CN108486244A - Predict that human body mineral matter lacks risk gene detecting kit and detection method - Google Patents
Predict that human body mineral matter lacks risk gene detecting kit and detection method Download PDFInfo
- Publication number
- CN108486244A CN108486244A CN201810293305.4A CN201810293305A CN108486244A CN 108486244 A CN108486244 A CN 108486244A CN 201810293305 A CN201810293305 A CN 201810293305A CN 108486244 A CN108486244 A CN 108486244A
- Authority
- CN
- China
- Prior art keywords
- primer
- human body
- mineral matter
- gene
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of prediction human body mineral matters to lack risk gene detecting kit and detection method.Wherein, the kit includes：For one or more in the first reagent, the second reagent for the rs13266634 detections of SLC30A8 gene mutation sites and the third reagent for the rs11126936 detections of SLC30A3 gene mutation sites of the rs11640851 detections of MT1A gene mutation sites.The present invention realize be directed to human body mineral matter lack risk real-time sampling detect in real time, acquisition sampling condition requirement is low, preservation condition is simple, collecting sample process is without any pain, detection process takes short, human body mineral matter, which is carried out, by using gene tester lacks the accuracy that risk substantially increases prediction, it ensure that the high accurancy and precision of detection, effectively assess the influence that inherent cause and other factors collective effect lack human body mineral matter risk.
Description
Technical field
The invention belongs to technical field of gene detection more particularly to a kind of prediction human body mineral matter to lack the inspection of risk gene
Test agent box and detection method.
Background technology
Minerals (mineral) are the compound or native element of naturally occurring in the earth's crust.Zn-ef ficiency is in minerals
Important composition, takes part in all more important life processes, zinc be internal more than 200 kinds of enzymes and the movable composition of DNA, RNA at
Point, it is the necessary material of growth and development.It is adjustable to the secretion derived from hormones of organs such as testis and ovaries, helps effectively slow
Decompression force may additionally facilitate health and the mucous membrane of mouth repairing and the effects that wound healing of nervous system and brain.In addition, right
Child and fetus in growth and indispensable, in growth in humans and development, the formation of bone and tooth, hair
Growth and the constant of energy have played very important effect.
If Zn-ef ficiency insufficiency of intake also will produce following symptom：Taste and smell is insensitive, at least there are two finger nails
There is white dirt, easy infection, skin and upholds that line, acne or skin secretion grease are more, fecundity is low, the colour of skin is pale, depressed inclines
To, lack appetite.Zinc is also to maintain immune function of human body ingredient, and zinc deficiency will appear that lymph corpuscle quantity is low, ball is immunized in blood
Albumen reduce, Natural killer activity weaken etc. situations, caused by clinical effectiveness be exactly pneumonia, beads coccus infection, and
Cold.
Just because of Zn-ef ficiency is so important, it is therefore desirable to understand human body and whether lack or Excess free enthalpy Zn-ef ficiency, ensure
The Zn-ef ficiency of human body is in normal level.At present monitoring Zn-ef ficiency content sampling mode mainly have blood (serum), hair,
The modes such as urine are detected, wherein current mainstream is using the blood sample for extracting human body, by spectrophotometry or
Flame atomic absorption method carries out the detection of its concentration.
The existing detection method for minerals in human body, main problem are：It acquires sampling condition and requires high, preservation item
Part is harsh, collecting sample painful, and time-consuming for detection process, testing result poor reliability, accuracy are low.
Invention content
To solve the above problems, the present invention provides a kind of prediction human body mineral matter shortage risk gene detecting kit,
Including：
For the first reagent of MT1A gene mutation sites rs11640851 detections, for SLC30A8 gene mutation sites
In second reagent of rs13266634 detections and the third reagent detected for SLC30A3 gene mutation sites rs11126936
It is one or more.
Preferably,
First reagent includes the first amplifing reagent of the MT1A gene magnifications for rs11640851 site primers；
Second reagent includes the second amplification examination of the SLC30A8 gene magnifications for rs13266634 site primers
Agent；
The third reagent includes the third amplification examination of the SLC30A3 gene magnifications for rs11126936 site primers
Agent；
Preferably,
First amplifing reagent includes the first primer and the second primer；
The sequence of the first primer is SEQ ID NO.1；
The sequence of second primer is SEQ ID NO.2.
Preferably,
Sequence based on the first primer and the second primer extend base is SEQ ID NO.7.
Preferably,
Second amplifing reagent includes third primer and the 4th primer；
The sequence of the third primer is SEQ ID NO.3；
The sequence of 4th primer is SEQ ID NO.4.
Preferably,
Sequence based on the third primer and the 4th primer extend base is SEQ ID NO.8.
Preferably,
The third amplifing reagent includes the 5th primer and the 6th primer；
The sequence of 5th primer is SEQ ID NO.5；
The sequence of 6th primer is SEQ ID NO.6.
Preferably,
Sequence based on the 5th primer and the 6th primer extend base is SEQ ID NO.9.
In addition, to solve the above problems, the present invention also provides a kind of prediction human body mineral matters to lack risk genetic test
Method, including：
Extract the genomic DNA in biochemical sample；
Based on MT1A gene mutation site rs11640851, SLC30A8 gene mutation sites rs13266634 and SLC30A3
One or more sites in gene mutation site rs11126936, synthetic primer, and utilize gene described in the primer amplification
Group DNA, obtains the segment containing one or more sites in rs11640851, rs13266634 and rs11126936；
Pass through the primer extend base；
It detects one or more corresponding in rs11640851, rs13266634 and rs11126936 in the segment
Site to know the base information in the site；
The human body mineral matter for analyzing the sample lacks risk.
A kind of prediction human body mineral matter of present invention offer lacks risk gene detecting kit and detection method, the examination
Agent box includes for the first reagent of MT1A gene mutation sites rs11640851 detections, for SLC30A8 gene mutation sites
In second reagent of rs13266634 detections and the third reagent detected for SLC30A3 gene mutation sites rs11126936
It is one or more.The present invention utilizes MT1A gene mutation site rs11640851, SLC30A8 gene mutation sites rs13266634
The prediction for lacking risk to human body mineral matter is carried out with SLC30A3 gene mutation sites rs11126936, is realized and is adopted in real time
Sample detects in real time, and acquisition sampling condition requirement is low, preservation condition is simple, and collecting sample process is without any pain, detection process consumption
When it is short, carry out human body mineral matter by using gene tester and lack risk to substantially increase the accuracy of prediction, ensure
The high accurancy and precision of detection effectively assesses the shadow that inherent cause and other factors collective effects lack human body mineral matter risk
It rings.
Description of the drawings
Fig. 1 is PCR product through agarose electrophoresis testing result.
The embodiments will be further described with reference to the accompanying drawings for the realization, the function and the advantages of the object of the present invention.
Specific implementation mode
Technical scheme of the present invention is described in further detail with reference to the mode of specific embodiment, but not structure
At any limitation of the invention, the modification of anyone limited number of time made within the scope of the invention as claimed, still in this hair
Within bright right.
The present invention provides a kind of prediction human body mineral matter shortage risk gene detecting kit, including：
For the first reagent of MT1A gene mutation sites rs11640851 detections, for SLC30A8 gene mutation sites
In second reagent of rs13266634 detections and the third reagent detected for SLC30A3 gene mutation sites rs11126936
It is one or more.
It is above-mentioned, it is to be understood that MT1A genes be Metallothionein 1 A, be primarily involved in the metabolic response of metal ion with
And maintain the dynamic equilibrium of tenor.MT1A is the metal-binding protein for having high-affinity to zinc, is transported to intracellular zinc
The regulation and control of albumen have central role.One variation of the gene can cause zinc to lack, cause to carry the variation individual its
The reduction of zinc concentration in blood.
It is above-mentioned, it is to be understood that the mutation of the transport protein of SLC30A8 gene code zinc, some genes can influence
Our metabolic capabilities to zinc in food, the mutation in a site, can reduce our body Zn-ef ficiencies above SLC30A8 genes
Turn-over capacity, have the crowd of mutation on this gene, more intake Zn-ef ficiencies could meet body need to daily requirement in right amount
It wants.
It is above-mentioned, it is to be understood that SLC30A3 is the zinc transporter of 30 family of Solute Transport albumen, is participated in intracellular
The balanced action of portion's zinc ion concentration will lead to the zinc ion of body if a certain site on SLC30A3 changes
Turn-over capacity is impaired, and then causes the concentration of zinc ion in blood insufficient.
Above-mentioned, used gene mutation site, can include but is not limited to MT1A gene mutations position in the present embodiment
Point rs11640851, SLC30A8 gene mutation site rs13266634 and SLC30A3 gene mutation site rs11126936.
It is above-mentioned, it should be noted that minerals (mineral) are the compound or native element of naturally occurring in the earth's crust.
Zn-ef ficiency is the important composition in minerals, takes part in all more important life processes, zinc be internal more than 200 kinds of enzymes and
The movable constituent of DNA, RNA is the necessary material of growth and development, also critically important for wound healing.If Zn-ef ficiency is taken the photograph
Enter deficiency, also will produce following symptom：Taste and smell is insensitive, at least there are two finger nail white dirt, easy infection, skin occurs
Skin extension line, acne or skin secretion grease are more, fecundity is low, the colour of skin is pale, Depression trend, lack appetite.Zinc is also dimension
Hold immune function of human body ingredient, zinc deficiency will appear lymph corpuscle quantity is low, in blood immunoglobulin reduce, constant killer cell
The situations such as miopragia, it is exactly pneumonia, the infection of beads coccus or even cold to cause clinical result.It is carried in the present invention
The prediction human body mineral matter of confession lacks risk gene detecting kit mainly for the zinc deficiency in prediction human body mineral matter
Risk.
The present invention chooses one in MT1A rs11640851, SLC30A8rs13266634, SLC30A3rs11126936
Or multiple combinations lack risk genetic test examination as human body mineral matter shortage risk site is judged in prediction human body mineral matter
Agent box is detected one or more combinations in above-mentioned site, and realization is cooperateed with using single locus or multiple sites
Judge the assessment of the risk of the zinc deficiency in the minerals for user to be measured.
The present invention using MT1A gene mutation sites rs11640851, SLC30A8 gene mutation site rs13266634 and
SLC30A3 gene mutation sites rs11126936 carries out the prediction for lacking risk to human body mineral matter, realizes real-time sampling
Detection in real time, acquisition sampling condition requirement is low, preservation condition is simple, and collecting sample process takes without any pain, detection process
It is short, it carries out human body mineral matter by using gene tester and lacks the accuracy that risk substantially increases prediction, ensure that
The high accurancy and precision of detection effectively assesses the shadow that inherent cause and other factors collective effect lack human body mineral matter risk
It rings.
Preferably,
First reagent includes the first amplifing reagent of the MT1A gene magnifications for rs11640851 site primers；
Second reagent includes the second amplification examination of the SLC30A8 gene magnifications for rs13266634 site primers
Agent；
The third reagent includes the third amplification examination of the SLC30A3 gene magnifications for rs11126936 site primers
Agent.
Preferably,
First amplifing reagent includes the first primer and the second primer；
The sequence of the first primer is SEQ ID NO.1；
The sequence of second primer is SEQ ID NO.2.
The sequence for being preferably based on the first primer and the second primer extend base is SEQ ID NO.7.
It is above-mentioned, it is to be understood that primer (primer) also known as introduction.It is a bit of single stranded DNA or RNA, as DNA
The starting point of duplication works more in nucleic acid synthesis reaction as the starting point that each polynucleotide chain is extended
Nucleotide chain, on 3 '-OH of primer, nucleotide is synthesized with diester chain type, therefore 3 '-OH of primer, it is necessary to be trip
From.Why need primer be because DNA synthesis in archaeal dna polymerase new nucleotide can be only added to it is existing
In DNA chain.
Above-mentioned, the form of presentation of sequence is from left to right form of presentation well known in the art, as 5 ' ends to 3 ' ends.
In the present embodiment, as follows for detecting MT1A gene primer sequences difference：
Primer sequence for MT1A：
The sequence of the first primer is SEQ ID NO.1, gcccatcctagcctctac；
The sequence of second primer is SEQ ID NO.2, cttggcctcagtttgtct；
Fragment length is 428bp；
In the present embodiment, it in order to detect some site, needs to need in each position containing the fragment amplification in the site
2 primers of point design, to expand generation homologous segment.The segment is spare as the template that follow-up base extends；Extension needs to use
To the primer for extending base, the base to extend out needs sequenator, such as 3730 sequenators are detected and could read specifically
It is certain base.
It is SEQ ID NO.7, gcaaatgcaaagagtgcaaatgca, length 24bp by the base that primer is extended；
By the first primer and the second primer, i.e. the MT1A segments of sequence SEQ ID NO.1 and sequence SEQ ID NO.2 amplifications
Sequence is contained in：：SEQ ID NO.10.
Preferably,
Second amplifing reagent includes third primer and the 4th primer；
The sequence of the third primer is SEQ ID NO.3；
The sequence of 4th primer is SEQ ID NO.4.
The sequence for being preferably based on the third primer and the 4th primer extend base is SEQ ID NO.8.
In the present embodiment, as follows for detecting the primer sequence difference of SLC30A8 gene mutation sites rs13266634：
Primer sequence for SLC30A8 gene mutation sites rs13266634：
The sequence of the third primer is SEQ ID NO.3, gaaagagttcccatagcg；
The sequence of 4th primer is SEQ ID NO.4, gaaggtggcctgtcaaat；
Fragment length is 410bp；
It is cccccgtgcttctttatcaacagcagccag c, length 31bp by the base that primer is extended；
By third primer and the 4th primer, i.e. the SLC30A8 of sequence SEQ ID NO.3 and sequence SEQ ID NO.4 amplifications
Fragment sequence is contained in：SEQ ID NO.11.
Preferably,
The third amplifing reagent includes the 5th primer and the 6th primer；
The sequence of 5th primer is SEQ ID NO.5；
The sequence of 6th primer is SEQ ID NO.6.
The sequence for being preferably based on the 5th primer and the 6th primer extend base is SEQ ID NO.9.
In the present embodiment, as follows for detecting the primer sequence difference of SLC30A3 gene mutation sites rs11126936：
Primer sequence for detecting SLC30A8 gene mutation sites rs11126936：
The sequence of 5th primer is SEQ ID NO.5, gaaggatgggaaggattt；
The sequence of 6th primer is SEQ ID NO.6, tgtcaagggagacttatggt；
Fragment length is 426bp；
It is ccccccccgcgggacattggggccaaaaagtctgattcc, length by the base that primer is extended
39bp；
By the 5th primer and the 6th primer, i.e. the detection of sequence SEQ ID NO.5 and sequence SEQ ID NO.6 amplifications
The fragment sequence of SLC30A8 gene mutation sites rs11126936 is contained in：SEQ ID NO.12.
In addition, the present invention also provides a kind of prediction human body mineral matters to lack risk gene tester, including：
Extract the genomic DNA in biochemical sample
Based on MT1A gene mutation site rs11640851, SLC30A8 gene mutation sites rs13266634 and SLC30A3
One or more sites in gene mutation site rs11126936, synthetic primer, and utilize gene described in the primer amplification
Group DNA, obtains the segment containing one or more sites in rs11640851, rs13266634 and rs11126936；
Pass through the primer extend base；
It detects one or more corresponding in rs11640851, rs13266634 and rs11126936 in the segment
Site to know the base information in the site；
The human body mineral matter for analyzing the sample lacks risk.
It is above-mentioned, in the present embodiment, prediction human body mineral matter is carried out based on Snapshot technologies and lacks the inspection of risk gene
It surveys, Snapshot technologies are the U.S. using biotech firm (ABI) exploitation, are a kind of based on fluorescent marker Single base extension principle
Typing method, also referred to as small sequencing, mainly for the SNP parting projects of moderate fluxes.
It is above-mentioned, in the present invention, provides and a kind of risk gene detecting kit is lacked based on prediction human body mineral matter
Predict that human body mineral matter lacks risk gene tester.
It is above-mentioned, the cast-off cells, quiet in extracting biochemical sample in the present embodiment can be extraction human oral cavity
Arteries and veins blood leukocytes, sperm equal samples may be the biochemical sample that hair, skin etc. carry human body hereditary information in addition.
It is above-mentioned, in the present embodiment, provide a kind of prediction human body mineral matter shortage risk gene tester, detection
Flow can include but is not limited to following steps：
Step 1, the genomic DNAs sample such as extraction human oral cavity cast-off cells, vein blood leukocytes, sperm, skin；
Step 2, be based on MT1A gene mutation sites rs11640851, SLC30A8 gene mutation site rs13266634 and
One or more sites in SLC30A3 gene mutation sites rs11126936, synthetic primer are simultaneously diluted；
Step 3, with primer pair progress template amplification is carried out in the same reaction tube, respectively obtain containing
The segment in one or more sites in rs11640851, rs13266634 and rs11126936；
Step 4, extend the base of target site by extending base；
Step 5, it is detected with 3730 detectors and knows MT1A gene mutation site rs11640851, SLC30A8 genes
The corresponding alkali in one or more sites in rs13266634 and SLC30A3 the gene mutation site rs11126936 of mutational site
Base；
Step 6, the risk that sample Zn-ef ficiency lacks is learnt after analyzing base.
Above-mentioned detection method can include but is not limited to the gene tester provided in the present embodiment, in addition, also may be used
Realized using the methods of quantitative fluorescent PCR (realtime PCR), mass spectrum, generation sequencing, the sequencing of two generations.
Above-mentioned, mass spectrum (being called mass spectrography) is a kind of and spectrum spectrum method arranged side by side, refers to answering extensively on ordinary meaning
For in every subjects field by preparation, separation, detection gaseous ion come a kind of know-how of authenticating compound.Mass spectrography
Can provide abundant structural information in primary analysis, by isolation technics with mass spectrography be combined be in separation science method one
Item breakthrough.Mass spectrometer is generally by Sample introduction system, ion source, mass analyzer, detector, data processing system
It is formed Deng part.In the present invention, gas chromatograph-mass spectrometer (GC-MS), flight time mass spectrum, liquid chromatography-mass spectrography may be used
The equipment such as combined instrument carry out the genetic test experiment for lacking risk to human body mineral matter.
Above-mentioned, used gene mutation site, can include but is not limited to MT1A gene mutations position in the present embodiment
Point rs11640851, SLC30A8 gene mutation site rs13266634 and SLC30A3 gene mutation site rs11126936.
To facilitate the understanding of the present invention, the technical solution further illustrated the present invention with reference to embodiment.Applicant
Statement, the present invention illustrate detailed process equipment and the technological process of the present invention, but the present invention not office by above-described embodiment
It is limited to above-mentioned detailed process equipment and technological process, that is, does not mean that the present invention has to rely on above-mentioned detailed process equipment and technique
Flow could be implemented.Person of ordinary skill in the field is each to product of the present invention it will be clearly understood that any improvement in the present invention
The equivalence replacement of raw material and the addition of auxiliary element, the selection of concrete mode etc. all fall within protection scope of the present invention and openly
Within the scope of.
Embodiment：
One, the extraction of sample DNA：
Sampling：It is wiped in cheek 10 times using cotton swab.Sampling please don't feed or drink water in first 30 minutes.
Processing：
1, swab is transferred in 2mL centrifuge tubes, cotton swab part is cut from its bar with scissors, 400 μ L solution As are added.
2, the RNaseA (10mg/mL) of 20 μ L, 55 DEG C of placement 15min are added into solution.
3, the Proteinase K (10mg/mL) of 20 μ L is added, fully reverse mixing, 55 DEG C of water-baths digest 60min, during digestion
It is recommended that reverse centrifuge tube mixing was primary every ten minutes.
4,400 μ L bulk solution B are added, fully reverse mixing white precipitate such as occurs, can be positioned over 75 DEG C of 15-
30min, precipitation can disappear, and not influence subsequent experimental.
5, solution is transferred to new centrifuge tube, 400 μ L absolute ethyl alcohols are added, mix well, at this time it is possible that wadding
Shape precipitates, and does not influence the extraction of DNA, solution and flocculent deposit can all be added in adsorption column and (be transferred at twice after mixing same
Adsorption column).
6,12000rpm centrifuges 1min, abandons waste liquid, and adsorption column is put into collecting pipe to (being repeated twice will be obtained by previous step
Solution is all transferred to).
7,600 μ L rinsing liquids (please first checked whether before use and absolute ethyl alcohol has been added) are added into adsorption column,
12000rpm centrifuges 1min, abandons waste liquid, adsorption column is put into collecting pipe.
8,600 μ L rinsing liquids are added into adsorption column, 12000rpm centrifuges 1min, abandons waste liquid, adsorption column is put into collection
Guan Zhong.
9,12000rpm centrifuges 2min, and adsorption column opening is placed in room temperature or 50 DEG C of incubators are placed several minutes, it is therefore an objective to will
Remaining rinsing liquid removal in adsorption column, otherwise the ethyl alcohol in rinsing liquid can influence subsequent experiment such as digestion, PCR.
10, adsorption column is put into a clean centrifuge tube, to the hanging 50-200 μ L that are added dropwise in adsorbed film center through 65 DEG C
The eluent of water-bath preheating, is placed at room temperature for 5min, and 12000rpm centrifuges 2min.
11, centrifugation gained eluent can be added in adsorption column, 12000rpm centrifuges 2min, you can obtains high quality
Genomic DNA.
Two, it synthetic primer and is diluted
1, the above designed primer 1-6 and 3 are extended base primers to synthesize.
2, primer dilutes, and the primer of 2OD is diluted to 100mM.The amount of the TE of addition is 660000/MW.
3, one group of primer is added into ddH before doing experiment2O is diluted to the working concentration of 10mM.
Three, fragment amplification
1, PCR reaction systems：It is shown in Table 1；
Each reagent dosage in PCR reaction systems in table 1, embodiment
| Reagent | Dosage |
| 10×Buffer(15Mm Mg2+) | 1μL |
| Primer(10Mm) | 0.4μL |
| dNTP(10Mm) | 0.3μL |
| HotStar enzymes (5u/ μ L) | 0.1μL |
| Genomic DNA | 1μL |
| Mg2+(25Mm) | 0.52μL |
| ddH2O | 6.68μL |
| Total Volume | 10μL |
2, multi-PRC reaction uses the PCR response procedures of Touch-down：
95℃10min；
94℃40s；
63 DEG C of 40s each recycle 0.5 DEG C of decline；
72 DEG C of 1min, 15 cycles；
94℃40s；
56℃30s；
72 DEG C of 1min, 25 cycles；
72℃5min；After 4 DEG C preservation；
PCR product has the Success in Experiment that shows of segment, the result is shown in Figure 1 through agarose electrophoresis detection.
3, the purifying of PCR product
Polychrome SNP experiments are with the PCR product (0.01-0.4pmol) of step 2 for template.But PCR product must first perform pure
Change, remaining dNTPs dephosphorylations and ExoI are degraded the single-stranded primer that dissociates using SAP enzymes.
(1) enzyme is purified：SAP and Exo I；
(2) action principle：
SAP removes extra dNTP and primer；
Exo I remove single-stranded primer and other single-stranded DNA products；
(3) reaction system：
6 μ L+2 μ L enzyme mixations (SAP containing 2U and 2U ExoI) of PCR product vibrate mixing.
(4) reaction condition：
37 DEG C are incubated heat preservation 1hr, and then 75 DEG C of heat preservation 15min are to inactivate SAP and Exo I enzymes.Purified template can be with
R or -20 DEG C of long-term preservations for 24 hours are preserved at 4 DEG C.
4.Snapshot PCR
Hybrid template：If using PCR product as the template of Snapshot PCR, after purifying is good, each respectively takes 2 μ L,
Mixing.
Mix the PCR primer of Snapshot：The final concentration of each primer in the reaction system is respectively 0.2 μM.It is (each
SNP primers add 1-2 μ L to 500 μ L dd H2In O)
Snapshot PCR systems：It is shown in Table 2；
Each reagent dosage in Snapshot PCR reaction systems in table 2, embodiment
| Dosage (μ L/Sample) | Standard items (μ L) | |
| Reaction Mix | 0.5 | 5 |
| Pooled PCR Products | 2 | 2 |
| Pooled Primers | 1.2 | 1 |
| dH2O | 1.3 | 2 |
| Total volume | 5 | 10 |
PCR cycle condition is：
96℃10sec→【96℃10sec→50℃(53℃)5sec→60℃30sec】* 25 → 60 DEG C of 30sec of cycle →
4℃forever
5, the purifying of Snapshot PCR products
0.5USAP 1U CIP are added in the above-mentioned Snapshot PCR products of 5 μ L, shake mixing, 37 DEG C of heat preservations
1hr, 75 DEG C of heat preservation 15min preserve r or -20 DEG C of long-term preservations for 24 hours with inactivator, 4 DEG C.
6, prepared by 310,3100,3730 electrophoresis Samples
Each reagent dosage in electrophoretic system is sequenced in Snapshot in table 3, embodiment
| Reagent | Dosage (μ L) |
| Hi-Di Formamide | 9.25 |
| GS-120LIZ | 0.1 |
| Snapshot products | 1 |
| Total volume | 10.35 |
95 DEG C of denaturation 5min → freeze 4min rapidly.
Each electrophoresis sample adds LIZ-120 internal standards, and the length scale of extension segment is allow to be accurately positioned.
Four, results and discussion：
In the present embodiment, data analysis is carried out using GeneMapper4.0 softwares；Output data result after software analysis
It is as follows：It is shown in Table 4 and table 5；
The testing result in each 3 sites of 2 samples in table 4, embodiment
| Sample Name | Gene | Allele 1 | Allele 2 |
| Sample 1 | MT1A | A | C |
| Sample 1 | SLC30A8 | T | T |
| Sample 1 | SLC30A3 | T | T |
| Sample 2 | MT1A | C | C |
| Sample 2 | SLC30A8 | C | C |
| Sample 2 | SLC30A3 | G | G |
Sample system comprehensive analysis Zn-ef ficiency lacks Risk Results in table 5, embodiment
| Sample 1 | Sample 2 | |
| MT1A testing results | Risk | Low-risk |
| SLC30A8 testing results | Low-risk | High risk |
| SLC30A3 testing results | Low-risk | High risk |
| Zn-ef ficiency lacks Risk Results | Low-risk | High risk |
In the present embodiment, the Zn-ef ficiency that the testing result carried out is directed to two juvenile individuals lacks risk, sample
The Zn-ef ficiency shortage risk of teenager's individual in product 1 is low, therefore, according to the testing result, the teenager in subsequent life
Zn-ef ficiency magnitude of recruitment need not increase, it is only necessary to be taken according to the diet of daily life.
It is high that its juvenile Zn-ef ficiency in sample 2 lacks risk.In corresponding health control, the Zn-ef ficiency amount needed is than general
Logical people is high, needs the supplement for increasing Zn-ef ficiency on the basis of magnitude of recruitment is recommended by country, therefore, day of the parent in addition to paying attention to child
Outside normal diet, the zinc supplementary also contemplated in the market is additionally supplemented.
SEQUENCE LISTING
<110>Guangzhou Hexie Health Management Co., Ltd.
<120>Predict that human body mineral matter lacks risk gene detecting kit and detection method
<130> 2018
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence
<400> 1
gcccatccta gcctctac 18
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<400> 2
cttggcctca gtttgtct 18
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence
<400> 3
gaaagagttc ccatagcg 18
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence
<400> 4
gaaggtggcc tgtcaaat 18
<210> 5
<211> 18
<212> DNA
<213>Artificial sequence
<400> 5
gaaggatggg aaggattt 18
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
tgtcaaggga gacttatggt 20
<210> 7
<211> 24
<212> DNA
<213>Artificial sequence
<400> 7
gcaaatgcaa agagtgcaaa tgca 24
<210> 8
<211> 31
<212> DNA
<213>Artificial sequence
<400> 8
cccccgtgct tctttatcaa cagcagccag c 31
<210> 9
<211> 39
<212> DNA
<213>Artificial sequence
<400> 9
ccccccccgc gggacattgg ggccaaaaag tctgattcc 39
<210> 10
<211> 900
<212> DNA
<213>Genus Homo
<400> 10
atttatttca ttgatctagt gcttttccac tcagcgcctt catcatccct agaacattcc 60
tattctaatg cctcccattt cagaggcgag aggactcagg ctcataattc tcctgctcca 120
tgtcacccag gtagtcgggg actgctaggc tgagccccag tactctgcgc agttcctggg 180
gtggatggga gacaggagtt attggttttt cgggattaag gacataaagc ccatcctagc 240
ctctacagat agaagtaaga ttaggcttca tggtgccctg agttggacag gagctatcta 300
tcaggcctgg caatgcactc agctggcagc atttgttgac caactgctgt tatcttctgt 360
ataaaattca ctgccttttt ctcttccttg caggtggctc ctgcacctgc actggctcct 420
gcaaatgcaa agagtgcaaa tgcacctcct gcaagaagag tgagtgtggg gccatctcca 480
ggaatctggg gctgagccaa gtcagaggca ggaaaccaga gctgggcatg gaggagtagg 540
ccaatgatcc atttcccaca tccccttccc cagcaactga ttcaggatca gagccagatc 600
tttagacgtg atggattccc aagtttcgtt cttaaaatag acaaactgag gccaagagtg 660
caccagcctg ccaagcacag acatgacacc taaggacttt cctcccctaa gtgtgtggtt 720
ctggggagcc agccttcctt tgtccttcat aaccccagtc actgcctttc cagccttctg 780
ccaggtctgg ggctcagatg gagataagct tttcacagaa gaccctcact cgaaagatcc 840
accacttatc tcccatctcc gacagtgcat gccatcctga actaagtgtc ctctggggct 900
<210> 11
<211> 900
<212> DNA
<213>Genus Homo
<400> 11
aggtctgtgg ggagctctaa acgcttcctg gttcctgtca ctatccttga tataaattct 60
gattacatac aaagcctgca acccagagat ccctgggagc tggtgagcag ggctgtataa 120
gaaataatag ttctgtcttg gctttttcca gggcttgtct ccccttccat agtaagctcc 180
taggaatgcc agactccaga gataacagtg gacagaaaga gttcccatag cgacagggca 240
ctttgctgca ctagagtttc ccctgccttg tctgtgtgaa tgtagctgat tatcagagca 300
aacgtggctt cctctgagtg ccctgcctct gccccacccc agcaggtcaa agacaaagta 360
cttgaagttg gagtcagagc agtcgcccat gcgtgtgcaa tcagtgctaa tctccctgtg 420
cttctttatc aacagcagcc agccgggaca gccaagtggt tcggagagaa attgctaaag 480
cccttagcaa aagctttacg atgcactcac tcaccattca gatggaatct ccagttgacc 540
aggaccccga ctgccttttc tgtgaagacc cctgtgacta gctcagtcac accgtcagtt 600
tcccaaattt gacaggccac cttcaaacat gctgctatgc agtttctgca tcatagaaaa 660
taaggaacca aaggaagaaa ttcatgtcat ggtgcaatgc acattttatc tatttattta 720
gttccattca ccatgaagga agaggcactg agatccatca atcaattgga ttatatactg 780
atcagtagct gtgttcaatt gcaggaatgt gtatatagat tattcctgag tggagccgaa 840
gtaacagctg tttgtaacta tcggcaatac caaattcatc tcccttccaa taatgcatct 900
<210> 12
<211> 900
<212> DNA
<213>Genus Homo
<400> 12
caaaatgagc aggattccta ctgatctctg agagcttttg gtgaacaggg caagcatgta 60
cctacacaat gatatagagc gaaggtggcc actgtcatta gggcagttag agtgctatca 120
gggttctgag gatggagggc cagactaatt ataacgagga aatcagggaa acagctgtaa 180
gaggtaacat gagaagggcc ttgaaggatg ggaaggattt tgataaagac aggtgaatgc 240
tatgccaggc acgccaaggc agtatgaagg gaaggtggag tgaagtgtgg agtgggactc 300
agcatgtgtt cctggccttg gtgtgcctcc tttccaggcc cacctcccag aacctccact 360
cctggatcct gcccccgccc tccctagaca tgaagctgaa gtgtggccct ttaagagacg 420
agcgggacat tggggccaaa aagtctgatt ccgggcacag agaactgatg gctagattcc 480
agagctgggg ttgtcatggg aggaaggggt gcagcctgct atggctgagg atggcagtgg 540
gaggagcatg ttaattggac ttcagtccga ctataagcac ccagcagagc ccaccttaac 600
tgcatggtac cataagtctc ccttgacaaa tgaatggggc ttgggacctc acctggggat 660
gccagaggct gagtgaggtc aggctgagtg ctaagtccat tctggtccaa ttctcagccc 720
caccactacc caacctgaac ccagcaagga cagaattttc cacagaattc aggacctgaa 780
tagaaaatac agtactagaa atactcatgg aggtgtgaca agaataccca caagtaaaaa 840
cgatggctcc agatagaaat gtgatcatag cagcaaagtg gggcgggatg tctggggcct 900
Claims (9)
1. a kind of prediction human body mineral matter lacks risk gene detecting kit, which is characterized in that including：
For the first reagent of MT1A gene mutation sites rs11640851 detections, for SLC30A8 gene mutation sites
In second reagent of rs13266634 detections and the third reagent detected for SLC30A3 gene mutation sites rs11126936
It is one or more.
2. prediction human body mineral matter lacks risk gene detecting kit as described in claim 1, which is characterized in that
First reagent includes the first amplifing reagent of the MT1A gene magnifications for rs11640851 site primers；
Second reagent includes the second amplifing reagent of the SLC30A8 gene magnifications for rs13266634 site primers；
The third reagent includes the third amplifing reagent of the SLC30A3 gene magnifications for rs11126936 site primers.
3. prediction human body mineral matter lacks risk gene detecting kit as claimed in claim 2, which is characterized in that
First amplifing reagent includes the first primer and the second primer；
The sequence of the first primer is SEQ ID NO.1；
The sequence of second primer is SEQ ID NO.2.
4. prediction human body mineral matter lacks risk gene detecting kit as claimed in claim 3, which is characterized in that
Sequence based on the first primer and the second primer extend base is SEQ ID NO.7.
5. prediction human body mineral matter lacks risk gene detecting kit as claimed in claim 2, which is characterized in that
Second amplifing reagent includes third primer and the 4th primer；
The sequence of the third primer is SEQ ID NO.3；
The sequence of 4th primer is SEQ ID NO.4.
6. prediction human body mineral matter lacks risk gene detecting kit as claimed in claim 5, which is characterized in that
Sequence based on the third primer and the 4th primer extend base is SEQ ID NO.8.
7. prediction human body mineral matter lacks risk gene detecting kit as claimed in claim 2, which is characterized in that
The third amplifing reagent includes the 5th primer and the 6th primer；
The sequence of 5th primer is SEQ ID NO.5；
The sequence of 6th primer is SEQ ID NO.6.
8. prediction human body mineral matter lacks risk gene detecting kit as claimed in claim 7, which is characterized in that
Sequence based on the 5th primer and the 6th primer extend base is SEQ ID NO.9.
9. a kind of prediction human body mineral matter lacks risk gene tester, which is characterized in that including：
Genomic DNA in the cell sample containing human genome of the extraction by scraping the modes such as human oral cavity；
Based on MT1A gene mutation site rs11640851, SLC30A8 gene mutation site rs13266634 and SLC30A3 genes
One or more sites in the rs11126936 of mutational site, synthetic primer, and utilize genome described in the primer amplification
DNA obtains the segment containing one or more sites in rs11640851, rs13266634 and rs11126936；
Pass through the primer extend base；
Detect one or more corresponding positions in rs11640851, rs13266634 and rs11126936 in the segment
Point is to know the base information in the site；
The human body mineral matter for analyzing the sample lacks risk.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810293305.4A CN108486244A (en) | 2018-03-30 | 2018-03-30 | Predict that human body mineral matter lacks risk gene detecting kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810293305.4A CN108486244A (en) | 2018-03-30 | 2018-03-30 | Predict that human body mineral matter lacks risk gene detecting kit and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108486244A true CN108486244A (en) | 2018-09-04 |
Family
ID=63317868
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810293305.4A Pending CN108486244A (en) | 2018-03-30 | 2018-03-30 | Predict that human body mineral matter lacks risk gene detecting kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108486244A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110033845A (en) * | 2019-01-18 | 2019-07-19 | 深圳鼎新融合科技有限公司 | A kind of child nutrition element shortage risk class assessment system |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107227376A (en) * | 2017-08-08 | 2017-10-03 | 杭州祥音生物医药科技有限公司 | For Primer composition, kit and the methods and applications of the susceptible mutation of gene for detecting influence absorption of trace elements ability |
| CN108384844A (en) * | 2018-02-07 | 2018-08-10 | 深圳鼎新融合科技有限公司 | Detect primer pair, probe and the kit of mankind's VDR, GC, LRP5, SLC30A8 gene pleiomorphism |
-
2018
- 2018-03-30 CN CN201810293305.4A patent/CN108486244A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107227376A (en) * | 2017-08-08 | 2017-10-03 | 杭州祥音生物医药科技有限公司 | For Primer composition, kit and the methods and applications of the susceptible mutation of gene for detecting influence absorption of trace elements ability |
| CN108384844A (en) * | 2018-02-07 | 2018-08-10 | 深圳鼎新融合科技有限公司 | Detect primer pair, probe and the kit of mankind's VDR, GC, LRP5, SLC30A8 gene pleiomorphism |
Non-Patent Citations (2)
| Title |
|---|
| FUJIHARA, JUNKO; YASUDA, TOSHIHIRO; KIMURA-KATAOKA, KAORI; 等.: "Association of SNPs in genes encoding zinc transporters on blood zinc levels in humans", 《LEGAL MEDICINE》 * |
| MOCCHEGIANI,EUGENIO;COSTARELLI,LAURA;GIACCONI,ROBERTINA;等: "Zinc, metallothioneins and immunosenescence: effect of zinc supply as nutrigenomic approach", 《BIOGERONTOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110033845A (en) * | 2019-01-18 | 2019-07-19 | 深圳鼎新融合科技有限公司 | A kind of child nutrition element shortage risk class assessment system |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106591473B (en) | A kind of people MTHFR and MTRR genetic polymorphism detections primer, probe, kit and method | |
| CN111944912B (en) | Skin gene detection method | |
| CN110904250A (en) | Multiple fluorescent quantitative PCR primer, kit and detection method for detecting multiple bacteria | |
| CN101671736B (en) | Gene detection kit used for detecting cell chimerism or individual recognition | |
| EP2772540A1 (en) | Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor | |
| CN108486244A (en) | Predict that human body mineral matter lacks risk gene detecting kit and detection method | |
| Bramanti et al. | Ancient DNA analysis of the delta F508 mutation | |
| CN111549116A (en) | Female early-onset ovarian insufficiency susceptibility gene detection model and detection kit | |
| CN108179187A (en) | A kind of pre-computed altitude risks of myopia gene detecting kit and detection method | |
| CN116716386A (en) | Detection kit for vitamin C deficiency risk assessment and application method thereof | |
| Gundorova et al. | Mutation spectrum of the PAH gene in phenylketonuria patients in the Karachay-Cherkess Republic (Russia) | |
| CN113337598B (en) | Detection kit for pregnancy vitamin B12 deficiency risk assessment and application method | |
| CN111961718B (en) | Clopidogrel medication gene detection kit and use method thereof | |
| CN116814758A (en) | Amplification primer group for nutrition metabolism related genes and detection method | |
| Bharath et al. | Isolation and quantification of DNA from epithelial cells obtained from acrylic removable partial denture for sex identification | |
| CN111073976A (en) | UIMC1 gene mutation site detection kit and application thereof | |
| RU2800082C2 (en) | Method for obtaining molecular single nucleotide markers for determining the probable ethnogeographic origin of a person, a set of oligonucleotides for implementing the method | |
| RU2607031C1 (en) | Method of detecting candidate genes for population research of genetic polymorphism in children dwelling in strontium geochemical province environment | |
| CN113957144B (en) | Combined methylmalonic acidemia gene mutation detection kit | |
| CN114410771B (en) | Primer library combination, kit and method for detecting neonatal genetic disease genes based on first-generation sequencing platform | |
| RU2800084C2 (en) | Method for obtaining molecular X-chromosome STR markers for identifying an unknown individual and determining biological relationship for working with samples of small amounts of DNA and a set of oligonucleotides for its implementation | |
| Ergun et al. | Whole exome sequencing reveals a mutation in an osteogenesis imperfecta patient | |
| KR102342523B1 (en) | Composition for prediction or diagnosis of hypertension or obesity | |
| CN107385026B (en) | Group of mutant genes related to breast cancer and auxiliary diagnostic kit thereof | |
| Gauri | Evaluation of Potential DNA Sources and Need of DNA Analysis for Personalized Medicine in Microfluidic Device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180904 |
|
| RJ01 | Rejection of invention patent application after publication |