: in the SSR molecular marker for detecting the fertility of the stamens of the beets, the primer pairs for PCR amplification of the molecular marker are BvRE051-S and BvRE051-A, and the specific sequence is as follows:
BvRE051-S：5'-TCCAACTTTGGGACTCTAAATTAAC-3'
BvRE051-A：5'-GAAAGTGACGGCGAGAATGT-3'。
the SSR molecular marker related to the fertility of the stamen of the beet is obtained in the embodiment, and the SSR molecular marker is used independently or is used together with other primers, the fertility of the stamen of the beet can be judged in advance through PCR detection, genomic DNA can be extracted as a material in any growth period of the beet, the workload is reduced, and the fertility judgment period is shortened.
The markers can be used to judge fertility of a germplasm or an individual. When the method is used for judging the fertility of the whole germplasm, the judgment can be directly carried out according to the PCR result and the statistical analysis, or the character investigation is carried out on key individuals to supplement the PCR result, and the method does not need to carry out two-year-consuming sowing, mother root cultivation, mother root planting, character investigation of stamen fertility and individual elimination on all individuals; when the method is used for judging the fertility of the beet individual, the method can also be used for pre-judging before blooming and pollen scattering according to the PCR result, so that the scope of character investigation individuals is narrowed.
The location information of the marker can be used for mining fertility genes.
The second embodiment is as follows: the application of the SSR molecular marker for detecting the fertility of the beet stamens in the embodiment is used for identifying the fertility of the beet stamens.
The third concrete implementation mode: the second embodiment is different from the first embodiment in that: the specific identification method comprises the following steps:
firstly, separating and extracting total DNA from young leaves of beet;
secondly, taking the DNA obtained in the step one as a template, adopting primers BvRE051-S and BvRE051-A to carry out PCR amplification,
thirdly, separating the PCR amplification product obtained in the second step by using polyacrylamide gel electrophoresis, and judging that the stamens are sterile if only a band of 172bp is detected according to the size judgment result of the amplification product; if a band of 232bp and a band of 274bp are detected in addition to the band of 172bp, it is judged that the stamen is fertile. The rest is the same as the second embodiment.
The fourth concrete implementation mode: the third difference between the present embodiment and the specific embodiment is that: and in the second step, the primer BvRE051-S is 5'-TCCAACTTTGGGACTCTAAATTAAC-3', and the primer BvRE051-A is 5'-GAAAGTGACGGCGAGAATGT-3'. The rest is the same as the third embodiment.
The fifth concrete implementation mode: this embodiment is different from the third or fourth embodiment in that: the conditions of the PCR amplification reaction in the second step are as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 57 deg.C for 1min, extension at 72 deg.C for 1min, 30 cycles, and final extension at 72 deg.C for 5 min. The other is the same as the embodiment or the fourth.
The following examples are given to illustrate the present invention, and the following examples are carried out on the premise of the technical solution of the present invention, and give detailed embodiments and specific procedures, but the scope of the present invention is not limited to the following examples.
Example 1:
obtaining a large amount of beet sequences through high-throughput sequencing, excavating unreported SSR markers from the beet sequences, screening more than one hundred candidate markers with good quality and polymorphism, and constructing F of beet stamen fertility2Isolating the population.
Fertile and sterile individuals are selected from the separation generations to construct a mixed pool, and candidate markers are screened by a group mixed segregation analysis (BSA) method, so that 8 SSR markers showing polymorphism among the mixed pool are obtained. And an SSR molecular marker related to the fertility of the beet stamens is selected from the SSR molecular markers and named as BvRE 051.
After investigating fertility of the stamens of the segregating generation, 30 beet of each fertile and sterile individual are marked according to the following method:
firstly, respectively extracting DNA of 30 young beet leaves;
secondly, taking the DNA obtained in the first step as a template, and adopting primers BvRE051-S and BvRE051-A to carry out PCR amplification, wherein a PCR reaction system is shown in Table 1:
TABLE 1
The conditions of the PCR amplification reaction are as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 57 deg.C for 1min, extension at 72 deg.C for 1min, 30 cycles, and final extension at 72 deg.C for 5 min.
Thirdly, a result detection method: and (3) separating the PCR amplification product obtained in the step two by using polyacrylamide gel electrophoresis, wherein the gel crosslinking degree is 8%, the voltage during electrophoresis is 100V, and the time is 4-5 h. And after electrophoresis, staining the membrane for 15-20 min by using 10mg/L Ethidium Bromide (EB) solution.
The genotyping results of fertile individuals are shown in FIG. 1, where M represents DNA 50bp marker, P1Indicates female parent (Male sterility), P2Represents a male parent (male fertile), and the number of the male parent is 1 to 30 fertile individuals. The genotyping results of the sterile individuals are shown in FIG. 2, where M represents DNA 50bp marker, P1Indicates female parent (Male sterility), P2Represents a male parent (male fertile), and 30 sterile individuals are numbered 1-30.
And (4) genotyping the fertile and sterile individuals of the separated generations respectively, and verifying the consistency of the marker and the fertility character expression. The molecular marker BvRE051 is found in all individuals, the consistency of the marker detection result and the performance of the stamen fertility character reaches 70 percent, and respectively reaches 63.33 percent and 76.67 percent in fertile and sterile individuals. The marker is shown to have a linkage relation with the stamen fertility and can be used for detecting the stamen fertility.
TABLE 2 detection results of stamen fertility-related markers on plants with different fertility
Sequencing, the BvRE051 amplification sequence is as follows (the cross-hatching part is SSR repeated unit):
sterility-associated band (172 bp):
GAAAGTGACGGCGAGAATGTCGCCGGAAAGTGCAGCGGCATTCGCCGGAAAAGAGGAGAGAGAAAGTAGAAAGCAGGAGAGAGAGAGTGAGGAGAGAGAGTGTAAAAATGGGGGAGAATTTGTATTTGTATAGTTGTAAATTAATAAGTTAATTTAGAGTCCCAAAGTTGGA
fertile associated band 1(232 bp):
GAAAGTGACGGCGAGAATGTCGCCGGAAAGTGCAGCGGCATTCGCCGGAAAAGAGGAGAGAGAAAGTAGAAAGCAGGAGAGAGAGAGTGAGGAGAGAGAGTGTAAAAATGGGGGAGAATTTGTATTTGTATTTGTATTTGTATTTG TATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATAGTTGTAAATTAATAAGTTAATTTAGAGTCCCAAAGTTGGA
fertile associated band 2(274 bp):
GAAAGTGACGGCGAGAATGTCGCCGGAAAGTGCAGCGGCATTCGCCGGAAAAGAGGAGAGAGAAAGTAGAAAGCAGGAGAGAGAGAGTGAGGAGAGAGAGTGTAAAAATGGGGGAGAATTTGTATTTGTATTTGTATTTGTATTTG TATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTTGTATTT GTATTTGTATAGTTGTAAATTAATAAGTTAATTTAGAGTCCCAAAGTTGGA
judging whether the male stamen is sterile or not according to the judgment result of the size of the amplified product if only a band of 172bp is detected; if a band of 232bp and a band of 274bp are detected in addition to the band of 172bp, it is judged that the stamen is fertile.
The amplified product is compared with a plant non-redundant nucleic acid database by BlastN, and the result shows that the amplified product of BvRE051 is similar to a 'serine-threonine kinase mRNA predicted to be a leucine receptor' of beet, the sequence similarity part is 1-135bp of the amplified fragment, and the sequence similarity of the part is 100%.
The markers were mapped by sequence similarity, and were mapped to regions 56139357 and 56139534 of chromosome 6 in the sugar beet genome.
Sequence listing
<110> university of Heilongjiang
<120> SSR molecular marker for detecting fertility of beet stamens and application thereof
<160>5
<210>1
<211>25
<212>DNA
<213> Artificial sequence
<220>
<223> PCR primer BvRE051-S
<400>1
<210>2
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223> PCR primer BvRE051-A
<400>2
<210>3
<211>172
<212>DNA
<213> Artificial sequence
<220>
<223> sterility-related band sequence
<400>3
gaaagtgacg gcgagaatgt cgccggaaag tgcagcggca ttcgccggaa aagaggagag 60
agaaagtaga aagcaggaga gagagagtga ggagagagag tgtaaaaatg ggggagaatt 120
tgtatttgta tagttgtaaa ttaataagtt aatttagagt cccaaagttg ga 172
<210>4
<211>232
<212>DNA
<213> Artificial sequence
<220>
<223> fertile related band 1 sequence
<400>4
gaaagtgacg gcgagaatgt cgccggaaag tgcagcggca ttcgccggaa aagaggagag 60
agaaagtaga aagcaggaga gagagagtga ggagagagag tgtaaaaatg ggggagaatt 120
tgtatttgta tttgtatttg tatttgtatt tgtatttgta tttgtatttg tatttgtatt 180
tgtatttgta tagttgtaaa ttaataagtt aatttagagt cccaaagttg ga 232
<210>5
<211>274
<212>DNA
<213> Artificial sequence
<220>
<223> fertile related band 2 sequence
<400>5
gaaagtgacg gcgagaatgt cgccggaaag tgcagcggca ttcgccggaa aagaggagag 60
agaaagtaga aagcaggaga gagagagtga ggagagagag tgtaaaaatg ggggagaatt 120
tgtatttgta tttgtatttg tatttgtatt tgtatttgta tttgtatttg tatttgtatt 180
tgtatttgta tttgtatttg tatttgtatt tgtatttgta tttgtatttg tatagttgta 240
aattaataag ttaatttaga gtcccaaagt tgga 274
Claims (5)
1. The SSR molecular marker for detecting the fertility of the stamens of the beets is characterized in that a primer pair for PCR amplification of the molecular marker is BvRE051-S and BvRE051-A, and the specific sequence is as follows:
BvRE051-S：5'-TCCAACTTTGGGACTCTAAATTAAC-3'
BvRE051-A：5'-GAAAGTGACGGCGAGAATGT-3'；
wherein the nucleotide sequence of the fertile related molecular marker is shown as SEQ ID NO: 4 and SEQ ID NO: 5, the nucleotide sequence of the sterility related molecular marker is shown as SEQ ID NO: 3, respectively.
2. Use of an SSR molecular marker for detecting fertility of a sugar beet stamen according to claim 1 for identifying fertility of a sugar beet stamen.
3. The use according to claim 2, characterized in that the specific identification method is:
firstly, separating and extracting total DNA from young leaves of beet;
secondly, performing PCR amplification by using the DNA obtained in the first step as a template and adopting primers BvRE051-S and BvRE 051-A;
thirdly, separating the PCR amplification product obtained in the second step by using gel electrophoresis, and judging whether the male stamen is sterile if only a band of 172bp is detected according to the size judgment result of the amplification product; if a band of 232bp and a band of 274bp are detected in addition to the band of 172bp, it is judged that the stamen is fertile.
4. Use according to claim 3, characterized in that in step two the primer BvRE051-S is 5'-TCCAACTTTGGGACTCTAAATTAAC-3' and primer BvRE051-A is 5'-GAAAGTGACGGCGAGAATGT-3'.
5. The use according to claim 3, wherein the PCR amplification reaction conditions of step two are: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 57 deg.C for 1min, extension at 72 deg.C for 1min, 30 cycles, and final extension at 72 deg.C for 5 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710718808.7A CN107267660B (en) | 2017-08-21 | 2017-08-21 | SSR molecular marker for detecting fertility of beet stamens and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710718808.7A CN107267660B (en) | 2017-08-21 | 2017-08-21 | SSR molecular marker for detecting fertility of beet stamens and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107267660A CN107267660A (en) | 2017-10-20 |
| CN107267660B true CN107267660B (en) | 2020-10-09 |
Family
ID=60076373
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710718808.7A Active CN107267660B (en) | 2017-08-21 | 2017-08-21 | SSR molecular marker for detecting fertility of beet stamens and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107267660B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321676B (en) * | 2018-11-07 | 2021-06-29 | 黑龙江大学 | SSR molecular marker BvRE105 for detecting granularity of beet seeds and application thereof |
| CN109161610B (en) * | 2018-11-07 | 2021-06-29 | 黑龙江大学 | SSR molecular marker BvRE016 for detecting granularity of beet seeds and application thereof |
| CN109207629B (en) * | 2018-11-07 | 2021-06-29 | 黑龙江大学 | SSR molecular marker BvRE049 for detecting granularity of beet seeds and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2390335A2 (en) * | 2007-05-23 | 2011-11-30 | Syngenta Participations AG | Polynucleotide markers |
| WO2013080045A2 (en) * | 2011-11-28 | 2013-06-06 | Anglo Netherlands Grain B.V. | Method for differentiating fertile and sterile plant lines by detection of polymorphic markers in chloroplast dna |
| CN105441544A (en) * | 2015-12-09 | 2016-03-30 | 武汉市蔬菜科学研究所 | Method for screening fertility-related molecular markers of recessive nucleic sterile line of non-heading Chinese cabbages through SNP technology and SSR technology together and application |
-
2017
- 2017-08-21 CN CN201710718808.7A patent/CN107267660B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2390335A2 (en) * | 2007-05-23 | 2011-11-30 | Syngenta Participations AG | Polynucleotide markers |
| WO2013080045A2 (en) * | 2011-11-28 | 2013-06-06 | Anglo Netherlands Grain B.V. | Method for differentiating fertile and sterile plant lines by detection of polymorphic markers in chloroplast dna |
| CN105441544A (en) * | 2015-12-09 | 2016-03-30 | 武汉市蔬菜科学研究所 | Method for screening fertility-related molecular markers of recessive nucleic sterile line of non-heading Chinese cabbages through SNP technology and SSR technology together and application |
Non-Patent Citations (5)
| Title |
|---|
| Genetic analysis of male fertility restoration in wild cytoplasmic male sterility G of beet;Touzet, P等;《THEORETICAL AND APPLIED GENETICS》;20040630;第109卷(第1期);第240-247页 * |
| Relationship between hybrid performance and genetic variation in self-fertile and self-sterile sugar beet pollinators as estimated by SSR markers;Curcic, Zivko等;《EUPHYTICA》;20170531;第213卷(第5期);第1-16页 * |
| SSR对甜菜骨干单胚雄性不育系和保持系的遗传多样性分析;王茂芊等;《中国农学通报》;20151115;第31卷(第32期);第62-67页 * |
| 分子标记技术在甜菜育种中的应用;倪洪涛等;《中国农学通报》;20161225;第32卷(第36期);第132-137页 * |
| 甜菜EST-SSR引物的快速筛选;吴则东等;《中国农学通报》;20161225;第32卷(第36期);第104-108页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107267660A (en) | 2017-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018085971A1 (en) | Cotton whole genome snp chip and application thereof | |
| CN108060261B (en) | Method for capturing and sequencing corn SNP marker combination and application thereof | |
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| CN108103235B (en) | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer | |
| CN114182041B (en) | PARMS molecular marker related to number of ovules of rape per ovary and application | |
| CN107267660B (en) | SSR molecular marker for detecting fertility of beet stamens and application thereof | |
| CN109337998B (en) | InDel6 and SSR229 molecular marker development method closely linked with corn plant height and application thereof | |
| CN114959104A (en) | SNP loci and corresponding KASP markers for assisting in selection of improved tobacco variety 'K326' leaf width traits | |
| US20210071271A1 (en) | Single nucleotide polymorphism marker related to chinese horse short stature trait and use thereof | |
| CN109280709B (en) | Molecular marker related to growth and reproduction traits of pigs and application | |
| CN114480709B (en) | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof | |
| CN108913787A (en) | SNP marker relevant to the more lambs of sheep and its application | |
| CN111926102A (en) | Molecular marker of rice photo-thermo-sensitive male sterility gene pms3 and application thereof | |
| CN108642201B (en) | SNP (Single nucleotide polymorphism) marker related to millet plant height character as well as detection primer and application thereof | |
| CN108157165B (en) | Method for rapidly and accurately breeding sterile line of three-line rice by utilizing rice genomics technology | |
| TWI635182B (en) | Molecular marker and application for early determining sexes and sex-related traits of papaya | |
| CN117683927A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| CN109504792B (en) | Molecular marker related to rice stigma exsertion as well as screening method and application thereof | |
| CN107988337B (en) | Identification method of rice blast resistance rice, gene marking method and application thereof | |
| CN116622877A (en) | SNP molecular marker related to lotus rhizome internode shape and application thereof | |
| CN107267661B (en) | SSR molecular marker for detecting fertility of beet stamens and application thereof | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN110468226B (en) | Molecular marker for resisting leaf rust of poplar and application thereof | |
| CN108570517B (en) | Specific primer related to Ning-Mai No. 9 low protein of weak gluten wheat and application of specific primer | |
| TWI600768B (en) | Molecular marker and application for early determining sexes and sex-related traits of papaya |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20171018 Address after: 150080 Harbin, Heilongjiang, Nangang District Road, No. 74 Applicant after: Heilongjiang University Applicant after: Sugar Beet Research Institute of Chinese Academy of Agricultural Sciences Address before: 150080 Harbin, Heilongjiang, Nangang District Road, No. 74 Applicant before: Heilongjiang University |
|
| TA01 | Transfer of patent application right | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |