CN107227376B - Kit for detecting susceptibility mutation of gene affecting trace element absorption capacity - Google Patents
Kit for detecting susceptibility mutation of gene affecting trace element absorption capacity Download PDFInfo
- Publication number
- CN107227376B CN107227376B CN201710669229.8A CN201710669229A CN107227376B CN 107227376 B CN107227376 B CN 107227376B CN 201710669229 A CN201710669229 A CN 201710669229A CN 107227376 B CN107227376 B CN 107227376B
- Authority
- CN
- China
- Prior art keywords
- trace element
- primer
- absorption capacity
- mutation
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a primer composition, a kit, a method and application for detecting gene susceptibility mutation affecting trace element absorption capacity, relates to the technical field of biological detection, and provides the primer composition for detecting gene susceptibility mutation affecting trace element absorption capacity, which comprises a primer for amplifying mutation sites, can effectively detect gene susceptibility mutation affecting trace element absorption capacity, and has the advantages of high sensitivity and strong specificity. The kit for detecting the gene susceptibility mutation influencing the trace element absorption capacity, which is provided by the invention, comprises the primer composition and the probe for capturing RNA, and can be used for simultaneously detecting three mutations at different positions, thereby reducing the detection cost and improving the detection efficiency. The method for detecting the gene susceptibility mutation influencing the trace element absorption capacity provided by the invention uses a method of PCR (polymerase chain reaction) and then capture, and improves the detection rate of the detection site.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a kit for detecting susceptibility mutation of genes influencing the absorption capacity of trace elements.
Background
The trace elements have little content in the body, and play an important role in the life activities of the organism by participating in the processes of metabolism, physiology, biochemical reaction, energy conversion and the like in the body. The trace elements cannot be synthesized in the body, must be taken from food and drinking water, and other components in the diet can affect the absorption and metabolism of the trace elements.
The VDR gene codes vitamin D receptor protein 2, and is an important protein in a vitamin D regulation feedback system. The biological principle is that vitamin D is converted in the body to form the most effective 1, 25-dihydroxycholecalciferol (sterol) form in the body, and the 1, 25-dihydroxycholecalciferol (sterol) can open calcium absorption ion channels on the cell surface through the action of vitamin D receptor protein (VDR), so that the absorption of calcium by cells is promoted.
Iron is one of the essential trace elements for human body, and has wide physiological effect. Under normal physiological conditions, 5% -10% of the iron is absorbed from the intestinal tract, and 90% -95% of the iron is released from spleen macrophages after recovery from aged red blood cells. Hemoglobin and ferritin content are common indicators that clinically reflect the status of iron stores in the body. Iron reduction in the body can lead to anemia; iron increase causes hemochromatosis, which is a pathological change mainly caused by iron accumulation in the organs, and also increases the risk of type 2 diabetes. Hepcidin secreted by the liver maintains iron metabolic balance by regulating intestinal iron absorption and macrophage iron release. The membrane-bound serine protease Matriptase-2 coded by the TMPRSS6 gene can degrade regulatory protein HJV on a cell membrane, so as to down-regulate a BMPs-SMAD signal channel and inhibit the expression of hepcidin.
The zinc source in human body is mainly obtained through diet, the mutation of some genes can influence the metabolic capability of zinc in food, the mutation of a site on the SLC30A8 gene can reduce the transport capability of zinc element, and people with mutation on the gene need to take more zinc element every day to meet the physical requirement. The SLC30A8 gene encodes the zinc transporter 8(ZnT8), which is expressed primarily in islet beta cells and is responsible for the transport of the zinc element from the cell cytoplasm to the cell vesicles, and in islet cells, the ZnT8 protein is primarily found in insulin-secreting granules, and is essential for the crystallization, storage and secretion of insulin.
At present, the detection of various trace elements is only carried out respectively due to different primers and different PCR conditions, which wastes time and labor, has overhigh cost and has low detection efficiency.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a kit for detecting susceptibility mutation of a gene influencing trace element absorption capacity, so as to solve the technical problems that detection of multiple trace elements in the prior art can only be carried out respectively, time and labor are wasted, cost is overhigh and detection efficiency is low.
The invention provides a kit for detecting susceptibility mutation of a gene affecting trace element absorption capacity, which comprises the following components (a) to (c):
(a) an upstream primer and a downstream primer for amplifying rs2228570 locus, wherein the upstream primer has a sequence shown as SEQ ID NO.1, and the downstream primer has a sequence shown as SEQ ID NO. 2;
(b) an upstream primer and a downstream primer for amplifying an rs855791 locus, wherein the upstream primer has a sequence shown as SEQ ID NO.3, and the downstream primer has a sequence shown as SEQ ID NO. 4;
(c) an upstream primer and a downstream primer for amplifying the rs13266634 locus, wherein the upstream primer has a sequence shown as SEQ ID NO.5, and the downstream primer has a sequence shown as SEQ ID NO. 6.
Further, the 5' end of the upstream primer for amplifying the rs2228570 site, the upstream primer for amplifying the rs855791 site and the upstream primer for amplifying the rs13266634 site are all subjected to phosphorylation modification.
The invention also provides application of the primer composition in detecting the gene susceptibility mutation affecting the trace element absorption capacity.
Further, the RNA probe for capturing has a sequence shown as SEQ ID NO. 7.
The invention also provides application of the kit in detecting the susceptibility mutation of the gene influencing the trace element absorption capacity.
In addition, the invention also provides a method for detecting susceptibility mutation of a gene affecting the trace element absorption capacity, which comprises the following steps:
and performing PCR amplification on the DNA of a sample to be detected by using the primer composition to obtain a first amplification product, capturing a target fragment of the first amplification product by using a probe in the kit, connecting the target fragments to obtain a continuous DNA fragment, amplifying the continuous DNA fragment by using at least one upstream primer and at least one downstream primer in the primer composition to obtain a second amplification product, and performing sequencing treatment on the second amplification product to detect the gene susceptibility mutation affecting the trace element absorption capacity.
Further, the method further comprises purifying the first amplification product.
Further, the DNA of the sample to be tested is derived from one or more of tissues, blood or oral epithelial cells.
Further, the trace elements are vitamin D, iron and zinc.
The primer composition for detecting the gene susceptibility mutation influencing the trace element absorption capacity, provided by the invention, comprises a primer for amplifying the rs2228570 locus, a primer for amplifying the rs855791 locus and a primer for amplifying the rs13266634 locus, can effectively detect the gene susceptibility mutation influencing the trace element absorption capacity, and has the advantages of high sensitivity and strong specificity. The kit for detecting the gene susceptibility mutation influencing the trace element absorption capacity, which is provided by the invention, comprises the primer composition and the RNA probe for capturing, and can be used for simultaneously detecting three mutations at different positions, thereby reducing the detection cost and improving the detection efficiency. The method for detecting the gene susceptibility mutation influencing the trace element absorption capacity provided by the invention applies the kit provided by the invention, and improves the detection rate of the detection site by using a method of PCR (polymerase chain reaction) and then capturing.
Drawings
FIG. 1 is a diagram showing the results of PCR of a sample DNA to be tested using the primer composition provided by the present invention in step (1) of example 3 of the present invention;
FIG. 2 is a graph showing the results of PCR using primers rs2228570F and rs13266634R on ligated contiguous DNA fragments as provided in step (6) of example 3 of the present invention;
FIG. 3 is a peak diagram of the sequencing result of the PCR product provided in step (7) of example 3 of the present invention.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention provides a primer composition for detecting susceptibility mutation of a gene affecting the trace element absorbing capacity, which comprises the following components (a) to (c):
(a) upstream and downstream primers for amplification of the rs2228570 site:
the nucleotide sequence of the upstream primer is as follows: 5 '-PO 4-GGAAGTGCTGGCCGCCAT-3' (SEQ ID NO. 1);
the nucleotide sequence of the downstream primer is as follows: 5'-CACTGACTCTGGCTCTGACCGT-3' (SEQ ID NO. 2);
(b) an upstream primer and a downstream primer for amplifying the rs855791 site:
the nucleotide sequence of the upstream primer is as follows: 5 '-PO 4-CTCACTTCTGCCCTTGACCA-3' (SEQ ID NO. 3);
the nucleotide sequence of the downstream primer is as follows: 5'-CACAGCATGCGTGGCGTCAC-3' (SEQ ID NO. 4);
(c) upstream and downstream primers for amplification of locus rs 13266634:
the nucleotide sequence of the upstream primer is as follows: 5 '-PO 4-CCCTGTGCTTCTTTATCAACAG-3' (SEQ ID NO. 5);
the nucleotide sequence of the downstream primer is as follows: 5'-AGCTTTTGCTAAGGGCTTTG-3' (SEQ ID NO. 6).
Wherein the rs2228570 site is positioned on the VDR gene, and the absorption promoting effect of vitamin D on calcium element can be enhanced by the mutation of the rs2228570 site; the rs855791 site is positioned on the TMPRSS6 gene, and a significant association relationship exists between the rs855791 site and the content of hemoglobin and ferritin; the rs13266634 site is positioned on the SLC30A8 gene, the mutation of the rs13266634 site can affect the expression of the SLC30A8 gene, the expression of the SLC30A8 gene of the people with the CC genotype is lower than that of the people with TT or CT, and the risk of the people suffering from type 2 diabetes is increased by 33 percent and 16.5 percent compared with the risk of the people suffering from type 2 diabetes, which indicates that the people need to take more zinc elements every day to reduce the risk of the people suffering from the diabetes.
In the present invention, the trace elements are vitamin D, iron and zinc.
In the invention, the 5' ends of the upstream primer for amplifying the rs2228570 site, the upstream primer for amplifying the rs855791 site and the upstream primer for amplifying the rs13266634 site are all subjected to phosphorylation modification so as to enhance the connection efficiency of the T4 ligase.
The invention also provides application of the primer composition in detecting the gene susceptibility mutation affecting the trace element absorption capacity.
The primer composition for detecting the gene susceptibility mutation influencing the trace element absorption capability provided by the invention can effectively detect the gene susceptibility mutation influencing the trace element absorption capability, and has the advantages of high sensitivity and strong specificity.
The invention also provides a kit for detecting the susceptibility mutation of the gene influencing the trace element absorption capacity, which comprises the primer composition and an RNA probe for capturing.
In the present invention, the nucleotide sequence of the RNA probe for capture is:
AGCUUUUGCUAAGGGCUUUAGCAAUUUCUCUCCGAACCACUUGGCUGUCCCGGCUGGCUGCUGUUGAUAAAGAAGCACAGGGCACUGACUCUGGCUCUGACCGUGGCCUGCUUGCUGUUCUUACAGGGAUGGAGGCAAUGGCGGCCAGCACUUCCCACAGCAUGCGUGGCGUCACCUGGUAGCGAUAGACCUCGCUGCACAGGUCCUGUGGGAUCAACUGCACAUCCACUUUCUGCAGAGCGUUGCUGAUGGGGCCUGUCCGUGGUCAAGGGCAGAAGUGAG(SEQ ID NO.7)。
the invention also provides application of the kit in detecting the susceptibility mutation of the gene influencing the trace element absorption capacity.
In the present invention, the trace elements are vitamin D, iron and zinc.
The kit for detecting the gene susceptibility mutation influencing the trace element absorption capacity provided by the invention can simultaneously detect three mutations at different positions, reduce the detection cost and improve the detection efficiency.
In addition, the invention also provides a method for detecting the susceptibility mutation of the gene influencing the trace element absorption capacity, which comprises the following steps:
the primer composition provided by the invention is used for respectively carrying out PCR amplification on sample DNA to be detected to obtain a first amplification product, a probe in the kit provided by the invention is used for capturing a target fragment of the first amplification product, the target fragments are connected to obtain a continuous DNA fragment, at least one upstream primer and at least one downstream primer in the primer composition provided by the invention are used for amplifying the continuous DNA fragment to obtain a second amplification product, the second amplification product is subjected to sequencing treatment, and the susceptible mutation of the gene influencing the trace element absorption capacity is detected.
Among them, T4 ligase was used for ligating the target fragments. At least one of the forward primer and the reverse primer in the primer composition provided by the invention is preferably rs2228570F and rs 13266634R.
In the present invention, the method further comprises purifying the first amplification product.
In the present invention, the DNA of the sample to be tested is derived from one or more of tissues, blood or oral epithelial cells.
In the present invention, the trace elements are vitamin D, iron and zinc.
The method for detecting the gene susceptibility mutation influencing the trace element absorption capacity provided by the invention applies the kit provided by the invention, and improves the detection rate of the detection site by using a method of PCR (polymerase chain reaction) and then capturing.
In order to more clearly illustrate the invention, the invention is further described below in connection with preferred embodiments.
Example 1 design of primers and probes
The primer composition provided by the invention is designed and obtained by the following method: according to the selected susceptible mutation of the trace element absorption capacity, an amplification primer specific to each site is designed, an amplification fragment comprises a DNA sequence in a mutation site, comparison is carried out through NCBI BLAST software, and through repeated test screening and verification, the primer which is high in amplification efficiency, good in specificity and capable of correctly distinguishing the mutation to be detected is obtained.
The RNA probe sequence for capturing provided by the invention is obtained by in vitro transcription.
The information of the mutation sites which are designed aiming at the trace element absorption capacity and are susceptible to mutation is shown in the table 1, and the amplification primers are shown in the table 2.
TABLE 1 susceptibility to mutation site information
TABLE 2 PCR amplification primer sequences for the PCR amplifications
| SEQ ID NO. | Amplification primer name | Primer sequence 5'-3' |
| 1 | rs2228570F | PO4-GGAAGTGCTGGCCGCCAT |
| 2 | rs2228570R | CACTGACTCTGGCTCTGACCGT |
| 3 | rs855791F | PO4-CTCACTTCTGCCCTTGACCA |
| 4 | rs855791R | CACAGCATGCGTGGCGTCAC |
| 5 | rs13266634F | PO4-CCCTGTGCTTCTTTATCAACAG |
| 6 | rs13266634R | AGCTTTTGCTAAGGGCTTTG |
The nucleotide sequence of the RNA probe used for capture was:
AGCUUUUGCUAAGGGCUUUAGCAAUUUCUCUCCGAACCACUUGGCUGUCCCGGCUGGCUGCUGUUGAUAAAGAAGCACAGGGCACUGACUCUGGCUCUGACCGUGGCCUGCUUGCUGUUCUUACAGGGAUGGAGGCAAUGGCGGCCAGCACUUCCCACAGCAUGCGUGGCGUCACCUGGUAGCGAUAGACCUCGCUGCACAGGUCCUGUGGGAUCAACUGCACAUCCACUUUCUGCAGAGCGUUGCUGAUGGGGCCUGUCCGUGGUCAAGGGCAGAAGUGAG(SEQ ID NO.7)。
example 2 sample preparation DNA extraction
Sampling mode: swab 15 times inside the cheek with a cotton swab.
The extracted DNA is extracted by a guanidinium isothiocyanate method.
Example 3 detection of susceptibility to mutation of Trace element absorption Capacity
(1) The DNA extracted in embodiment 2 of the present invention is used as a template, and the PCR amplification primers provided in embodiment 1 of the present invention are used to perform PCR amplification respectively to obtain target sequence amplification products, and the results are shown in fig. 1, where the first lane is Marker, the second lane is rs2228570, the third lane is rs855791, and the fourth lane is rs13266634, the length of the amplification target band is expected, and the target fragment is single. See table 3 for PCR amplification reaction systems.
TABLE 3 PCR amplification reaction System
| Reagent | Volume of |
| 10×PCR Buffer with Mg2+ | 2.5μL |
| dNTP Mixture(2.5mM each) | 2μL |
| Taq DNA polymerase (5U/. mu.l) | 0.125μL |
| Upstream primer (10. mu.M) | 1μL |
| Downstream primer (10. mu.M) | 1μL |
| Template DNA | 2μL |
| ddH2O | 16.375μL |
The PCR reaction condition is 95 ℃ and 30 s; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 60s, and co-amplification for 45 cycles; final extension at 72 ℃ for 300 s.
(2) After mixing the PCR products obtained in step (1), 8. mu.L of the total mixed product was treated with SAP enzyme and Exo I enzyme to remove unreacted dNTP and primers contained in the amplification product obtained in step (1). See table 4 for reaction system.
TABLE 4 PCR product purification System
| Reagent | Volume of |
| SAP(1U/μL) | 2μL |
| Exo I(5U/μL) | 0.5μL |
| 10×Exonuclease Buffer | 1.2μL |
| PCR mixture | 8μL |
| Total | 12μL |
The reaction was placed on a PCR instrument and incubated at 37 ℃ for 1h and then at 75 ℃ for 15min to inactivate SAP and ExoI enzymes. The purified template can be stored for 24h at 4 ℃ or for a long time at-20 ℃.
(3) 2 × hybridization buffer was preheated beforehand at 65 ℃. And (3) adding the RNA probe and the product obtained in the step (2) respectively to perform hybridization reaction. See table 5 for reaction system.
TABLE 5 hybridization reaction System
After mixing, hybridization was carried out for 12 hours at 65 ℃ on a PCR instrument.
(4) The hybridization product was purified using magnetic beads and dissolved in 20. mu.L of water.
(5) The capture fragments were ligated in step (4) using T4 ligase, and the ligation reaction system is shown in Table 6. After mixing, the mixture was incubated in a Thermomixer at 20 ℃ for 15 min.
TABLE 6 ligation reaction System
| Reagent | Volume of |
| Sample of step (4) | 20μL |
| 2×Rapid ligation Buffer | 25μL |
| T4 DNA ligase | 5μL |
| Total | 50μL |
(6) The product obtained in step (5) was amplified using primers rs2228570F and rs13266634R, and the results are shown in fig. 2, indicating that T4 ligase ligation was successful in step 5. See table 7 for amplification reaction system.
TABLE 7 amplification reaction System
| Reagent | Volume of |
| 10×PCR Buffer with Mg2+ | 2.5μL |
| dNTP Mixture(2.5mM each) | 2μL |
| Taq DNA polymerase (5U/. mu.l) | 0.125μL |
| rs7975232F(10μM) | 1μL |
| rs4988235R(10μM) | 1μL |
| The product obtained in step (5) | 2μL |
| ddH2O | 19μL |
(7) The PCR products were detected by capillary electrophoresis using ABI 3730 XL. The obtained results were typed using Chromas software, and the results are shown in fig. 3, which demonstrates that the present assay can detect 3 SNPs continuously and accurately detect the surrounding sequence.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Hangzhou Xiangyin biomedical science and technology Co Ltd
<120> primer composition, kit and method for detecting susceptibility mutation of gene affecting trace element absorption ability
Method and application
<160>7
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213> Artificial sequence
<400>1
ggaagtgctg gccgccat 18
<210>2
<211>22
<212>DNA
<213> Artificial sequence
<400>2
cactgactct ggctctgacc gt 22
<210>3
<211>20
<212>DNA
<213> Artificial sequence
<400>3
ctcacttctg cccttgacca 20
<210>4
<211>20
<212>DNA
<213> Artificial sequence
<400>4
cacagcatgc gtggcgtcac 20
<210>5
<211>22
<212>DNA
<213> Artificial sequence
<400>5
ccctgtgctt ctttatcaac ag 22
<210>6
<211>20
<212>DNA
<213> Artificial sequence
<400>6
agcttttgct aagggctttg 20
<210>7
<211>282
<212>RNA
<213> Artificial sequence
<400>7
agcuuuugcu aagggcuuua gcaauuucuc uccgaaccac uuggcugucc cggcuggcug 60
cuguugauaa agaagcacag ggcacugacu cuggcucuga ccguggccug cuugcuguuc 120
uuacagggau ggaggcaaug gcggccagca cuucccacag caugcguggc gucaccuggu 180
agcgauagac cucgcugcac agguccugug ggaucaacug cacauccacu uucugcagag 240
cguugcugau ggggccuguc cguggucaag ggcagaagug ag 282
Claims (2)
1. A kit for detecting a susceptible mutation of a gene affecting trace element absorptive capacity, comprising the following (a) to (d):
(a) an upstream primer and a downstream primer for amplifying rs2228570 locus, wherein the upstream primer has a sequence shown as SEQ ID NO.1, and the downstream primer has a sequence shown as SEQ ID NO. 2;
(b) an upstream primer and a downstream primer for amplifying an rs855791 locus, wherein the upstream primer has a sequence shown as SEQ ID NO.3, and the downstream primer has a sequence shown as SEQ ID NO. 4;
(c) an upstream primer and a downstream primer for amplifying the rs13266634 locus, wherein the upstream primer has a sequence shown as SEQ ID NO.5, and the downstream primer has a sequence shown as SEQ ID NO. 6;
(d) an RNA probe for capturing, wherein the RNA probe for capturing has a sequence shown as SEQ ID NO. 7;
the microelements are calcium, iron and zinc.
2. The kit according to claim 1, wherein the upstream primer for amplifying the rs2228570 site, the upstream primer for amplifying the rs855791 site and the upstream primer for amplifying the rs13266634 site are all modified by phosphorylation at the 5' ends.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710669229.8A CN107227376B (en) | 2017-08-08 | 2017-08-08 | Kit for detecting susceptibility mutation of gene affecting trace element absorption capacity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710669229.8A CN107227376B (en) | 2017-08-08 | 2017-08-08 | Kit for detecting susceptibility mutation of gene affecting trace element absorption capacity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107227376A CN107227376A (en) | 2017-10-03 |
| CN107227376B true CN107227376B (en) | 2020-09-08 |
Family
ID=59958031
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710669229.8A Active CN107227376B (en) | 2017-08-08 | 2017-08-08 | Kit for detecting susceptibility mutation of gene affecting trace element absorption capacity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107227376B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384844A (en) * | 2018-02-07 | 2018-08-10 | 深圳鼎新融合科技有限公司 | Detect primer pair, probe and the kit of mankind's VDR, GC, LRP5, SLC30A8 gene pleiomorphism |
| CN108486244A (en) * | 2018-03-30 | 2018-09-04 | 广州合谐医疗科技有限公司 | Predict that human body mineral matter lacks risk gene detecting kit and detection method |
| CN108642152A (en) * | 2018-04-13 | 2018-10-12 | 深圳鼎新融合科技有限公司 | The kit and method of Genotyping detection |
| CN110042158A (en) * | 2019-04-24 | 2019-07-23 | 杭州云鼎基因生物科技有限公司 | The detection method in ferro element absorption associated gene mutation site |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003002762A2 (en) * | 2001-06-29 | 2003-01-09 | Syngenta Participations Ag | Enhanced detection and distinction of differential gene expression by enzymatic probe ligation and amplification |
| WO2011044643A1 (en) * | 2009-10-16 | 2011-04-21 | Genetics Investments Pty. Ltd. | Macronutrient sensitivity |
| CN105543370B (en) * | 2016-01-14 | 2019-06-04 | 中南大学湘雅医院 | New comprehensive deaf-related gene mutation detection architecture and kit |
| CN106755532A (en) * | 2017-02-28 | 2017-05-31 | 天津脉络医学检验有限公司 | A kind of amplimer for detecting children's calcium uptake gene pleiomorphism and application |
-
2017
- 2017-08-08 CN CN201710669229.8A patent/CN107227376B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107227376A (en) | 2017-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107227376B (en) | Kit for detecting susceptibility mutation of gene affecting trace element absorption capacity | |
| CN102808026B (en) | Primer, probe, fluorescent PCR kit and method for detecting polymorphism of human MTHFR (Methylene Tetrahydrofolate Reductase) gene | |
| Zeng et al. | Liquid biopsies: DNA methylation analyses in circulating cell-free DNA | |
| EP2937422A1 (en) | A method and a kit for non-invasively detecting fetal deafness pathogenic gene mutations | |
| CN107557450A (en) | A kind of reagent and method and its application of rapid build high-throughput sequencing library | |
| CN101899519B (en) | Kit for detecting SNP locus of gene associated with individualized medication of warfarin and PCR amplification method thereof | |
| CN108588176A (en) | A method of R-loop high-throughput sequencing libraries are built based on single stranded DNA | |
| Qu et al. | Long noncoding RNAs and mRNA regulation in peripheral blood mononuclear cells of patients with chronic obstructive pulmonary disease | |
| Hranilović et al. | Hyperserotonemia in autism: the potential role of 5HT-related gene variants | |
| CN110804652B (en) | Additive, kit and reaction method for real-time quantitative PCR (polymerase chain reaction) for rapidly detecting DNA (deoxyribonucleic acid) | |
| CN102719524A (en) | Kit for warfarin personalized medication related gene SNP locus detection and PCR amplification method using same | |
| Kim et al. | Assessment of gene expression in peripheral blood using RNAseq before and after weight restoration in anorexia nervosa | |
| Tekin et al. | Biomarker potential of hsa-miR-145-5p in peripheral whole blood of manic bipolar I patients | |
| Bai et al. | Menaquinone-4 (vitamin K2) induces proliferation responses in bovine peripheral blood mononuclear cells | |
| Li et al. | Contribution of mitochondrial gene variants in diabetes and diabetic kidney disease | |
| CN113136433A (en) | Kit for simultaneously detecting multiple SNP sites related to tumor susceptibility | |
| CN113667743A (en) | Detection kit for budesonide metabolic marker and detection method and application thereof | |
| CN108192969B (en) | Marker for assisting epilepsy diagnosis and detection kit thereof | |
| CN110699445A (en) | AS3MT gene single nucleotide polymorphism site detection kit, use method and application | |
| Zheng et al. | Single-cell transcriptome reveals immunopathological cell composition of skin lesions in subacute cutaneous lupus erythematosus | |
| Zhang et al. | Association between vitamin D receptor gene polymorphism and prognosis in patients with end stage renal disease undergoing dialysis. | |
| Dmitrieva-Zdorova et al. | Association of interleukin-13 gene polymorphisms with atopic bronchial asthma | |
| Elsaid et al. | Association of NOS3 (rs 2070744) and SOD2Val16Ala (rs4880) gene polymorphisms with increased risk of ESRD among Egyptian patients | |
| CN102533965B (en) | Fluorescent quantitative polymerase chain reaction (PCR) kit for detecting of cow with transferred human lactoferrin gene and application of fluorescent quantitative PCR kit | |
| CN114107485A (en) | Diabetes microangiopathy gene susceptibility detection kit and group of SNP sites applied by same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |