CN107190012A - Recombinant mutant pig circular ring virus 2 virus capsid protein - Google Patents

Recombinant mutant pig circular ring virus 2 virus capsid protein Download PDF

Info

Publication number
CN107190012A
CN107190012A CN201610141013.XA CN201610141013A CN107190012A CN 107190012 A CN107190012 A CN 107190012A CN 201610141013 A CN201610141013 A CN 201610141013A CN 107190012 A CN107190012 A CN 107190012A
Authority
CN
China
Prior art keywords
pcv
capsid protein
virus
vaccine
antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610141013.XA
Other languages
Chinese (zh)
Inventor
不公告发明人
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Send Biotechnology Co Ltd
Original Assignee
Suzhou Send Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Send Biotechnology Co Ltd filed Critical Suzhou Send Biotechnology Co Ltd
Priority to CN201610141013.XA priority Critical patent/CN107190012A/en
Publication of CN107190012A publication Critical patent/CN107190012A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/10011—Circoviridae
    • C12N2750/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/10011—Circoviridae
    • C12N2750/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

This hair is provided with former and insect rhabdovirus system production the recombinant mutant pig circular ring virus 2 virus capsid protein of E. coli system.They are used as antigen and are made vaccine, and induction is particularly the immunity of 2 type b subclass pig circular ring virus (PCV2b) to pig circular ring virus, can prevent after inoculation or to mitigate pig circular ring virus diseases related.In addition, they also can be used to detect the specific antibody that pig circular ring virus is particularly 2 type b subclass PCV-IIs.

Description

Recombinant mutant pig circular ring virus 2 virus capsid protein
Technical field：
The present invention relates to recombinant mutant pig circular ring virus 2 virus capsid protein, they are used as antigen and vaccine are made or for examining Survey antibody.
Background technology
Pig circular ring virus (Porcine circovirus, PCV) is no coating, sub-thread minus strand cyclic DNA virus [Tischer I, et al.Nature.1982Jan 7；295(5844)：64-6], including PCV1 and PCV2 [Allan G, 2012] two types.PCV1 is to pig no pathogenicity, and PCV2 is diseases related (the Porcine circovirus of pig circular ring virus Associated disease, PCVAD) pathogen, can worldwide cause PCVAD.PCVAD is also referred to as pig annulus Virus disease (porcine circovirus disease, PCVD) or pmws (postweaning multisystemic wasting syndrome, PMWS).PCVAD is the systematic disease of pig, can Involving respiratory system (causing pneumonia), enteron aisle (causing enteritis), skin (causing necrodermatitis), kidney (causes nephrosis to integrate Levy) and reproductive system [Opriessnig T, et al.J Vet Diagn Invest.2007Nov；19(6)：591-615； Segalés J.et al.Res Vet Sci.2012Dec；93(3)：1231-40], can also appear as consumption, enlargement of lymph nodes, Jaundice and Body weight loss.PCV2 can destroy the lymphoid tissue of pig, cause lymphoid tissue to lack.Lymphoid tissue missing is PCVAD A kind of significant pathological change [Ramamoorthy S, et al.Anim Health Res Rev.2009Jun；10(1)：1- 20].PCVAD another feature is that occur immunodeficiency [Darwich L, et al.Virus Res.2012Mar；164 (1-2)：61-7；Meng XJ.Annu Rev Anim Biosci.2013Jan；1：43-64].This immune deficiency makes infection PCV2 pig is easily occurred together multiple pathogens infection, and these pathogen include the [Opriessnig such as protozoon, fungi, bacterium and virus T, et al.Vet Microbiol.2012Jul 6；158(1-2)：69-81].
PCV2 has two genotype of PCV2a and PCV2b.Over nearly 10 years, worldwide popular PCV2 experienced from By main infection genotype of PCV2a to drift (shift) [the Trible BR, et using PCV2b as main infection genotype al.Virus Res.2012Mar；164(1-2)：68-77].
PCV2 mainly propagates [Rose N, et al.Vet by porcine respiratory, alimentary canal and the urinary tract secretion Microbiol.2012May25；157(1-2)：152-63].
PCV2 infection can make the immunologic function disorder of pig, show as immunologic hypofunction, can also appear as immunologic function high Enter (hyperimmunoreactivity).In the individual for occurring PMWS, its B cell and T cell can be eliminated totally, make it not PCV2 protection antibodies [Chae C.Vet.J.2004 168 can be produced：41-49]；In the pig for occurring dermatitis and nephrotic syndrome It may occur in which immune complex in skin and a large amount of depositions [Chae C.Vet.J.2005 169 of kidney：326-336].
PCV2 genome has three open reading frames (open reading frame, ORF)：ORF1, ORF2 and ORF3.ORF2 encoding capsid proteins (capsid protein, CP).The homology of sequence is between PCV1 and PCV2 ORF2 67% [Allan G, et al.Virus Res.2012Mar；164(1-2)：4-9].CP is PCV2 exclusive architecture albumen, can It is self-assembled into virus-like particle (Virus like particles, VLPs).CP is used as the antigen of PCV2 vaccines.
PCV2 vaccines can induce the protective immunological reaction for PCV, prevention or mitigation PCVAD (Fachinger et al.Vaccine.2008Mar10；26(11)：1488-99；et al.Vaccine.2008Jun 25；26(27- 28)：3443-51；Segal é s et al.Vaccine.2009Dec 9；27(52)：7313-21；Pejsak et al.Pol J Vet Sci.2012；15(1)：37-42].Existing commercialization PCV vaccines are PCV2a vaccines, including PCV2a inactivated vaccines, PCV2a total lengths capsid protein subunit vaccine and attenuation PCV1-2a embedded viruses vaccine [the Beach NM, et of inactivation al.Virus Res.2012Mar；164(1-2)：33-42].PCV1-2a embedded viruses be using PCV1 gene framework and The virus that PCV2a capsid protein genes are made.PCV2b vaccines in the development stage have a variety of [Beach NM, et al.Virus Res.2012Mar；164(1-2)：33-42], including the PCV2b attenuations through passing on repeatedly or genetic modification is obtained Viral vaccine, PCV1-2b embedded viruses vaccine, Plasmid DNA vaccines, the PCV2 Cap for carrying chimeric PCV1-2 genomes are thin Bacterium phage display vaccine, PCV2 Cap displaying baculovirus vector vaccine, PCV2 Cap pseudoabies poisonous carrier Vaccine, PCV2 Cap adenovirus carrier vaccine and PCV2 Cap bronchus Bao Te bacillus (Bacterium Bordetella bronchiseptica) carrier bacterin.
The immunity that the capsid protein (CP) encoded by PCV2ORF2- is induced can resist PCV2 attack, this to exempt from The main neutralizing antibody (neutralizing antibodies, NA) by PCV2 of epidemic disease power mediates [Blanchard P, et al.Vaccine 2003；21：4565-75；Segale ' s J.Expert Rev.Vaccines 2,015 14 (3), 473- 487]。
When examination PCV2 infects and detects PCV2 vaccine potencies, the total antibody (total of PCV2 in being circulated more according to pig blood Anti-PCV2antibodies, TA) level judge.TA is PCV2 specific antibodies.Field observation and clinical research table It is bright, in the presence of high titre TA, PCV2 can still exist in the tissue and blood of host [guez-Arrioja GM, et al.Am J Vet Res2002；63：354-7；Larochelle R, et al.Can J Vet Res 2003；67： 114-20；Sibila M, et al.Am J Vet Res2004；65：88-92；McIntosh Ka, et al.Can J Vet Res 2006；70(1)：58-61；Segale ' s J.Expert Rev.Vaccines 2,015 14 (3), 473-487].This says It is bright, neutralizing antibody (neutralizing antibodies, NA) is lacked in this kind of high titre TA, there is substantial amounts of non-neutralization Antibody (non-neutralizing antibodies, N-NA) [Meerts P, et al.BMC Vet Res2006；2：6； Fort M, et al.Vet Microbiol 2007；125：244-55].Under experimental conditions, PCV2NA can be after vaccine inoculation 10 to 28 days occur [Meerts P, et al.BMC Vet Res 2006；2：6；Fort M, et al.Vet Microbiol2007；125：244-55；Pogranichnyy RM, et al.Viral Immunol 2000；13：143-53]. PCV2NA level and PCV2 replicates the negatively correlated relation of generation [Meerts P, the et al.BMC Vet Res with PCV2-SD 2006；2：6；Fort M, et al.Vet Microbiol 2007；125：244-55].Generate high-level PCV2TA pig body Interior PCV2NA levels may be not enough to infection [Meerts P, the et al.BMC Vet Res 2006 for protecting it to resist PCV2； 2：6；Fort M, et al.Vet Microbiol 2007；125：244-55]；PCV2NA produces not enough pig, even if existing high The PCV2 specific antibodies of titre may not also possess the immunity [Segale ' s J.Expert Rev.Vaccines for removing PCV2 2015 14 (3), 473-487].
The main neutralizing epitopes on PCV2CP of PCV2NA, which are stimulated, to be produced.Research shows there is B cell table on PCV2CP Position, there is also t cell epitope [Meerts P, et al.Viral Immunol 2005；18：333-41；Fort M, et al.Vet Immunol Immunopathol2009；129：101-7；Steiner E, et al.BMC Vet Res 2009；5： 45]；B cell epitope includes the neutralizing epitope (neutralizing epitopes) that NA can be stimulated to produce and can stimulate N-NA's Non- neutralizing epitope (Non neutralizing epitopes)；The non-neutralizing epitope having is to inveigle epitope (decoy epitope) [Trible BR, et al.Clin.Vaccine Immunol.2011,18：749-757；Trible BR, et al.Virus Res.2012.164：68-77].The upper peptide fragments [CP (169-180)] being made up of 169-180 amino acid residues of PCV2CP are one Inveigle epitope.CP (169-180) is also referred to as immunodominance oligopeptides (immunodominant oligopeptide epitope) [Trible BR, et al.Clin.Vaccine Immunol.2011.18：749-757].To the 462PCV2 sequences in gene pool Row analysis is disclosed, CP (169-180) sequence it is highly conserved [Trible, B.R., et al.Journal of virology, 2012,86,13508-13514].X-ray diffraction analysis display, the functional areas where CP (169-180) form an outer loop knot Structure (external loop structure).The structure is dashed forward in the outside of CP subunits, 173-Tyr therein, 174-Phe and 175-Glu is the critical amino acid residues of antibody binding.The structure is the basis that CP (169-180) is recognized by antibody, combined. However, when PCV2 particles are formed, CP (169-180) is not exposed to the surface of virion.Therefore, in complete virus In particle, antibody can not close to CP (169-180) [Trible, B.R., et al.Journal of virology, 2012,86, 13508-13514].With PCV2CP monomers [Trible, B.R., et al.Journal of virology, 2012,86, 13508-13514] and VLP (PCV2CP VLP) [Khayat, R., et al.Journal of for being formed by PCV2CP Virology, 2011,85 (15), 7856-7862] distinguish discovery after immune swine, generate height with the PCV2CP VLP pigs being immunized The anti-PCV antibody (anti-PCV2antibodies) of level, including high-caliber PCV2NA and low-level CP (169- 180) antibody.After being attacked by PCV2, PCV2 is can't detect in the serum through the PCV2CP VLP pigs being immunized.By contrast, In the serum for the pig that PCV2CP monomers are immunized, it can detect that high-caliber PCV antibody and high-caliber CP (169-180) are anti- Body, almost inspection does not measure PCV2 neutralization activities.In addition, after being attacked with PCV2, the PCV2 diseases for the pig being immunized through PCV2CP monomers Toxaemia and non-immune pig without difference.This explanation, CP (169-180) antibody is N-NA；The anti-CP (169-180) of high level Antibody can not control PCV2 duplication [Trible, B.R., et al.Journal of virology, 2012,86,13508- 13514]。
It is a universals of the pathogen that can set up Long-term Infection in the presence of trick epitope.It is non-protective to inveigle epitope Epitope (non-protective epitopes), is immunodominant epitope (immunodominant epitope).Inveigle epitope Can strength, long stimulus B cell occur humoral immune response, thus can start suppress antibody tormation reverse feedback regulation, should Regulation and control can suppress the humoral immune response that neutralizing epitope occurs, thus suppress NA generation.In complete PCV2 particles, as exempting from The CP (169-180) of epidemic disease Dominant Epitopes is hidden in the position that antibody can not be reached, it is impossible to stimulate the generation for inveigling antibody.For complete The immune response that PCV2 particles occur produces substantial amounts of NA, and host can be made to control PCV2 duplication.PCV2 infection cells can be produced Free CP or CP fragments.The restructuring PCV2CP VLP not assembled can expose CP (169-180), thus can stimulate substantial amounts of CP (169-180) antibody.Infect the PCV2 other pathogen of pig easy infection.This concomitant infections can stimulate PCV2 duplication to make infection Cell produces PCV2CP monomers and PCV2CP fragments.The immune response occurred for the free CP or PCV2CP fragments of PCV2 produces big The N-NA of amount, this antibody can not neutralize PCV2, it is impossible to control PCV2 duplication, thus can make attacking for PCV2 escape immune systems Hit.The PCV2 of immune system attack of having escaped is sustainable to be replicated in infection cell, produce more PCV2CP monomers and PCV2CP fragments, make PCVAD delay progress.The antibody suffered from PCVAD pig bodies is mainly immunodominance oligopeptides (immunodominant oligopeptide epitope, CP (169-180) antibody [Trible BR, et al.Clin.Vaccine Immunol.2011.18：749-757].The function of CP (169-180) antibody is immune trick (immunological decoy), makes immune response deviate from the epitope of protectiveness, thus PCV2 using this inveigle epitope as A kind of defense mechanism, is resisted, immune system [Trible, B.R., et the al.Journal of of escape host with this Virology, 2012,86,13508-13514].
The content of the invention：
1st, the present invention provides a kind of recombinant mutant PCV2b capsid proteins, is characterized in eliminating PCV2b capsid proteins Escape epitopes and by another peptide fragment (containing neutralizing epitope) of its instead PCV2b capsid protein.
2nd, the invention provides produce this recombinant mutant in E. coli system and insect cell rhabdovirus system The method of PCV2b capsid proteins, the recombinant mutant PCV2b capsid proteins produced in E. coli system are named as C2, in elder brother The recombinant mutant PCV2b capsid proteins of worm cell rhabdovirus system production are named as Cβ。
3rd, the invention provides coding C2 nucleotide sequence (sequence table<400>2) with C2 amino acid sequence (sequence table <400>3) coding C, is also providedβNucleotide sequence (sequence table<400>And C 5)βAmino acid sequence (sequence table<400> 6)。
4th, the invention provides C2 and CβBeing used as antigen is used for the preparation of vaccine and is particularly for PCV-II The detection of PCV2b specific antibodies.C2 and CβIt is as the characteristics of preparing vaccine antigen：It can induce the annulus disease of high titre Poison particularly PCV2b specific antibodies, the antibody of PCV-II capsid protein escape epitopes is directed to without inducing.C2 and CβAs The characteristics of detection of specific antibody antigen is：With it detects that PCV-II specific antibody do not include by PCV-II capsid The nonneutralizing antibody that albumen escape epitopes are induced.
5th, the recombinant mutant PCV2b capsid proteins that the present invention is provided, including but not limited to C2 and CβVaccine can be made into Prevent the porcine circovirus associated diseases as caused by Infection of Porcine circovirus.
6th, the recombinant mutant PCV2b capsid proteins that provide of the present invention can and adjuvant, pharmaceutically acceptable carrier be made into vaccine Or vaccine combination prevents the porcine circovirus associated diseases as caused by Infection of Porcine circovirus.
7th, the recombinant mutant PCV2b capsid proteins that the present invention is provided, including but not limited to C2 and CβIt is used as antigen The specific antibody of pig circular ring virus is detected, without detecting the antibody induced by pig circular ring virus 2 virus capsid protein escape epitopes.
Term in invention：
Except non-specifically is emphasized, the term in the present invention has what can be understood by technical staff in art of the present invention Ordinary meaning.If there is the conflict in implication, the explanation in the present invention should be deferred to, defines or illustrates.
" recombinant porcine circovirus capsid protein "：It is to use the restructuring containing pig circular ring virus 2 virus capsid protein encoding gene is carried The pig circular ring virus 2 virus capsid protein (PCV CP) of the Escherichia coli production of plasmid, also refers to the stalk shape for carrying PCV CP encoding genes The PCV CP of the insect cell production of virus infection, also including the PCV CP with yeast cells or mammalian cell production.Weight Group PCV CP monomers can be self-assembled into virus-like particle (virus like particle, VLP), and the VLP is used as antigen system For the vaccine for having prevention effect to Infection of Porcine circovirus.Trick epitope in restructuring PCV CP monomers can stimulate pig circular ring virus The generation of nonneutralizing antibody.This antibody is also referred to as inveigling antibody, may interfere with the generation of pig circular ring virus neutralizing antibody.PCV CP represents pig circular ring virus 2 virus capsid protein, is included in the pig circular ring virus 2 virus capsid protein on PCV2 particles, also represents Recombinant Swine circle Circovirus virus capsid protein.PCV CP epitopes containing trick.The PCV CP encoding genes that the present invention is provided employ the close of optimization design Numeral.
" recombinant mutant pig circular ring virus 2 virus capsid protein " is to use the restructuring matter for changing structure encoding gene containing PCV CP are carried The PCV CP of the Escherichia coli production of grain, also refer to and are produced with the insect cell for the stalk shape virus infection for carrying PCV CP encoding genes PCV CP, also change structure PCV CP including what is produced with yeast cells or mammalian cell.Change structure recombinant porcine circovirus clothing Glutelin is to eliminate to inveigle epitope and in the recombinant porcine circovirus capsid egg for the position instead neutralizing epitope for inveigling epitope In vain.Change structure recombinant porcine circovirus capsid protein and be used as antigen and prepare have the epidemic disease of prevention effect to Infection of Porcine circovirus Seedling.Change structure recombinant porcine circovirus capsid protein and do not induce anti-CP (169-180) antibody, and add and induce PCV neutralizing antibodies Neutralizing epitope.Represented with C2 and change structure recombinant porcine circovirus capsid protein what Escherichia coli produced.C2 and use large intestine bar The structure recombinant porcine circovirus capsid protein that changes of bacterium production has identical implication.Use CβRepresent in insect rhabdovirus system production Change structure recombinant porcine circovirus capsid protein, CβWith produced in insect rhabdovirus system change structure recombinant porcine circovirus clothing Glutelin has identical implication.C2 engineering bacterias refer to the Escherichia coli for converting pET28a-C2, can be used to produce C2. PET28a-C2 is pET28a (+) plasmid for carrying C2 encoding genes.PET28a (+) plasmid is procaryotic cell expression plasmid.Restructuring Identical implication can be had by changing structure pig circular ring virus 2 virus capsid protein and changing structure pig circular ring virus 2 virus capsid protein.
" Infection of Porcine circovirus "：Infection of Porcine circovirus is caused by pig circular ring virus (PCV), and caused disease is referred to as Pig circular ring virus is diseases related.
" porcine circovirus associated diseases " porcine circovirus associated diseases (Porcine circovirus associated Disease, PCVAD) it is also referred to as pig circular ring virus disease (Porcine circovirus diseases, PCVD).PCVAD is initial Be referred to as pmws (postweaning multisystemic wasting syndrome, PMWS).According to the difference of pathological condition, PCVAD is also referred to as Pcv system disease (PCV-systemic disease, PCV- SD), PCV2 subclinical infections (PCV2-subclinical infection, PCV2-SI), PCV2 genital system diseases (PCV2- Reproductive disease, PCV2-RD), pigskin scorching (porcine dermatitis) and pig nephrotic syndrome (nephropathy syndrome, PDNS) [Segale ' s J.Expert Rev.Vaccines 2,015 14 (3), 473- 487].PCVAD Major Clinical, pathology and diagnosis index such as document [Segale ' s J.Expert Rev.Vaccines 2015 14 (3), 473-487] table one (TABLE 1) it is described.
" anti-infective "：The recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided can play the work of anti-PCV2 infection With.It is anti-infective and treatment or prevention effect is produced to microorganism infection is the term that can exchange.Anti- PCV2 infection also refers to prevention Or mitigate porcine circovirus associated diseases.What the present invention was provided, which changes structure recombinant porcine circovirus capsid protein, has anti-infective work With.
" antigen " is to be recognized by B-cell receptor or φt cell receptor and excite individual adaptability immune response (adaptive Immune response) material or molecule.Antigen can come from the outside of individual, such as microbial antigen；Also it may be from individual Inside, such as tumour antigen.Microbial antigen is can be recognized and exciting by B-cell receptor or φt cell receptor from microorganism The material or molecule of individual adaptability immune response.The vaccine being prepared into using microbial antigen can make it after to individual applications The immunity to the pathogen is obtained, it is protected when touching same or like pathogen again.Antigen can be from Microorganism or tumour cell extract, can use recombinant DNA technology in E. coli system, insect rhabdovirus system, yeast System and mammalian cell system production, also can use be chemically synthesized.What the present invention was provided changes structure recombinant porcine circovirus Capsid protein is a kind of microbial antigen.Antigen is the main component of vaccine, can also be used to detect antigen-specific antibodies.
" immune response "：Immune response (immune response) and immune response have similar meaning.Immune response It is that individual immunocyte includes bone-marrow-derived lymphocyte, T lymphocytes, NK cells, gamma delta T cells, NKT cells, dendritic cells, macrophage Cell and granulocyte etc. are to antigen or other stimulations [related model molecule (the pathogen associated of such as pathogen Molecular pattern, PAMP) model molecule (the damage associated molecular related to damage Pattern, DAMP) reaction made.The result of immune response is selective destruction or the pathogenic microorganism or interior for removing invasion Raw tumour cell.Immune response includes innate immune response and adaptive immune response.Adaptive immune response includes cell and exempted from Epidemic disease response and humoral immune response.The immune response excited by the vaccine being made of microbial antigen can make what is be immunized Individual obtains the ability of resistance microorganism infection.To individual to the immune response of microorganism anti-infectious function can occur for promotion.Tool The immune response for having anti-infectious function is protective immune response.The recombinant mutant PCV-II capsid protein that the present invention is provided can Induction individual produces protective immune response.
" individual "：The vertebra that individual (subject or individual) in the present invention is referred to including pig, mouse is moved Thing, also including people.
" lymphocyte "：Lymphocyte (lymphocyte) refers to not to be had present in blood, lymph and lymphoid tissue The mono-nuclear leukocytes of phagocytic activity, including bone-marrow-derived lymphocyte (also referred to as B cell) and T lymphocytes (also referred to as T cell).T cell can It is divided into the T cell (CD4 of surface expression CD4 molecules+T cell) and be the T cell (CD8 of surface expression CD8 molecules+T cell).
The viral antigens such as membrane-associated protein, capsid protein, the enzyme of " antiviral adaptive immune response " viral gene coding Individual can be excited to occur adaptive immune response, the response includes antiviral humoral immune response and antiviral cellular immunity should Answer.The antibody produced during antiviral humoral immune response can play following effects：1. viruses adsorption, intrusion infection are prevented Cell；2. limiting virus are sent out in body fluid；3. by activating complement, opsonic action, antibody-dependant cell-mediated cell Plain effect destroys virus infected cell.Antiviral cell immunoreceptor is main by CD8+T cells and CD4+T cell is mediated.CD8+T Cell can specific killing virus infected cell, also can be antiviral by producing TNF, gamma interferon and T cell The factor (CD8+T-cell anti-viral factor, CAF) plays non-lethal antiviral effect.CD4+T cells can pass through Discharge cytokine activation macrophage, promote CD8+T cell propagation, break up and play antivirus action, also can specificity kill Hinder virus infected cell.
" epitope " is also referred to as epitope (antigen epitope) or epitope (antigen determinant), It is the chemical group of decision antigentic specificity in antigen molecule, to determine the specific material base of immune response.Epitope can quilt Antigen receptor identification, the combination of lymphocytic cell surface, and then activated lymphocyte, cause immune response.Antibody molecule molecule exists Identification, with reference to playing immunological effect after epitope.Epitope can be divided into linear epitope and comformational epitope.Linear epitope The epitope that (linear epitope) is made up of the amino acid residue being sequentially connected, also referred to as continuous epitope.Linear epitope can be by T Cell receptor identification, combination, can also be recognized by B-cell receptor, combine.Linear epitope positioned at proteantigen surface can be approached Antibody is simultaneously combined by it.Linear epitope inside proteantigen, is difficult or can not be combined close to antibody and by it.Have Linear epitope can be located at the surface of protein monomer, but when multiple (such as dozens of or hundreds of) protein monomers constitute compound After (being such as assembled into virus-like particle), the linear epitope will be concealed the inside of the compound and be difficult or can not approach Antibody is simultaneously combined by it.Comformational epitope (conformational epitope) is by the disjunct amino acid residue folding of order Fold out the epitope formed after space conformation.The determination of linear epitope on PCV2CP can be using the PCV Swine serums infected or PCV diseases Malicious high immune rabbit anteserum detects that the superposition peptide of capsid protein (CP) is carried out.According to CP sequent synthesis cover the whole audience and CP All 12 peptides of superposition.Linear epitope in the antibody response area (Antibody reactive regions) of determination is PCV2b CP 3-43,71-85,117-131 and 171-202 [Mah é, D., et al.The Journal of General Virology, 2000,81 (Pt 7), 1815-1824].The determination of comformational epitope [conformational epitopes] can be using chimeric disease The cell and monoclonal antibody of malicious DNA transfections are carried out.Cell with 7 plants of anti-PCV CP monoclonal antibodies and the chimeric PCV of transfection is true Immune response area (immunoreactive in fixed PCV CP comformational epitopes [conformational epitopes] Regions) in 47-85,165-200 and 200-233 [Lekcharoensuk, P., et al.Journal of Virology, 2004,78 (15), 8135-8145].With reference to the studies above, it is 4 immune response areas that can divide PCV CP, is named as epitope A-D [Trible, B.R., et al.Clinical and Vaccine Immunology：2011CVI, 18 (5), 749-757].
" B cell epitope " is by B-cell receptor (B cell receptor, BCR) or antibody identification, the epitope combined.B Cell recognized by BCR, with reference to obtaining activation signal after B cell epitope.In the presence of other activation signals, activated The B cell proliferation of signal, differentiation, and then generation can recognize that, with reference to the antibody of B cell epitope.
" immunodominant epitope " immunodominant epitope (immunodominant epitopes) is energy on an antigen molecule Effective stimulus B cell produces the B cell epitope of specific antibody.For B cell produces antibody, the B on an antigen molecule Cell epitope is not equivalent.Some B cell epitopes can be recognized preferentially by the BCR of B cell, and potent can stimulate the B cell High-caliber specific antibody is produced, as immunodominant epitope.Some B cell epitopes do not possess this effect.It can use PCV2 infects Swine serum, PCV2 vaccine immunities Swine serum or suffers from PCVAD Swine serums to determine immunodominant epitope on PCV2CP [Trible, B.R., et al.Clinical and Vaccine Immunology：2011CVI, 18 (5), 749-757].This The recombinant mutant PCV-II capsid protein that invention is provided contains the Dominant Epitopes of more energy inducing protective immunity reaction.
" neutralizing epitope " is the B cell epitope that neutralizing antibody can be stimulated to produce.Neutralizing epitope on virion stimulates production Raw neutralizing antibody can prevent viral host cells infected, limiting virus from being spread in body fluid between body fluid.In viral vaccine Antigen should contain neutralizing epitope.The recombinant mutant PCV-II capsid protein that the present invention is provided contains more neutralizing epitopes.
" t cell epitope " is the epitope for being recognized, combining by φt cell receptor (T cell receptor, TCR).T cell by Body (T cell receptor, TCR) is antigen receptor of the expression on T cell surface, is heterodimer transmembrane protein.TCR is by can Become (V) area and constant (C) district's groups into.V areas are the domains that TCR recognizes epitope.TCR is unable to Direct Recognition t cell epitope, Epitope peptide-MHC molecule compound of antigen presenting cell or target cells can only be recognized.MHC molecule is major histocompatibility The proteinaceous molecule of complex (major histocompatibiltiy complex, MHC) gene code, including MHC I classes Molecule and MHC II quasi-molecules.
" protective epitope " protective epitope (protective epitopes) is that individual can be stimulated to produce protective immunity The epitope of reaction, can be B cell epitope or t cell epitope.It is anti-that protective epitope can stimulate individual to produce protectiveness Virus immunity reacts.It can make individual from the viral infection for a certain viral protective immunological reaction or mitigate the virus The caused disease of infection.Neutralizing epitope is a kind of protective epitope.The recombinant mutant PCV-II capsid egg that the present invention is provided Contain more protective epitopes in vain.
" trick epitope " inveigles epitope (decoy epitope) to be a kind of immunodominant epitope, but non-protective epitope, main Stimulate nonneutralizing antibody to produce, can weaken or suppress immune response of the individual to protective epitope.Epitope is inveigled to be also referred to as escape Epitope.Virus can be by inveigling epitope to exercise immune trick (immunological decoys), and escape host's is immune whereby Attack.Typically immune trick sees feline immunodeficiency virus (feline immunodeficiency virus, FIV) and people HIV (human immunodeficiency virus, HIV).Variable region (the variable of FIV envelope proteins Regions) V3, V4 and V5 are that FIV completes section necessary to its host cells infected, there is immunodominance neutralizing epitope, can pierce Swash the generation of neutralizing antibody.But during infection, these regions can shorten, increase or amino acid sequence height Variation, and then stimulate substantial amounts of non-protective antibody [Hosie MJ, the et al.Viruses 2,011 3 of generation：1870-1890]. HIV glycoprotein 120 (gp120) [Stamatatos L, et al.Nat.Med.2009 15：866-870] trick also occurs Epitope, stimulates the generation of nonneutralizing antibody.Hypervariable region sustainability in PRRSV glycoprotein 5 (GP5) is recruited B cell but not pierced Swash and produce neutralizing antibody [Ostrowski M, et al.J.Virol.2002 76：4241-4250], gammaherpesvirus Glycoprotein 150 (gp150) be with immunodominance, to stimulate non-protective antibody response [Gillet L, et al.PLoS One.2007Aug 8；2(8)：e705].CP (169-180) peptide fragment of pig circular ring virus 2 virus capsid protein is to inveigle epitope [Trible, B.R., et al.Journal of virology, 2012,86,13508-13514].Pig circular ring virus correlation disease A kind of significant change of disease is the immune disorder of host, shows as producing substantial amounts of nonneutralizing antibody (non- neutralizing antibody).The recombinant mutant PCV-II capsid protein that the present invention is provided is without trick epitope.
" PCV2 Cap (169-180) oligopeptides " is the 169th to the 180th of the CP according to pig circular ring virus 2 virus capsid protein The peptide fragment of amino acids sequent synthesis, also referred to as CP (169-180).Envelope antigen can be done using CP (169-180) and do enzyme-linked Immunoadsorption assay (ELISA) inveigles epitope to stimulate the non-neutralization produced to inveigle antibody to detect by pig circular ring virus 2 virus capsid protein [Trible, B.R., et al.Journal of virology, 2012,86,13508-13514；Trible BR, et al.2011.Clin.Vaccine Immunol.18：749-757；Trible BR, et al.2012.Vaccine 30：4079- 4085]。
" neutralizing antibody " is produced by the bone-marrow-derived lymphocyte of individual during antiviral humoral immune response, can passed through The antibody for recognizing, preventing virus infected cell and limiting virus to spread with reference to viral antigen.In general, only for being expressed in The antibody (i.e. neutralizing antibody) of virus or infected cell surface glycoprotein just has the effect for controlling virus infection.Neutralizing antibody Effect with anti-circovirus infection.
" " protection antibody (protective antibody) can protect individuals from virus infection to protection antibody Antibody, the antibody of virus infection diseases caused can be mitigated by also referring to.Neutralizing antibody is a kind of protection antibody.What the present invention was provided Recombinant mutant PCV-II capsid protein can be with the generation of eliciting protective antibody.
" nonneutralizing antibody " nonneutralizing antibody (non-neutralizing antibody) is to be unable to blocking virus to enter place The antibody of chief cell.
" non-protective antibody " non-protective antibody (nonprotective antibody) is that individual is made without protection Special viral antibody.The antibody for inveigling epitope induction individual to produce is non-protection antibody.
" trick antibody " inveigles antibody and escape antibody to be can be with the term of used interchangeably, with identical implication.At this In invention, it is the PCV for inveigling epitope (escape epitopes) to be induced in individual by pig circular ring virus (PCV) to inveigle antibody (escape antibody) Specific antibody, it belongs to nonneutralizing antibody, falls within non-protective antibody, the effect for not possessing anti-PCV infection, and may interfere with The generation of PCV neutralizing antibodies and protection antibody.In addition, inveigling (escape) antibody to be borrowed by PCV come immune response pair of escaping Its limitation infected.Accordingly, it is capable to induce PCV neutralizing antibodies and protection antibody but do not stimulate the PCV clothing of trick (escape) antibody Glutelin is the antigen of more immune efficacy, is more suitable for the preparation for being used for PCV vaccines.
" PCV2 specific antibodies " is can to recognize, resist with reference to the antibody of PCV2 or its component, including neutralizing antibody, protectiveness Body, nonneutralizing antibody and non-protective antibody.PCV2 specific antibodies can use EUSA (ELISA) and Diagnosis of Sghistosomiasis The methods such as mark (Western blot) are detected.The recombinant mutant PCV-II capsid protein that the present invention is provided can be used to detection PCV2 specific antibodies, and can avoid by the interference of the PCV2CP non-protective antibody for inveigling epitope to induce.
" plasmid vector with biological function " has the plasmid vector (biologically of biological function Functional plasmid or viral vector) be can the foreign gene entrained by eukaryotic cell expression plasmid. By can expressing protein antigen encoding gene be cloned on the plasmid with biological function, the plasmid vector is after individual is injected into Corresponding proteantigen, which can be given expression to, makes individual immunity.This plasmid that can express antigen is referred to as nucleic acid vaccine or DNA vaccination. Recombinant mutant PCV-II capsid protein encoding gene of the present invention can be cloned into the plasmid vector with biological function On expression be made change the nucleic acid vaccine of structure PCV-II capsid protein.
" viral vector with biological function " has the viral vector (biologically of biological function Functional plasmid or viral vector) it is that can express entrained external source base after transfection/infection of eukaryotic cells The virus of cause.By can expressing protein antigen encoding gene be cloned into the viral vector with biological function, the viral vector exists Being injected into after individual transfection/infection cell and can give expression to corresponding proteantigen and make individual immunity.It is this that there is transfection/sense The virus for contaminating eukaryotic activity and energy expressing protein antigen is referred to as live vector, and it can be used as vaccine.This can be sent out Bright described recombinant mutant PCV-II capsid protein encoding gene, which is cloned into the viral vector with biological function, is made table Up to the live vector vaccine for changing structure PCV-II capsid protein.Viral vector with biological function can also be a kind of in itself It is used as the attenuated virus of vaccine, such as vaccine virus attenuation PCV1-2a embedded viruses vaccine [Beach NM, et al.Virus Res.2012Mar；164(1-2)：33-42].It is used as the structure PCV-II capsid protein provided by the present invention that changes and encodes base Because having the virus of the viral vector of biological function to include but is not limited to adenovirus, poxvirus, bacteriophage, baculoviral, pig mouthful Aphtovirus, pig blue-ear disease (porcine reproductive and respiratory syndrome) virus, CSFV, PRV, pig circular ring virus, pig Parvovirus, swine influenza virus and pig parainfluenza virus etc..
" vaccine "：It with attenuation or the causal organism or its component that kill is being used for of being made of antigen that vaccine (vaccine), which is, The biological products of artificial active immunity.Antigen and adjuvant are the main components of vaccine.The purpose of vaccine inoculation is to make individual acquisition Immunity to pathogen and then it is set to be protected when touching corresponding pathogen again.The recombinant mutant pig that the present invention is provided PCV-II capsid protein is antigen, and this antigen can be used for the vaccine for preventing Infection of Porcine circovirus, also can and it is other Pig vaccine use in conjunction.These pigs include but is not limited to following pig transmissible prevention from suffering from the diseases vaccines with vaccine：Pig mouthful hoof Epidemic disease, pig blue-ear disease (porcine reproductive and respiratory syndrome), swine fever, porcine pseudorabies, Infection of Porcine circovirus, pig parvoviral sense Dye, Streptococcus suis, transmissible gastroenteritis of swine, swine enzootic pneumonia, haemophilus parasuis infection, brickpox, swine plague, pig atrophic Rhinitis, transmissible gastroenteritis of swine, pig encephalitis, swine flu, pig cloth Lu Shi diseases, grice diarrhoea, pig parainfluenza virus infection, pig stream Sense, mycoplasma hyopneumoniae infection, hydropsy for baby pigs, Salmonella choleraesuls, pig epidemic diarrhea and swine plague.Vaccine it is immune Effect refers to the activity of its inducing protective immunity response.The immune efficacy of vaccine can also refer to the immune efficacy of antigen in vaccine, Adjuvant can improve the immune efficacy of antigen.
The recombinant mutant PCV-II capsid protein that " pig circular ring virus vaccine " present invention is provided can be with pig circular ring virus epidemic disease Seedling [Beach NM, et al.Virus Res.2012Mar；164(1-2)：33-42] use in conjunction, these vaccines include but not It is limited to PCV2a inactivated vaccines, PCV2a total lengths capsid protein subunit vaccine, PCV2b total lengths capsid protein subunit vaccine, goes out Attenuation PCV1-2a embedded viruses vaccine living, through passing on repeatedly or PCV2b Attenuated Virus Vaccines that genetic modification is obtained, PCV1- 2b embedded viruses vaccine, Plasmid DNA vaccines, PCV2 Cap bacteriophage body display vaccine, the PCV2 clothing for carrying PCV genes Glutelin displaying baculovirus vector vaccine, PCV2 Cap Pseudorabies virus carrier bacterin, PCV2 Cap adenovirus Carrier bacterin and PCV2 Cap bronchus Bao Te bacillus (Bacterium Bordetella bronchiseptica) carrier Vaccine etc..
The recombinant mutant pig circular ring virus 2 virus capsid protein that " adjuvant " present invention is provided can combine with one or more adjuvants Using strengthening the effect of its inducing protective immunity.The thing that adjuvant (adjuvant) is in vaccine and antigen is applied together Matter, the inoculation times of vaccine are reduced with following active (1)；(2) immune duration of vaccine is extended；(3) by exciting intrinsic Immune response promotes humoral immune response and cellullar immunologic response；(4) the cross protection immune response of antigen induction is extended；(5) Strengthen the immune response of weak immune response individual such as aged individual or immunocompromised subject to antigen；(6) consumption of antigen is reduced. Can with the present invention provide recombinant mutant pig circular ring virus 2 virus capsid protein use in conjunction adjuvant [Stanley A.Plotkin, Walter A.Orenstein, Paul A.Offit, Vaccines, Sixth Edition, An imprint of Elsevier Inc.2013, ISBN-13：9781455700905] include but is not limited to：Alum adjuvant (is main by aluminium hydroxide or aluminum phosphate The vaccine adjuvant of composition), AS04 adjuvants [absorption MPL Aluminium phosphate adjuvant (MPL is the Gram-negative bacteria fat through chemical detoxification Polysaccharide)], MF59 adjuvant (a kind of oil-in-water emulsifiers, oil phase therein is squalene), (one kind uses spiny dogfish to AS03 adjuvants Alkene is the oil-water emulsifiers of oil phase), AF03 adjuvants (a kind of oil-in-water emulsifiers for using squalene for oil phase), The adjuvants of Montanide ISA 51 (using mineral oil as the water-in-oil emulsifier of oil phase), Freund's adjuvant, incomplete Freund's adjuvant, disease Malicious corpusculum adjuvant (virosome adjuvant), N- oxidic polyethylene piperazidine derivatives (polyoxidonium) assistant Agent, white-oil adjuvant, MontanideTMISA-206 adjuvants, polylactide co-glycolide, virus (Adenovirus, Vaccinia, fowlpox) carrier adjuvant, BCG vaccine (BCG, bacillus Calmette-Gu é rin) including QS21 be Inner's Saponin, match somebody with somebody including C-type lectin ligands, the CD1d including α-galactosylceramide including TDB Body, AS01 (MPL, QS21, liposomes), AS02 (MPL, QS21, emulsifying agent), AS15 (MPL, QS21, CpG ODN, lipid Body), GLA-SE (GLA, emulsion), IC31 (CpG ODN, cationic polypeptide), CAF01 (TDB, cationic-liposome) and ISCOMs (saponin, phosphatide) [Reed SG, et al.Nat Med.2013Dec；19(12)：1597-608；Melero I, et al.Nat Rev Clin Oncol.2014Sep；11(9)：509-24].The recombinant mutant pig circular ring virus 2 that can be provided with the present invention The adjuvant of virus capsid protein use in conjunction also include pathogen associative mode molecule and its analogies, Toll-like receptor activator, Damage associative mode molecule and its analogies, ring dinucleotides and its analogies, immune stuck point mortifier, costimulation receptor activation Agent and cell factor etc..
" the related model molecule of pathogen "：The recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided can and disease The related model molecule (pathogen-associated molecular patterns, PAMPs) of substance and the like connection Application is closed to strengthen its immune efficacy.PAMPs is the various conservative constituents of microorganism, such as bacterial cell wall component, fungal cell Wall composition and viral nucleic acid etc..Inherent immunity cell passes through pattern recognition receptors (pattern-recognition Receptors, PRRs) recognize PAMPs and be activated.PRR includes Toll-like receptors (TLRs), nucleotide- Binding oligomerization domain (Nod)-, leucine-rich repeat-containing receptors (NLRs), RIG-I-like receptors (RLRs), C-type lectin receptors (CLRs) and AIM-2like receptors；Also intracellular nucleic acid receptor (the intracellular sensors of of intracellular identification nucleic acid are included Nucleic acids), OAS albumen and cGAS [Iwasaki A et al.Nat Immunol.2015Apr；16(4)：343- 53]。
" Toll-like receptor activator "：The recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided can with it is a kind of or A variety of Toll-like receptor (Toll-like receptors, TLRs) activator use in conjunction strengthen its immune efficacy, and performance is anti- Circovirus infection activity.The TLR excitements for the recombinant mutant pig circular ring virus 2 virus capsid protein use in conjunction that can be provided with the present invention Agent includes but is not limited to：Imidazoquinolines class TLR7/TLR8 activators including Imiquimod and R848；Bag Include the TLR7 activators including 852A；TLR8 activators including VTX-2337；Including IMO-2055, CPG 7909, TLR9 activators including MGN1703 and other CpG ODN (deoxy-oligonucleotide containing CpG)；Including BCG vaccine (BCG) TLR2/TLR4 activators；Including OM-174, monophosphoryl lipid A (MPL), aminoalkyl TLR4 activators including glucosamine phosphates and other lipoid A (lipid A) analog；Including viral core TLR9 activators including acid, bacterial nucleic acid；TLR5 activators including bacterial flagellin；Including zymosan TLR2/TLR6 activators；Including Poly I:C (poly IC), viral double-stranded RNA or its analogies TLR3 activators and TLR7/TLR8 activators [the Adams JL et al including viral single stranded RNA or its analogies Nat Rev Drug Discov.2015Sep；14(9)：603-22].
" the related model molecule of damage "：Damage related model molecule (damage-associated molecular Patterns, DAMPs) adjuvant for the recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided can be done.DAMPs is by damaging Hinder cell release, innate immune response own cells composition can be excited.DAMPs can be by the inherent immunities of PRR excitating organisms Response.These DAMP include but is not limited to：Heat shock protein, HMGB1 (high-mobility group box 1), Hyaluronan fragments, glycans, glycoconjugates, ATP (Adenosine5 '-triphosphate), adenylate, Uric acid, S100 albumen, heparin sulfate, Galectins, nucleus DNA, N-formylated peptides, Antimicrobial peptides, mitochondrial DNA and calreticulin [Krysko DV et al.Nat Rev Cancer.2012Dec；12(12)：860-75；Pouwels SD et al.Mucosal Immunol.2014Mar；7(2)： 215-26]。
The recombinant mutant pig circular ring virus 2 that " ring dinucleotides " ring dinucleotides and its analogies can be provided as the present invention The adjuvant of virus capsid protein.Ring dinucleotides (Cyclic dinucleotides, CDNs) [Cell, 2,013 154 (5), 962- 970] bacterium is derived from, can also be synthesized in mammalian cell.Bacterium CDNs includes but is not limited to c-di-GMP (cyclic Di-GMP, cdG), the adenylate of ring two (cyclic di-AMP, cdA) and cyclic adenosine monophosphate-guanylic acid (cyclic AMP-GMP, cAMP-GMP).Bacterium CDN is a class PAMP, can exciting innate immune response.CDN is also may occur in which in mammalian cell, such as Cyclic guanylic acid-adenylate (cyclic guanosine monophosphate-adenosine monophosphate, cGAMP) [Wu J et al.Science.2013Feb 15；339(6121)：826-3] also can exciting innate immune response.
" immune stuck point mortifier "：Immune stuck point mortifier (immune checkpoint inhibitor) can conduct The adjuvant for the recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided.Immune stuck point mortifier is to suppress immune stuck point point Material [the Melero I et al.Nat Rev Cancer.2015Aug of subfunction；15(8)：457-72].Suppress immune stuck point The function of molecule enables the signal of immune cell activation to highlight, thus immunocyte is in lasting state of activation.It is in The CD4 of sustained activation state+T cell can Help B Cells generation antibody, also auxiliary cd8 t cell killing target cell such as virus infection Cell.Therefore, antigen or vaccine can be improved in the immune of individual by maintaining the preparation such as immune mortifier of adding some points of t cell activation state Effect.The immune stuck point molecule that immune stuck point inhibitor suppresses includes but is not limited to CTLA4, PD1, LAG3 (Lymphocyte activation gene 3)、2B4(CD244)、BTLA(B and T lymphocyte attenuator)、TIM3(T cell Membrane protein 3) and A2aR (adenosine A2a receptor) [Pardoll DM.Nat Rev Cancer.2012Mar 22；12(4)：252-64].The immune stuck point mortifier of antibody category of immune stuck point function can be suppressed, including But it is not limited to CTLA-4 antibody, CD-1 antibody and CD-L antibody.
" costimulation receptor activators "：The recombinant mutant pig circular ring virus that co-receptor activator can be provided as the present invention The adjuvant of capsid protein.Costimulation acceptor is acceptor of the expression on immunocyte surface, mediates and exempts from after being activated by activator The transduction of epidemic disease cell activation signal, thus promote immune response of the individual to antigen or vaccine.Costimulation receptor activators are logical Cross the preparation with reference to immune cell activated after costimulation acceptor.Costimulation receptor activation monoclonal antibody (Co- Stimulatory receptor activating monoclonal antibody) it is costimulation receptor activators, it can strengthen The effect of antigen or vaccine.Costimulation acceptor (the Co-stimulatory of this kind of activity monoclonal antibody target Receptor CD137 (41BB), OX40, CD40, GITR, ICOS and CD27 (Glucocorticoid-) are included but is not limited to induced tumour necrosis factor receptor family-related protein)[Melero I et al.Nat Rev Cancer.2015Aug；15(8)：457-72；Sanmamed MF et al.Semin Oncol.2015Aug； 42(4)：640-55].
" cell factor "：The assistant for the recombinant mutant pig circular ring virus 2 virus capsid protein that cell factor can be provided as the present invention Agent.These cell factors include but is not limited to：Interleukin 2 (IL-2), granulocyte colony stimulating factor (G-CSF), grain are thin Born of the same parents-macrophage colony stimulatory factor (granulocyte-macrophage colony-stimulating factor) GM- ) and interferon-' alpha ' CSF.
" vaccine combination "：The recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided can be with being pharmaceutically subjected to Carrier (pharmaceutically acceptable carrier) composition vaccine combination.Restructuring in said composition changes The dosage of structure pig circular ring virus 2 virus capsid protein is immune effective dose (immunologically effective dosages).The vaccine combination can be made into certain formulation, and these formulations include but is not limited to solution, emulsion, lipid Body and freeze-dried powder etc..Adjuvant can be contained in vaccine combination.
The recombinant mutant pig circular ring virus 2 virus capsid protein that " use in conjunction " present invention is provided can be with adjuvant use in conjunction, can With with pig circular ring virus vaccine use in conjunction, vaccine use in conjunction can also be used with pig.Use in conjunction refers to recombinant mutant pig PCV-II capsid protein and adjuvant, pig circular ring virus vaccine and other pigs vaccine, which refer to, is combined into a preparation (vaccine combination Thing) apply together, also refer to recombinant mutant pig circular ring virus 2 virus capsid protein adjuvant, pig circular ring virus vaccine and other pig vaccines Separately application.
" pharmaceutically acceptable carrier "：The recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided can be with materia medica Upper acceptable carrier (pharmaceutically acceptable carrier) composition vaccine combination.Materia medica can connect The carrier (pharmaceutically acceptable carrier) received refers to the filling of one or more solids or liquid Agent, diluent or encapsulating substance.This kind of carrier is adapted to the recombinant mutant pig circular ring virus 2 virus capsid protein application for providing the present invention In individual.The carrier can be it is organic, inorganic, it is natural or synthesis.Pharmaceutically acceptable carrier can be pharmacy Acceptable solvent (aqueous solution and non-aqueous solution), dispersant, suspension, emulsifying agent, pulvis, diluent, liposome, antibacterial Agent, antifungal agent, isotonic preparation, delayed absorption preparation, freeze drying protectant and other suitable restructuring provided with the present invention change Structure pig circular ring virus 2 virus capsid protein is together using the preparation for improving its immune efficacy.The aqueous solution includes but is not limited to water, physiology salt Water, PBS, balanced salt solution and glucose solution.Solvent or dispersant may include water, ethanol, polyalcohol (such as glycerine, Propane diols, polyethylene glycol etc.), the also mixture including being made up of these solvents or dispersant.In order to maintain pharmaceutical composition Mobility can be using the lipid including lecithin.In order that vaccine combination is in preferable graininess and can apply table Face activating agent.In order to there is suitable osmotic pressure, it can add sugared, many including mannitol and sorbierite in vaccine combination First alcohol and sodium chloride etc..In order to extend action time, sustained release agent such as stearate and gelatin can be added in pharmaceutical composition.Breast Agent may include oil-water emulsifiers, water-in-oil emulsifier or W/O/W emulsifying agent.Pharmaceutically acceptable carrier is also wrapped Include pharmaceutically acceptable antioxidant (pharmaceutically-acceptable antioxidants), these antioxidants Including water soluble antioxidant, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, Sodium metabisulfite and sodium sulfite etc.；Oil-soluble inhibitor, such as ascorbyl palmitate, Butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl Gallate and alpha-tocopherol etc.；Metal-chelator, such as citric acid, ethylenediamine tetraacetic Acid (EDTA), sorbitol, tartaric acid and phosphoric acid etc..
" immune effective dose "：The immune effective dose of recombinant mutant pig circular ring virus 2 virus capsid protein provided by the present invention (immunologically effective dosages) is to inducing protective immunity response dosage after individual applications.In epidemic disease Using recombinant mutant pig circular ring virus 2 virus capsid protein using immune effective dose in seedling and vaccine combination.Immune effective dose How many to be decided by the standard that those skilled in the art be known, referring also to other factors, these factors include being not limited to Size, health condition and disease severity of individual etc..The recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided can Single or multiple to be applied to individual, each dosage range can be in 1 μ g to 1000mg.In order to reach preferable effect, this area Person skilled in the art can adjust to the dosage of this recombinant mutant pig circular ring virus 2 virus capsid protein, before its dosage range can be State scope 10 times to 1000 times.
" method of administration "：The recombinant mutant pig circular ring virus 2 virus capsid protein that the present invention is provided application when can using it is parenteral, External application or the method for administration of suction.Parenteral method of administration is included through vein, abdominal cavity, intrathecal, muscle, subcutaneous, intracutaneous and local pouring Fawn on interior injection.
Brief description of the drawings：
Fig. 1：PET28a (+) plasmid map and multiple cloning sites
Fig. 2：The agarose gel electrophoresis of C2 encoding genes
Fig. 3：The SDS-PAGE identifications of recombinant mutant PCV2b capsid proteins (C2) engineering bacteria
Fig. 4：C2 engineering bacterium fermentations obtain the SDS-PAGE analyses of thalline mycoprotein
Fig. 5：Purify C2 SDS-PADE analyses
The viroid sample particle (electric Microscopic observation) that Fig. 6 is assembled into by C2
Immune efficacy of Fig. 7 recombinant mutant PCV2b capsid proteins (C2) in mouse
Immune efficacy of Fig. 8 recombinant mutant PCV2b capsid proteins (C2) in pig
The comparison of antibody is inveigled in the induction of Fig. 9 C2 and D recombinant protein
Figure 10 CβThe PCR identifications of encoding gene segment
Figure 11 pFastBac Dual collection of illustrative plates
Figure 12 recombinant baculovirus Bac-2CβAcquisition
Figure 13 recombinant mutant PCV2b capsid proteins (Cβ) expression identification (SDS-PAGE/Western blot)
Figure 14 recombinant mutant PCV2b capsid proteins (Cβ) the viroid sample particle (electric Microscopic observation) that is assembled into
Figure 15 purification of Recombinant changes structure PCV2b capsid proteins (Cβ) identification (SDS-PAGE)
Figure 16 recombinant mutant PCV2b capsid proteins (Cβ) in the immune efficacy of mouse
Figure 17 CβThe comparison for inveigling antibody is induced with D recombinant proteins
The collection of illustrative plates of Figure 18 pMD18-T＆pMD19-T vector plasmids
Specific implementation method：
The acquisition of PCV2b capsid proteins (CP) encoding gene that embodiment 1 is made up of Escherichia coli preferred codons：
The PCV2b clothing that PCR (PCR) structures are made up of Escherichia coli preferred codons is overlapped using many wheels Glutelin (CP) encoding gene, the protein of the gene code is also referred to as D albumen [Fang M, et al.Intervirology.2015；58(5)：318-23].PCV2b capsid proteins (CP) encoding gene is cloned into carrier T Plasmid (Takara, figure -18).PCV2b capsid proteins (CP) encoding gene has such as sequence table<400>Sequence shown in 1.With DNA sequencing determines the correctness of its sequence.
The acquisition of embodiment 2 recombinant mutant PCV2b capsid proteins (C2) encoding gene：
With PCV2b CP encoding genes (<400>1) it is template, obtaining acquisition using the method for PCR and molecular cloning changes structure PCV2b capsid proteins (C2) encoding gene, C2 encoding genes have such as sequence table<400>Sequence shown in 2.Obtain C2 coding bases The basic skills of cause is：
(1) recombinant mutant PCV2b capsid protein encoding gene A fragments are obtained
With PCV2b capsid proteins (CP) encoding gene (sequence table<400>1) encoding gene is template, is weighed using PCR Group changes structure PCV2b capsid protein encoding gene A fragments.The specific PCR sense primer band Nco I restriction enzyme digestions of use Site (CCATGG), anti-sense primer carries BamH I restriction enzymes restriction enzyme sites (GGATCC).
(2) recombinant mutant PCV2b capsid protein encoding gene B fragments are obtained
With PCV2b capsid proteins (CP) encoding gene (sequence table<400>1) it is template, recombinant mutant is obtained using PCR PCV2b capsid protein encoding gene B fragments, the specific PCR sense primer of use is with Bgl II restriction enzymes digestion position Point (AGATCT), anti-sense primer carries XHo I restriction enzymes restriction enzyme sites (CTCGAG).
(3) recombinant mutant PCV2b capsid proteins (C2) encoding gene is obtained
Structure PCV2b capsid protein encoding gene A fragments (A fragments) will be changed and do 2% agarose gel electrophoresis.Using Beijing ancient cooking vessel The DNA QIAquick Gel Extraction Kits of company of state reclaim A fragments.The A fragments of recovery are connected into carrier T plasmid (Takara, figure -18), obtained The carrier T plasmid for being loaded with A fragments, referred to as T-A must be contained.T-A is transformed into JM109 Escherichia coli (referred to as JM109) (Novagen companies).By conversion product streak inoculation to LB Semi-solid cell culture plates, flat board is inverted (bottom is upward), 37 DEG C of perseverances by lid lid Warm incubator culture 12-14 hours.Positive colony is selected, is expanded after culture, T-A is extracted.
Structure PCV2b capsid protein encoding gene B fragments (abbreviation B fragments) will be changed as stated above to connect into carrier T plasmid (Takara, figure -18), is obtained containing the carrier T plasmid for being loaded with B fragments, referred to as T-B.T-B is transformed into JM109, the positive is selected Clone, expands after culture, extracts T-B.
T-A is digested with Nco I and BamHI, the A fragments with Nco I and BamH cohesive ends are discharged.With Nco I and BamH I digest pET-28a (+) plasmid, reclaim linear plasmid.By the A fragments with Nco I and BamH cohesive ends and through limitation Property restriction endonuclease be connected with Nco I and BamH I digestion pET-28a (+) plasmids (figure -1, Novagen companies of the U.S.), carried There is restructuring pET-28a (+) plasmid (pET-28a (+)-A) for changing structure PCV2b capsid protein encoding gene A fragments.By pET-28a (+)-A is transformed into e. coli bl21 (BL21 (DE3).Streak inoculation is to LB Semi-solid cell culture plates, and flat board is inverted (bottom by lid Upward), 37 DEG C of constant temperature incubator cultures 12-14 hours.Positive colony is selected, is expanded after culture, pET-28a (+)-A plasmids are extracted.
PET28a-A is digested with BamH I and XHo I, the pET28a-A with BamH I and XHo I cohesive ends is reclaimed linear Plasmid.T-B is digested with Bgl2 and XHo I, the B fragments with Bgl2 and XHo I cohesive ends are discharged, B fragments are reclaimed.By this B Fragment is inserted into pET28a-A plasmids with BamH I and XHo I point of contacts, obtains pET28a-A-B recombinant plasmids.pET28a-A-B Recombinant plasmid is that carrying changes structure PCV2b capsid proteins (C2) encoding gene (with such as<400>Sequence shown in 2) pET28a Recombinant plasmid, is named as pET28a-C2.In pET28a-C2, the open reading frame of C2 encoding genes starts from Nco I and cut ATG in point, terminates in the TAA in hexahistine encoding gene downstream, common 729bp, what coding was made up of 242 amino acid residues Recombinant mutant PCV2b capsid proteins, recombinant mutant PCV2b capsid proteins are referred to as C2.C2 has such as sequence<400>Shown in 3 Amino acid sequence, be made up of 242 amino acid residues, molecular weight is about 28.64KD, isoelectric point is about 10.55.C2 is free of The trick epitope of PCV2b capsid proteins, the trick epitope induces epitope by a protection antibody of PCV2b capsid proteins and substituted. The recombinant mutant PCV2b capsid proteins (C2) of C2 encoding genes coding have such as sequence table<400>Amino sequence shown in 3.
PET28a-C2 is transformed into BL21 Escherichia coli (DE3) (Novagen), conversion product streak inoculation to LB half is solid Body culture plate, lid lid, flat board is inverted (bottom is upward), 37 DEG C of constant temperature incubator cultures 12-14 hours.Positive colony is selected, is extracted pET-28a-C2.PET28a-C2 is identified that digestion condition is as follows with NcoI and XhoI digestion：
After mixing, incubated 100 minutes in 37 DEG C.
Agarose gel electrophoresis (figure -2) is done to digestion product.As a result show：Can be from pET28a-C2 with NcoI and XhoI In discharge C2 encoding genes (about 729bp).
Using T7 promoter primers the C2 encoding genes in pET28a-C2 are carried out DNA sequencing [raw work bioengineering (on Sea) limited company], as a result show：Sequence (the sequence table of C2 encoding genes<400>2) it is consistent with design.
The expression of the recombinant mutant PCV2b capsid proteins (C2) of embodiment 3：
The pET28a-C2 identified through NcoI and XhoI digestions conversion BL21 Escherichia coli (DE3) (Novagen) are prepared into table Up to C2 (sequence tables<400>3) engineering bacteria freeze-drying lactobacillus, specific method is as follows：
30mlLB culture mediums (tryptone 1%, yeast extract powder 0.5%, sodium chloride 1%) are taken to the clean tapers of 100ml In bottle, agar powder 0.45g is added, is mixed, breathable sealing is fastened with cotton rope, autoclaving.In superclean bench, treat After conical flask temperature reduction (the firm non-scald on hand back of the body of taper bottle wall), 15 μ l 100mg/ml kanamycins (Kan) (Kan is added immediately The μ g/ml of final concentration 50), it is rapid to mix, in the 2 high culture dish pressed through that liquid is divided equally, LB Semi-solid cell culture plates are made. PET28a-C2 is transformed into BL21 Escherichia coli according to a conventional method.By transformed bacteria solution streak inoculation to LB Semi-solid cell culture plates, lid Lid, flat board is inverted (bottom is upward), 37 DEG C of constant temperature incubator cultures 12-14 hours.
The independent colony inoculation in 3 line of LB Semi-solid cell cultures plate is drawn respectively with the suction pipe of sterilizing to bore to these three In shape bottle (being designated as A, B, C).Respectively culture medium containing 53mlLB (adds 30 μ l kanamycins (100mg/ml) in bottle.It is put into 37 DEG C In constant-temperature table, setting speed is 200rpm, is cultivated 3--5 hours.When culture medium OD600 values reach 0.6-1.0, start to prepare Freeze-dried vaccine is simultaneously identified it.In super-clean bench, from A, B, C shaking flask, 200 μ l bacterium solutions are drawn extremely with sterile sample injector head respectively In 3 1.5ml EP pipes, pre-induction sample is used as；Separately 1ml bacterium solutions are drawn to the 20ml glass of 3 sterilizings with sterile sample injector head In glass test tube, 0.5 μ l 1M IPTG are added, are cultivated 3 hours with 200rpm in 37 DEG C of constant-temperature tables.
By the EP pipes centrifugation 1min (11000rpm) containing bacteria liquid sample before induction, inhaled with sample injector and abandon supernatant, steamed with 20 μ l Distilled water dissolves sediment, is blown and beaten and mixed with sample injector, adds 20 μ 2 × sample-loading buffers of l, and this is bacterium solution SDS PAGE before induction Sample (before A, B, C induction).
Take 20 μ l to induce 3 hours bacterium solutions into 3 1.5ml EP pipes, add 20 μ 2 × sample-loading buffers of l, this is induction Bacterium solution SDS PAGE samples afterwards (after A, B, C induction).
Before electrophoresis, to bacterium solution SDS PAGE samples do and boil processing before induction, after induction：Sample cell is inserted on cursory (mouth of pipe should be higher by=face at least 1cm), is placed in cursory in boiling water, boils 5min.Sample cell is centrifuged into 5 points of (11000rpm) Clock, takes 10 μ l supernatant loadings, does SDS PAGE analyses (figure -3).
By remaining bacterium solution [(A, B, C) each about 40ml], centrifugation (using Kubo field centrifuge), 10 minutes, is abandoned by 3000 turns Clearly.Put on ice, 20% skimmed milk 1.5ml, 10% sodium glutamate 1.5ml is separately added into precipitation, mix, dispense paramount press through 3ml cillin bottles in, every bottle of 0.6ml, totally 15 bottles (each three bottles of A, B, C), the lid lid blow vent of lid (ensure breathe freely).
By cillin bottle (A1-5, B1-5, C1-5) to -70 DEG C of pre-freezes, 12 hours.The cillin bottle of pre-freeze is placed in rapidly lyophilized In machine, freeze 24 hours.Capping, -20 DEG C of labellings, storage.
Glycerine strain is prepared from C2 engineering strains, glycerine strain fermented and cultured is expressed into C2.Fermentation tank of the fermentation at 10 liters It is middle to carry out.In the OD of zymocyte liquid600Add IPTG induced expressions during up to 70, the temperature of Fiber differentiation is 37 DEG C.Induction takes before starting Zymocyte liquid 1ml.20 μ l bacterium solutions, plus 20 μ l 2 × SDS-PAGE sample loading buffers are taken out, are mixed, thalline before induction is prepared Lysate (is used for SDS-PAGE electrophoresis), 4 DEG C of preservations.Induction 2 hours after, take induction after bacterium solution and centrifuge (8 DEG C, 3500rpm, 10 minutes) collect thalline.The thalline of collection is in -70 DEG C of preservations.By bacterium solution after induction do 16 times dilution after, take 20 μ l plus 2 × SDS-PAGE sample loading buffers are mixed, and are mixed, and this is (rear) sample after induction.
SDS-PAGE analysis shows, C2 engineering bacteria high level expressions C2 albumen (figure -4).
The purifying and assembling of the recombinant mutant PCV2b capsid proteins (C2) of embodiment 4：
The C2 engineering bacterias for acquisition of fermenting are placed in 500ml stainless steel cups, melted on ice, 200ml is added and splits bacterium buffer solution (4 DEG C), are stirred with agitator, and regulation electric mixer is maintained at the slow-speed of revolution, stirs above-mentioned thalline mixture 15 minutes, makes thalline It is uniformly dispersed, without block thalline, places on ice standby.Thalline is cracked with high pressure homogenizer (950-1050bar), 10 is split and follows Ring.Lysate is moved into 50ml centrifuge tubes respectively, centrifuged (11000r/min, 4 DEG C, 20 minutes).After centrifugation, leave and take Clearly, move into 500ml vials, upper prop is purified immediately.C2 is purified using Sepharose 4B nickel affinity chromatographies.With 4 cylinders The NiSO46H of product2Nickel ion is adsorbed onto on Sepharose 4B by O solution (100.0mmol/L), flow velocity 1.0ml/min. Sepharose 4B nickel affinity chromatographies are balanced with level pad 1 (Tris 0.02M, NaCl 0.5M, imidazoles 0.5M, pH8.0) Post (abbreviation nickel post), with 4 column volumes, flow velocity 1.0ml/min.Then with level pad 2 (Tris 0.02M, NaCl 0.5M, imidazoles 0.01M, 0.01M beta -mercaptoethanol, 5% glycerine, 0.05%Tween 80, pH8.0) balance nickel post.With 4 posts Volume, flow velocity 1.0ml/min.The C2 engineering bacteria lysates supernatant being collected by centrifugation is diluted 1 times with 2 buffer solutions of balance, started permanent Flow pump loading, flow velocity 1ml/min.With lavation buffer solution (Tris 0.02M, NaCl 0.5M, imidazoles 0.04M, 0.01M β-sulfydryl Ethanol, 5% glycerine, 0.05%Tween 80, pH8.0) washing is stayed overnight, flow velocity is 0.3ml/min.With elution buffer (Tris 0.02M, NaCl 0.5M, imidazoles 0.5M, 0.05M beta -mercaptoethanol, 5% glycerine, 0.05%Tween 80, pH8.0) elution C2. The C2 of purifying purity, molecular weight and content (figure -5) is detected for SDS-PAGE.
By the C2 of purifying under the conditions of 4 DEG C, using assembles concentration (Na2HPO450.0mM, NaH2PO450.0mM, NaCl 0.50M, Tween80 0.03%, EDTANa2.2H2O, pH=6.5) dialyse 10 hours.After dialysis, C2 has been assembled into virus Sample particle (figure -6).
Immune efficacy of the recombinant mutant PCV2b capsid proteins (C2) of embodiment 5 in mouse：
Using C2 vaccine immune mouses.Serum is separated after immune, ELISA is with inactivation PCV-II (PCV2b) wrapper sheet Detect antibody.
5.1 immune mouse
5.1.1 mouse
ICR mouse (medical board animal housing of Jilin University), female, body weight is 17-18 grams.
5.1.2 antigen
C2 albumen
5.1.3 adjuvant
Oil-in-water (white oil) emulsifying agent
5.1.4 the preparation of vaccine
It is made of oil-in-water (white oil) emulsifier C2 in C2 vaccines, every 100 μ l vaccines and contains 3 μ g C2.
5.1.5 mouse is immunized
Mouse is randomly divided into C2 vaccine groups and PBS groups, every group 11.It is each immune 1 time at the 0th day and the 14th day, method It is that 100 μ l C2 vaccines or 100 μ l PBS are injected in the intramuscular injection of right hind single-point.Two groups of mouse sub-cage rearings.Taken a blood sample before inoculation, Determine that mouse is negative for PCV2b specific antibodies.
5.1.6 taken a blood sample after immune
At 2 times it is immune after 14 days from mouse tail vein blood sampling, the μ l of blood sampling volume >=100.By the whole blood of collection, (1.5mlEP is managed In) room temperature place 30 minutes.11000rpm is centrifuged 15 minutes, collects serum, packing, -20 DEG C of preservations.
PCV-II (PCV2b) detection of specific antibody in 5.2 mice serums
The PCV 2b specific antibodies in serum are detected with enzyme-linked immunosorbent assay (ELISA).
5.2.1 envelope antigen
Inactivate PCV-II (PCV2b) (Tianjin Ruipu Biotechnology Co., Ltd, TCID50/ml=7.0).
5.2.2 test equipment
Enzyme mark strip (combined type ELISA Plate), 0.5mlEP pipes, 1.5mlEP pipes, sample injector head, pipettor, multichannel pipettor, Plate (diameter 9cm) and graduated glass bottle etc..
5.2.3 reagent
Sodium carbonate (Chemical Reagent Co., Ltd., Sinopharm Group), NaCl (Chemical Reagent Co., Ltd., Sinopharm Group), KCl (Beijing Chemical Plant), Na2HPO4·12H2O (Chemical Reagent Co., Ltd., Sinopharm Group), KH2PO4(Tianjin big chemical reagent forever Development centre), polysorbas20 (Tianjin recovery fine chemistry industry research institute), skimmed milk power (Biotopped), citric acid (traditional Chinese medicines collection Chemical reagent Co., Ltd of group), OPD (Shanghai San Pu Chemical Co., Ltd.s), 30%H2O2(Beijing Chemical Plant), the concentrated sulfuric acid (Beijing Chemical plant) and glutaraldehyde (Tianjin good fortune morning chemical reagent factory).
5.2.4 experimental procedure
(1) with inactivation PCV 2b (1: 50 dilution) coated elisa plate, coating buffer is PBS, 100 μ l/ containing 0.8% glutaraldehyde Hole, 4 DEG C overnight；
(2) with containing 5% skimmed milk power cleaning solution close, 200 μ l/ holes, 37 DEG C 2 hours.Cleaning solution is to be told containing 0.05% PBS (7.3mol/L NaCl, 3mmol/L KCl, the 10mmol/L Na of temperature 202HPO4·12H2O, 17.6mmol/L KH2PO4)；
(3) wash, dry liquid, washed with cleaning solution, 300 μ l/ holes, room temperature 3min, repeated washing is twice；
(4) mice serum that addition is diluted with confining liquid 1: 100,100 μ l/ holes, 4 DEG C are overnight；
(5) inhale and abandon liquid, wash, cleaning solution and method are ibid；
(6) enzyme-added labeling antibody.Liquid is dried, is washed with cleaning solution, 300 μ l/ holes, room temperature 3min, liquid is dried, repetition is washed Wash twice.Add (sheep anti-Mouse) IgG, 100 μ l/ that the horseradish peroxidase (HRP) diluted with confining liquid 1: 2500 is marked Hole, 37 DEG C 1 hour；
(7) develop the color.Liquid is dried, is washed with cleaning solution, 300 μ l/ holes, room temperature 3min, liquid, repeated washing two is dried It is secondary.Add the μ l/ holes of substrate solution 100,37 DEG C of lucifuges colour developing 15min.The compound method of 10ml substrate solutions (i.e. with i.e. with) is：Take The liquid of 1ml 10X first and second, plus the μ g of distilled water 9ml, OPD 10 (fully dissolving) and 15 μ l 30%H2O2.The liquid of 10X first and second is by 10X solution As (0.914Mol/L citric acids) and 10X second liquid (2Mol/L Na2HPO4.12H2O 47.2 volumes) are pressed：50 volume ratios are made into；
(8) enzyme chromogenic reaction, 50ul/ holes are terminated with terminate liquid (sulfuric acid 2mmol/L)；
(9) OD values are surveyed with ELIASA (492nm) and taken pictures.
5.3 result
C2 can induce PCV2b specific antibodies (figure -7), P ＜ 0.01 in mouse.This explanation recombinant mutant PCV2b capsid Albumen can be used for the preparation that resisting porcine circovirus infects vaccine as antigen, also illustrate recombinant mutant PCV2b capsid proteins Antigen can be used as to detect pig circular ring virus specific antibody.
Immune efficacy of the recombinant mutant PCV2b capsid proteins (C2) of embodiment 6 in pig：
Using C2 vaccine immunity pigs.Serum is separated after immune, with the type ELISA antibody assay kits of pig annulus before section 2 Detection antibody judges the effect of vaccine.It is parallel that vaccine is done using the auspicious general appropriate vaccine of the set of data and the peaceful progress identical experiment of section's previous conviction circle Effect compares.Experiment is completed in Tianjin Ruipu Biotechnology Co., Ltd.
6.1 immune swine
6.1.1 pig
The susceptible piglet of 14-21 ages in days health, PCV2 negative antibodies, PCV2 antigen negatives.
6.1.2 vaccine
The auspicious appropriate vaccine of the general set of data (potency 107 25TCID50/ ml), section previous conviction circle is peaceful, C2 albumen (sequence tables<400>3) vaccine (with amount g/ parts of 100 μ, being prepared in the ratio of water-oil factor 3: 1 with white oil emulsifying agent)
6.1.3 it is immune
Musculi colli vaccinates 2ml vaccines.
6.1.4 observed and recorded
Record swinery health status, situation of growing, compare and be inoculated with the pigs of different vaccines and grow uniformity etc..
6.1.5 blood sampling
The 6th week collection serum after immune.
6.2 detection of specific antibody
Result judgement is carried out using the type ELISA antibody assay kits of pig annulus before section 2 (positive：OD450Value ＞ 0.43；It is cloudy Property：OD450Value ＜ 0.25).
6.3 result
As shown in figure -8,6th week after immune, C2 albumen (sequence tables<400>3) the PCV-II specificity that vaccine is induced Antibody is higher than the PCV-II specificity that PCV-II specific antibody, the section of the being significantly higher than circle that the appropriate vaccine of the set of data is induced rather are induced Antibody.In addition, the production performance that 6th week observes after immune is shown, the auspicious general appropriate vaccine of the set of data and inoculation C2 albumen epidemic diseases are inoculated with The pig growth of seedling group is uniform, hair is smooth, the state of mind is good；The peaceful group pig of inoculation section circle shows slightly thin and weak, and the growth uniformity is poor.This Illustrate that recombinant mutant PCV2b capsid proteins can be used for the preparation that resisting porcine circovirus infects vaccine as antigen, also illustrate Recombinant mutant PCV2b capsid proteins can be used as antigen to detect pig circular ring virus specific antibody.
The comparison of antibody is inveigled in the induction of the C2 and D recombinant proteins of embodiment 7：
Using C2 and D recombinant protein antigen vaccine immune mouses.Serum is separated after immune, PCV2 Cap is used (169-180) oligopeptides wrapper sheet does ELISA detection antibody.
7.1 immune mouse
7.1.1 mouse
ICR mouse (medical board animal housing of Jilin University), female, body weight is 17-18 grams.
7.1.2 antigen
D albumen (abbreviation D) is PCV2b capsid proteins [the Fang M, et using Bacillus coli expression al.Intervirology.2015；58(5)：318-23], by such as sequence table<400>DNA encoding shown in 1.D albumen can be assembled Into virus-like particle (Virus like particls, VLPs).Detected using SDS-PAGE, D albumen (D) is shown as molecular weight For 28.9KD zone.(the 40000 times of amplifications) observation under Electronic Speculum, the VLP of D albumen formation size is about 17nM, the VLP and circle Circovirus virus particle is morphologically about the same.D albumen is the restructuring PCV2b capsid proteins of total length, capsid protein containing PCV-II Escape epitopes [CP (169-180)].
C2 albumen (sequence tables<400>3), abbreviation C2.
7.1.3 adjuvant
Oil-in-water (white oil) emulsifying agent
7.1.4 the preparation of vaccine
With oil-in-water (white oil) emulsifier D or C2, it is made in D protein vaccines and C2 vaccines, every 100 μ l vaccines and contains 2.5 μ g antigens.
7.1.5 mouse is immunized
Initial immunity was carried out to mouse in the 0th day, method is 100 μ l D protein vaccines of injection or C2 vaccines, injection site It is right hind muscle, single-point injection.Booster immunization is carried out to mouse in the 14th day, method is ibid.
7.1.6 taken a blood sample before immune
In initial immunity the previous day, immune serum is treated in collection.Taken a blood sample through mouse tail vein, the μ l of blood sampling volume >=100.Will Whole blood (in 1.5mlEP pipes) room temperature of collection is placed 30 minutes.11000rpm is centrifuged 15 minutes, collects serum, packing, -20 DEG C Preserve.
7.1.7. taken a blood sample after immune
14 days after exempting from 1,2 exempt from after 14,28,42 days, adopt mouse, separation serum, method is as taken a blood sample (8.1.6) before immune.
7.2 immune serum antibody tests
Specific antibody in serum is detected using ELISA
7.2.1 envelope antigen
Using PCV2 Cap (169-180) oligopeptides [also referred to as CP (169-180)] do envelope antigen [Trible, B.R., Et al.Journal of virology, 2012,86,13508-13514；Trible BR, et al.2011.Clin.Vaccine Immunol.18：749-757；Trible BR, et al.2012.Vaccine 30：4079- 4085]。
7.2.2 test equipment
Enzyme mark strip (combined type ELISA Plate), 0.5mlEP pipes, 1.5mlEP pipes, sample injector head, pipettor, multichannel pipettor, Plate (diameter 9cm), graduated glass bottle.
7.2.3 reagent
Sodium carbonate (Chemical Reagent Co., Ltd., Sinopharm Group), NaCl (Chemical Reagent Co., Ltd., Sinopharm Group), KCl (Beijing Chemical Plant), Na2HPO4·12H2O (Chemical Reagent Co., Ltd., Sinopharm Group), KH2PO4(Tianjin big chemistry examination forever Agent development centre), polysorbas20 (Tianjin recovery fine chemistry industry research institute), skimmed milk power (Biotopped), citric acid (traditional Chinese medicines Chemical reagent Co., Ltd of group), OPD (Shanghai San Pu Chemical Co., Ltd.s), 30%H2O2(Beijing Chemical Plant), the concentrated sulfuric acid (north Capital chemical plant) and glutaraldehyde (Tianjin good fortune morning chemical reagent factory).
7.2.4ELISA basic step
(1) with CP (169-180) (4 μ g/ml) in carbonate buffer solution (15mmol/L sodium carbonate and 35mmol/L bicarbonates Sodium water solution) 96 hole elisa Plates of middle coating, 100 μ l/ holes, 4 DEG C are coated with overnight.
(2) closed with the cleaning solution containing 5% skimmed milk power, 150 μ l/ holes, 37 DEG C of 1 hour cleaning solutions are containing 0.05% tween 20 PBS (7.3mol/L NaCl, 3mmol/L KCl, 10mmol/L Na2HPO4·12H2O, 17.6mmol/LKH2PO4)；
(3) wash, dry liquid, washed with cleaning solution, 300 μ l/ holes, room temperature 3min, repeated washing is twice；
(4) mice serum that addition is diluted with confining liquid 1: 10000,100 μ l/ holes, 4 DEG C are overnight；
(5) inhale and abandon liquid, wash, cleaning solution and method are ibid；
(6) enzyme-added labeling antibody, be the same as Example 5；
(7) develop the color.Be the same as Example 5；
(8) enzyme chromogenic reaction, 50ul/ holes are terminated with terminate liquid (sulfuric acid 2mmol/L)；
(9) OD values are surveyed with ELIASA (492nm).
7.3 result
As shown in figure -9, C2 (sequence table different with D albumen<400>3) it can not induce and escape for PCV-II capsid protein The antibody for epitope of escaping.This explanation, C2 can because avoid inducing pig circular ring virus escape antibody and as more effective antigen by with In the vaccine for preparing resisting porcine circovirus infection.
The acquisition of the PCV2b capsid protein encoding genes of embodiment 8：
Amplified using PCR (PCR) methods from infection PCV2b pig lymph node cells and PCV2b total length capsids The encoding gene of albumen (CP), the albumen of the gene code is referred to as P albumen, and the gene is also referred to as P protein coding genes.P Protein coding gene is cloned into carrier T plasmid (Takara, figure -18).Clone has the T- vector plasmids of P protein coding genes (T-P) it is stored in JM109 Host Strains.P protein coding genes have such as sequence table<400>Nucleotide sequence shown in 4.
The recombinant mutant PCV2b capsid proteins (C of embodiment 9β) encoding gene acquisition：
Using P protein coding genes as template, obtained using the method for PCR and molecular cloning and change structure PCV2b capsid proteins (Cβ) encoding gene, CβEncoding gene has such as sequence table<400>Sequence shown in 5.
By CβEncoding gene is cloned in carrier T plasmid (Takara, figure -18), obtains and carries CβThe restructuring T of encoding gene is carried Constitution grain (T-Cβ), by T-CβDigestion is transformed into JM109 cells, obtains clone bacterium.With 5 ' primers (AGATCTGTCGACAACAAGCCGCCAACATGACGTAT) and 3 ' primers (ACGGCCAAGCTTTCACTTAGGGTTAA), with T-CβPCR is for template, the product of amplification shows the fragment (Figure 10) that length is 743bp, the length in agarose gel electrophoresis With it is expected consistent.
With M13+ (- 47) (AGGGTTTTCCCAGTCACG) be sequencing primer to T-CβIn CβEncoding gene does DNA surveys Sequence, measured sequence with it is expected that it is completely the same.
With T-CβFor template, using 5 ' primer (AGATCTGTCGACAATGACGTAT) cut containing SalI Point (GTCGAC) and Kozak sequences () and 3 ' primers (ACGGCCAAGCTTTCACTTAGGGTTAA) contain Hind III point of contacts (AAGCTT) be PCR obtain both sides with SalI point of contacts (GTCGAC) and Hind III point of contacts (AAGCTT) CβEncoding gene (SalI-Cβ-Hind III)。
With T-CβFor template, using using 5 ' primers (CTCGAGAACAAGCCGCCAACATGACGTAT) and 3 ' primers (ACGGCCGGTACCTCACTTAGGGTTAA) it is PCR and obtains both sides band Xho I (CTCGAG) and Kpn I restriction enzyme digestions The C of point (GGTACC)βEncoding gene (Xho I-Cβ-Kpn I)。
The acquisition effect of embodiment 10, restructuring donor plasmid pFastBac Dual-2C β：
By SalI-Cβ- Hind III are cloned into carrier T plasmid (Takara, figure -18), obtain and carry SalI-Cβ-Hind The restructuring carrier T plasmid (T-SalI-C of III genesβ-Hind III).By T-SalI-Cβ- Hind III are transformed into JM109 cells Middle amplification, extracts T-SalI-Cβ-Hind III.T-SalI-C is digested with Sal I and Hind IIIβ- Hind III, obtain both sides C with Sal I and Hind III cohesive endsβEncoding gene.With Sal I and Hind III digestion pFastBac Dual (figure -11) obtains the pFastBac Dual with Sal I and Hind III cohesive ends of linearisation.pFastBac Dual (Invitrogen) it is a kind of transmission matter containing polyhedrin (PH) promoter (abbreviation PH) and p10 promoters (abbreviation p10) Grain [Yu Yongli microbiology immunology be in progress, in August, 2015 volume 43 the 4th phase, 1-15], can in Escherichia coli by PH and The genomic DNA of gene (foreign gene) and p10 downstream and gene (foreign gene) swivel base downstream to baculoviral On.It can be identical or different to be cloned into the foreign gene in pFastBac Dual PH and p10 downstreams.At this In invention, in order to improve expression quantity, by same CβEncoding gene is cloned under pFastBac Dual PH and p10 respectively Trip.Specific practice is：Both sides are carried to the C of Sal I and Hind III cohesive endsβEncoding gene is connected into pFastBac The downstream of Dual PH promoters (figure -11), obtains PH-Cβ-pFastBac Dual(PH-Cβ).By Xho I-Cβ- Kpn I are cloned Enter carrier T plasmid (Takara, figure -18) and obtain carrying Xho I-CβCarrier T plasmid (the T Xho I-C of-Kpn I genesβ-Kpn I), by T Xho I-Cβ- Kpn I are transformed into JM109 cells and expanded, and extract T-Xho I-Cβ-Kpn I.With Xho I and Kpn I Digest T-Xho I-Cβ- Kpn I obtain the C that both sides carry Xho I and Kpn I cohesive endsβEncoding gene.With Xho I and Kpn I digests PH-Cβ-pFastBac Dual(PH-Cβ), obtain the PH-C with Xho I and Kpn I cohesive ends of linearisationβ- pFastBac Dual(PH-Cβ).Both sides are carried to the C of Xho I and Kpn I cohesive endsβEncoding gene is connected into PH-Cβ- pFastBac Dual(PH-Cβ) P10 promoters downstream (figure -11), obtain P10-Cβ-PH-C β- pFastBac Dual carriers (pFastBac Dual-2Cβ)。pFastBac Dual-2CβAs carry CβThe transmission plasmid of encoding gene.Reflected through DNA sequencing It is fixed, CβEncoding gene has correctly been cloned into PH and p10 downstream.CβEncoding gene has such as sequence table<400>Shown in 5 Nucleotide sequence.
Embodiment 11, recombinant baculovirus Bac-2C β acquisition and CβExpression：
By pFastBac Dual-2CβConvert to DH10bac competent cells (Invitrogen).DH10bac competence Cell is the Escherichia coli for carrying Bacmid and helper plasmid.[Yu Yongli microbiology immunology is in progress Bacmid, 2015 8 Month volume 43 the 4th phase, 1-15] be assembled with bacterial artificial chromosome (Bacterial artificial chromosomes, BACs baculovirus DNA (BV DNA)).Due to BACs presence, Bacmid can be maintained in Escherichia coli, and can be with big The growth of enterobacteria and expand.For bacterium, Bacmid is " Large plasmid ".There is Bacmid, and have in Bacmid over-assembles Bacterium Tn7 transposons, this enables foreign gene restructuring to be completed to the process of baculoviral (BV) in bacterium.Helper plasmid is compiled Code transposase, its transposase encoded can will pass on the Expression element of foreign gene-carrying on plasmid by the Tn swivel bases of its both sides Sub- left and right " arm " swivel base enters Bacmid.In DH10bac competent cells (Invitrogen), pFastBac Dual-2CβIn CβGene expression element (Expression cassettes) and Bacmid there occurs that swivel base is recombinated, and generate restructuring BV (Bacmid-2Cβ)。Bacmid-2CβIt is that there is transfection/infective restructuring BV DNA, the C of carryingβGene expression element is main C by Ph promoters and P10 promoters and downstreamβEncoding gene is constituted.Using containing anti-gentamicin semisolid culturemedium pair Contain Bacmid-2CβEscherichia coli carry out blue and white screening [Yu Yongli microbiology immunology be in progress, August the 43rd in 2015 Roll up the 4th phase, 1-15].Picking picking white single bacterium colony (figure -12), amplification cultivation extracts Bacmid-2Cβ。
Use Bacmid-2CβThe Sf9 cells of transfection, infect Sf9 cells with baculoviral (Baculovirus) and do not turn/feel It is control to contaminate Sf9 cells.At the 3rd day, Bacmid-2C is transfectedβAnd infection baculoviral Sf9 cells occur it is obvious thin Born of the same parents' lesion (figure -12), points out Bacmid-2CβBeing assembled into swivel base in Sf9 cells has CβThe restructuring of gene expression element is shaft-like Virus (Bac-2Cβ), and Bac-2CβThe massive duplication in Sf9 cells.At the 8th day, transfect Bacmid-2C's ' and infect bar The Sf9 cells almost all cracking (figure -12) of shape virus.Take Bacmid-2CβThe cells and supernatant after the 3rd day is transfected, this For first generation Bac-2Cβ(Bac-2Cβ-1).4 DEG C of preservations of packing.Collect Bacmid-2C simultaneouslyβTransfectional cell is precipitated for CβEgg The identification (figure -13) expressed in vain.
Use Bac-2Cβ- 1 infection Sf9 cells, at the 5th day, there is obvious lesion in cell, collects supernatant, this is the second generation Bac-2Cβ(Bac-2C β- 2) 4 DEG C of preservations, are dispensed, while collecting cell precipitation (Bac-2Cβ- 2 cell precipitations) it is used for CβTable Up to identification (figure -13).Use Bac-2Cβ- 2 infection Sf9 cells, at the 5th day, there are obvious lesions in cell, collects supernatant, This is third generation Bac-2Cβ(Bac-2Cβ- 3), while collecting cell precipitation (Bac-2Cβ- 3 cell precipitations) it is used for CβExpression mirror Fixed (figure -13).To Bac-2Cβ- 1, Bac-2Cβ- 2 and Bac-2Cβ- 3 have also carried out PCR identifications, it is determined that CβGene expression member The presence of part.
By Bac-2Cβ- 1, Bac-2Cβ- 2 and Bac-2CβSDS-PAGE electrophoresis is done in the cracking of -3 cell precipitation sample-loading buffers With Western blot analyses.It is (big with P albumen (the PCV2b capsid proteins of insect baculovirus expression system expression), D albumen The PCV2b capsid proteins of enterobacteria expression system expression) [FangM, et al.Intervirology.2015；58(5)：318- 23] as control.SDS-PAGE results are shown, in Bac-2Cβ- 1, Bac-2Cβ- 2 and Bac-2CβExpressed in -3 cells point The albumen that sub- amount is about 27.7KD, molecular size range is with being expected unanimously.Western blot result shows that these albumen can By D protein immunizations guinea pig serum (1: 100 dilution) identification.These results (Figure 13) show, have obtained Bac-2Cβ, Bac-2Cβ Sf9 cells can be infected, and express Cβ。CβWith such as sequence table<400>Amino acid sequence shown in 6.
Use Bac-2Cβ- 3 infection Sf9 cells, collect cell after 3 days, the cell of collection are suspended from into assembles concentration [(Na2HPO4· 12H2O (0.05M), NaH2PO4·2H2O (0.05M), NaCl (0.5M), Tween80 (0.03%), disodium ethylene diamine tetraacetate (0.001M)] in, ultrasound (200W, works 20 times, each 5s) cell lysis collects supernatant, (40,000 times put in Electronic Speculum after centrifugation Observed under greatly), it is seen that by CβThe particle of composition, the diameter of particle is about 20nm (figure -14).This explanation, can be assembled into class VLP Particle.
The recombinant mutant PCV2b capsid proteins (C of embodiment 12β) in the immune efficacy of mouse：
Using CβThe vaccine immune mouse being made as antigen.The annulus disease in serum, detection serum is separated after immune Malicious specific antibody.
12.1 immune mouse
12.1.1 mouse
ICR mouse (medical board animal housing of Jilin University), female, body weight is 17-18 grams.
12.1.2 antigen
Use Bac-2Cβ- 3 infection Sf9 cells, collect cell after 3 days, the cell of collection are suspended from into assembles concentration [(Na2HPO4· 12H2O (0.05M), NaH2PO4·2H2O (0.05M), NaCl (0.5M), Tween80 (0.03%), disodium ethylene diamine tetraacetate (0.001M)] in, using high pressure homogenizer cell lysis (700ba, 4 circulations) ultrasound.(4000 turns, 5 minutes) collections of centrifugation Supernatant.＞ containing purity 85% C in supernatantβAlbumen (figure -15).Use this CβAlbumen (sequence table<400>6) antigen immune is done small Mouse.
13.1.3 adjuvant
Oil-in-water (white oil) emulsifying agent
13.1.4 the preparation of vaccine
With oil-in-water (white oil) emulsifier CβC is madeβContain 3 μ g C in vaccine, every 100 μ l vaccinesβ。
13.1.5 immune mouse
Mouse is randomly divided into CβVaccine group and PBS groups, every group 11.It is each immune 1 time at the 0th day and the 14th day, method It is that 100 μ l C2 vaccines or 100 μ l PBS are injected in the intramuscular injection of right hind single-point.Two groups of mouse sub-cage rearings.Taken a blood sample before inoculation, Determine that mouse is negative for PCV2b specific antibodies.
13.1.6 taken a blood sample after being immunized
At 2 times it is immune after 14 days from mouse tail vein blood sampling, the μ l of blood sampling volume >=100.By the whole blood of collection, (1.5mlEP is managed In) room temperature place 30 minutes.11000rpm is centrifuged 15 minutes, collects serum, packing, -20 DEG C of preservations.
PCV-II (PCV2b) detection of specific antibody in 13.2 mice serums
The PCV 2b specific antibodies in serum are detected with enzyme-linked immunosorbent assay (ELISA).
13.2.1 envelope antigen
Inactivate PCV-II (PCV2b) (Tianjin Ruipu Biotechnology Co., Ltd, TCID50/ml=7.0).
13.2.2 test equipment
Enzyme mark strip (combined type ELISA Plate), 0.5mlEP pipes, 1.5mlEP pipes, sample injector head, pipettor, multichannel pipettor, Plate (diameter 9cm) and graduated glass bottle etc..
13.2.3 reagent
Sodium carbonate (Chemical Reagent Co., Ltd., Sinopharm Group), NaCl (Chemical Reagent Co., Ltd., Sinopharm Group), KCl (Beijing Chemical Plant), Na2HPO4·12H2O (Chemical Reagent Co., Ltd., Sinopharm Group), KH2PO4(Tianjin big chemical reagent forever Development centre), polysorbas20 (Tianjin recovery fine chemistry industry research institute), skimmed milk power (Biotopped), citric acid (traditional Chinese medicines collection Chemical reagent Co., Ltd of group), OPD (Shanghai San Pu Chemical Co., Ltd.s), 30%H2O2(Beijing Chemical Plant), the concentrated sulfuric acid (Beijing Chemical plant) and glutaraldehyde (Tianjin good fortune morning chemical reagent factory).
13.2.4 experimental procedure
(1) with inactivation PCV 2b (1: 50 dilution) coating (Rui Pu) ELISA Plate, coating buffer is the PBS containing 0.8% glutaraldehyde, 100 μ l/ holes, 4 DEG C overnight；
(2) with containing 5% skimmed milk power cleaning solution close, 200 μ l/ holes, 37 DEG C 2 hours.Cleaning solution is to be told containing 0.05% PBS (7.3mol/L NaCl, 3mmol/L KCl, the 10mmol/L Na2HPO412H2O, 17.6mmol/ of temperature 20 LKH2PO4)；
(3) wash, dry liquid, washed with cleaning solution, 300 μ l/ holes, room temperature 3min, repeated washing is twice；
(4) mice serum that addition is diluted with confining liquid 1: 100,100 μ l/ holes, 4 DEG C are overnight；
(5) inhale and abandon liquid, wash, cleaning solution and method are ibid；
(6) enzyme-added labeling antibody.Liquid is dried, is washed with cleaning solution, 300 μ l/ holes, room temperature 3min, liquid is dried, repetition is washed Wash twice.Add (sheep anti-Mouse) IgG, 100 μ l/ that the horseradish peroxidase (HRP) diluted with confining liquid 1: 2500 is marked Hole, 37 DEG C 1 hour；
(7) develop the color.Liquid is dried, is washed with cleaning solution, 300 μ l/ holes, room temperature 3min, liquid, repeated washing two is dried It is secondary.Add the μ l/ holes of substrate solution 100,37 DEG C of lucifuges colour developing 15min.The compound method of 10ml substrate solutions (i.e. with i.e. with) is to take The liquid of 1ml10X first and second, plus the μ g of distilled water 9ml, OPD 10 (fully dissolving) and 15 μ l 30%H2O2.The liquid of 10X first and second is by 10X solution As (0.914Mol/L citric acids) and 10X second liquid (2Mol/L Na2HPO4.12H2O) by 47.2 volumes: 50 volume ratios are made into；
(8) enzyme chromogenic reaction, 50ul/ holes are terminated with terminate liquid (sulfuric acid 2mmol/L)；
(9) OD values are surveyed with ELIASA (492nm) and taken pictures.
13.3 results
Cβ(sequence table<400>6) PCV2b specific antibodies (figure -16), P ＜ 0.01 can be induced in mouse.This explanation weight Group changes structure PCV2b capsid proteins can be used for the preparation that resisting porcine circovirus infects vaccine as antigen, also illustrate that restructuring changes Structure PCV2b capsid proteins can be used as antigen to detect pig circular ring virus specific antibody.
The C of embodiment 13βWith the comparison of the protein induced trick antibody of D：
Using CβThe vaccine immune mouse being made with D albumen as antigen.Separated after immune in serum, detection serum by PCV-II capsid protein inveigles the antibody that epitope is produced.
13.1 immune mouse
13.1.1 mouse
ICR mouse (medical board animal housing of Jilin University), female, body weight is 17-18 grams.
13.1.2 antigen
D albumen (abbreviation D).D albumen is PCV2b capsid proteins [the Fang M, et using Bacillus coli expression al.Intervirology.2015；58(5)：318-23].D albumen energy assembling assembly virus-like particles (Virus like Particls, VLPs).Detected using SDS-PAGE, D albumen (D) is shown as the zone that molecular weight is 28.9KD.(4 under Electronic Speculum Ten thousand times of amplifications) observation, the VLP size of D albumen formation is about 17nM, the VLP and PCV-II particle morphologically almost one Sample.D albumen is the restructuring PCV2b capsid proteins of total length, the escape epitopes [CP (169-180)] of the capsid protein containing PCV-II.
CβAlbumen.Use Bac-2Cβ- 3 infection Sf9 cells, collect cell after 3 days, the cell of collection are suspended from into assembles concentration [(Na2HPO4·12H2O (0.05M), NaH2PO4·2H2O (0.05M), NaCl (0.5M), Tween80 (0.03%), ethylenediamine Tetraacethyl disodium (0.001M)] in, using high pressure homogenizer cell lysis (700ba, 4 circulations) ultrasound.Centrifuge (4000 turns, 5 Minute) collect supernatant.＞ containing purity 85% C in supernatantβAlbumen (figure -15).Use this CβAlbumen (sequence table<400>6) antigen is done Immune mouse.
13.1.3 adjuvant
Oil-in-water (white oil) emulsifying agent
13.1.4 the preparation of vaccine
D albumen or C2 are emulsified respectively with oil-in-water (white oil) emulsifying agent, and D protein vaccines and C is madeβVaccine, every 100 μ l epidemic diseases Contain 2.5 μ g antigens in seedling.
13.1.5 immune mouse
Initial immunity is carried out to mouse in the 0th day, method is in the μ l D protein vaccines of right hind intramuscular injection 100 or C2 epidemic diseases Seedling.In the 14th day to booster immunization, method is ibid.
13.1.6 taken a blood sample before being immunized
In initial immunity the previous day, immune serum is treated in collection.Tail vein blood, the μ l of blood sampling volume >=100.By collection Whole blood (in 1.5mlEP pipes) room temperature is placed 30 minutes.11000rpm is centrifuged 15 minutes, collects serum, packing, -20 DEG C of preservations.
13.1.7. taken a blood sample after being immunized
14 days after initial immunity, 14 after booster immunization, 28,42 days, mouse blood system is adopted from serum, method such as 13.1.6.
13.2 immune serum antibody test
Specific antibody in serum is detected using ELISA
13.2.1 envelope antigen
Using PCV2 Cap (169-180) oligopeptides, also referred to as CP (169-180), do envelope antigen [Trible, B.R., Et al.Journal of virology, 2012,86,13508-13514；Trible BR, et al.2011.Clin.Vaccine Immunol.18：749-757；Trible BR, et al.2012.Vaccine 30：4079- 4085].CP (169-180) is the trick epitope on PCV-II capsid protein.
13.2.2 test equipment
Enzyme mark strip (combined type ELISA Plate), 0.5mlEP pipes, 1.5mlEP pipes, sample injector head, pipettor, multichannel pipettor, Plate (diameter 9cm) and graduated glass bottle etc..
13.2.3 reagent
Sodium carbonate (Chemical Reagent Co., Ltd., Sinopharm Group), NaCl (Chemical Reagent Co., Ltd., Sinopharm Group), KCl (Beijing Chemical Plant), Na2HPO4·12H2O (Chemical Reagent Co., Ltd., Sinopharm Group), KH2PO4(Tianjin big chemical reagent forever Development centre), polysorbas20 (Tianjin recovery fine chemistry industry research institute), skimmed milk power (Biotopped), citric acid (traditional Chinese medicines collection Chemical reagent Co., Ltd of group), OPD (Shanghai San Pu Chemical Co., Ltd.s), 30%H2O2(Beijing Chemical Plant), the concentrated sulfuric acid (Beijing Chemical plant) and glutaraldehyde (Tianjin good fortune morning chemical reagent factory).
13.2.4ELISA basic step
(1) with CP (169-180) (4 μ g/ml) in carbonate buffer solution (15mmol/L sodium carbonate and 35mmol/L bicarbonates Sodium water solution) 96 hole elisa Plates of middle coating, 100 μ l/ holes, 4 DEG C are coated with overnight.
(2) with containing 5% skimmed milk power cleaning solution close, 150 μ l/ holes, 37 DEG C 1 hour.Cleaning solution is to be told containing 0.05% PBS (7.3mol/L NaCl, 3mmol/L KCl, the 10mmol/L Na2HPO412H2O, 17.6mmol/ of temperature 20 LKH2PO4)；
(3) wash, dry liquid, washed with cleaning solution, 300 μ l/ holes, room temperature 3min, repeated washing is twice；
(4) mice serum that addition is diluted with confining liquid 1: 10000,100 μ l/ holes, 4 DEG C are overnight；
(5) inhale and abandon liquid, wash, cleaning solution and method are ibid；
(6) enzyme-added labeling antibody, be the same as Example 12；
(7) develop the color.Be the same as Example 12；
(8) enzyme chromogenic reaction, 50 μ l/ holes are terminated with terminate liquid (sulfuric acid 2mmol/L)；
(9) OD values are surveyed with ELIASA (492nm).
13.3 results
As shown in figure -17, C different with D albumenβ(sequence table<400>6) it can not induce for PCV-II capsid protein The antibody of escape epitopes.
This explanation, C2 can be used to prepare because avoiding inducing pig circular ring virus escape antibody as more effective antigen The vaccine of resisting porcine circovirus.

Claims (18)

1. one kind has such as sequence table<400>DNA molecule shown in 2.
2. one kind has such as sequence table<400>Change structure PCV-II capsid protein shown in 3, it by taking off as claimed in claim 1 Oxygen ribonucleic acid molecule is encoded.
3. changing structure PCV-II capsid protein as claimed in claim 2, it contains two amino acid sequence identical peptide fragments, its In a peptide fragment instead of the trick epitope of PCV-II capsid protein.
4. as claimed in claim 3 change structure PCV-II capsid protein, trick epitope therein also can be by also by annulus disease Other peptide fragments or the substitution of any peptide fragment on virus capsid protein.
5. such as claim 1, the recombinant protein described in 2,3,4 can be formulated into vaccine as antigen to prevent by pig circular ring virus 2 Porcine circovirus associated diseases caused by poison infection.
6. such as claim 1, the recombinant protein described in 2,3,4, it detects that PCV-II particularly PCV2b is special as antigen Property antibody, be characterized in excluding the interference that PCV-II capsid protein inveigles antibody.
7. one kind has such as sequence table<400>DNA molecule shown in 5.
8. one kind has such as sequence table<400>Change structure PCV-II capsid protein shown in shown in 6, as being taken off described in claim 7 Oxygen ribonucleic acid molecule is encoded.
9. changing structure PCV-II capsid protein as claimed in claim 8, it contains two sequence identical peptide fragments, one of them Peptide fragment instead of the trick epitope of PCV-II capsid protein.
10. as claimed in claim 8 change structure PCV-II capsid protein, trick epitope therein also can be by also by annulus disease Other peptide fragments or the substitution of any peptide fragment on virus capsid protein.
11. such as claim 7, the recombinant protein described in 8,9,10 can be formulated into vaccine to prevent by pig annulus as antigen Porcine circovirus associated diseases caused by virus infection.
12. such as claim 7, the recombinant protein described in 8,9,10, it detects that PCV-II particularly PCV2b is special as antigen Heterogenetic antibody, is characterized in that the interference that PCV-II capsid protein inveigles antibody can be excluded.
13. such as claim 2, change structure PCV-II capsid protein described in 3,4,8,9,10, they can be in Escherichia coli, insect Rhabdovirus system is produced, and can also be produced in yeast and mammalian cell system.
14. such as claim 2, structure PCV-II capsid protein is changed described in 3,4,8,9,10, their encoding gene can by gram It is grand to prevent the pig as caused by Infection of Porcine circovirus to vaccine is made on plasmid vector or viral vector with biological function PCV-II relevant disease.
15. such as claim 2, structure PCV-II capsid protein is changed described in 3,4,8,9,10, the vaccine being made of them can be with Pig circular ring virus vaccine or other pigs vaccine use in conjunction.
16. such as claim 2, structure PCV-II capsid protein is changed described in 3,4,8,9,10, they can use adjuvant and pharmacy can The carrier of receiving is made into vaccine or vaccine combination to prevent the porcine circovirus associated diseases as caused by Infection of Porcine circovirus.
17. changing structure PCV-II capsid protein as claimed in claim 16, drawn being used for prevention by Infection of Porcine circovirus Immune effective dose (immunologically effective amount) is used during the porcine circovirus associated diseases risen.
18. such as claim 16, structure PCV-II capsid protein is changed described in 17, it is being used for prevention by Infection of Porcine circovirus Can be through the method for administration application such as abdominal cavity, muscle, subcutaneous, intracutaneous during caused porcine circovirus associated diseases.
CN201610141013.XA 2016-03-14 2016-03-14 Recombinant mutant pig circular ring virus 2 virus capsid protein Pending CN107190012A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610141013.XA CN107190012A (en) 2016-03-14 2016-03-14 Recombinant mutant pig circular ring virus 2 virus capsid protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610141013.XA CN107190012A (en) 2016-03-14 2016-03-14 Recombinant mutant pig circular ring virus 2 virus capsid protein

Publications (1)

Publication Number Publication Date
CN107190012A true CN107190012A (en) 2017-09-22

Family

ID=59870677

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610141013.XA Pending CN107190012A (en) 2016-03-14 2016-03-14 Recombinant mutant pig circular ring virus 2 virus capsid protein

Country Status (1)

Country Link
CN (1) CN107190012A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108484725A (en) * 2018-03-16 2018-09-04 广东海大畜牧兽医研究院有限公司 A kind of polypeptide for distinguishing the wild malicious antibody of detection PCV2 and vaccine antibody and its application in ELISA detection kit
CN109762835A (en) * 2018-09-21 2019-05-17 宁夏大学 The construction method of hunchbacked source nano antibody gene pool
CN110407919A (en) * 2019-06-12 2019-11-05 天津瑞普生物技术股份有限公司 A kind of recombination sequence and application of porcine circovirus 2 type (PCV-2) Cap protein
CN110687302A (en) * 2019-10-30 2020-01-14 浙江省医学科学院 Test paper strip and method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold
CN113462625A (en) * 2021-06-18 2021-10-01 杨凌凯瑞生物科技有限公司 Genetic engineering strain of cap protein and construction and fermentation methods thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012005732A1 (en) * 2010-07-08 2012-01-12 United Biomedical, Inc Designer peptide-based pcv2 vaccine
CN102813918A (en) * 2012-08-13 2012-12-12 郑州后羿制药有限公司 Porcine circovirus 2 type recombinant subunit vaccine and preparation method thereof
CN103805573A (en) * 2013-12-31 2014-05-21 广东大华农动物保健品股份有限公司 Recombinant adenovirus rAd-ORF2-TCE and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012005732A1 (en) * 2010-07-08 2012-01-12 United Biomedical, Inc Designer peptide-based pcv2 vaccine
CN102813918A (en) * 2012-08-13 2012-12-12 郑州后羿制药有限公司 Porcine circovirus 2 type recombinant subunit vaccine and preparation method thereof
CN103805573A (en) * 2013-12-31 2014-05-21 广东大华农动物保健品股份有限公司 Recombinant adenovirus rAd-ORF2-TCE and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BENJAMIN R. TRIBLE等: "Genetic variation of porcine circovirus type 2 (PCV2) and its relevance to vaccination, pathogenesis and diagnosis", 《VIRUS RESEARCH》 *
BENJAMIN R. TRIBLE等: "Recognition of the Different Structural Forms of the Capsid Protein Determines the Outcome following Infection with Porcine Circovirus Type 2", 《JOURNAL OF VIROLOGY》 *
PEI-CHING WU等: "Efficient expression and purification of porcine circovirus type 2 virus-like particles in Escherichia coli", 《JOURNAL OF BIOTECHNOLOGY》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108484725A (en) * 2018-03-16 2018-09-04 广东海大畜牧兽医研究院有限公司 A kind of polypeptide for distinguishing the wild malicious antibody of detection PCV2 and vaccine antibody and its application in ELISA detection kit
CN109762835A (en) * 2018-09-21 2019-05-17 宁夏大学 The construction method of hunchbacked source nano antibody gene pool
CN110407919A (en) * 2019-06-12 2019-11-05 天津瑞普生物技术股份有限公司 A kind of recombination sequence and application of porcine circovirus 2 type (PCV-2) Cap protein
CN110407919B (en) * 2019-06-12 2021-05-28 天津瑞普生物技术股份有限公司 Recombinant gene sequence of porcine circovirus type 2 (PCV-2) Cap protein and application thereof
CN110687302A (en) * 2019-10-30 2020-01-14 浙江省医学科学院 Test paper strip and method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold
CN113462625A (en) * 2021-06-18 2021-10-01 杨凌凯瑞生物科技有限公司 Genetic engineering strain of cap protein and construction and fermentation methods thereof

Similar Documents

Publication Publication Date Title
US11780889B2 (en) Porcine circovirus type 3 immunogenic compositions and methods of making and using the same
CN107190012A (en) Recombinant mutant pig circular ring virus 2 virus capsid protein
ES2357679T3 (en) VACCINE AGAINST FELINO CALICIVIRUS (FCV) THAT INCLUDES A CAPSIDA PROTEIN FROM AN FCV OR A CAPSIDA PROTEIN FROM AN ISOLATED FCV THAT INCLUDES A PROTEIC SEQUENCE SEQ ID NO: 13 OR PROTEIC SEQUENCES WITH, AT LEAST, 95% IDENTITY WITH IT .
CN103154242A (en) Norovirus derived immunogenic compositions and methods
CN103122352A (en) Porcine circovirus II-type recombinant baculovirus as well as preparation method and application thereof
Li et al. Immunogenicity and immunoprotection of porcine circovirus type 2 (PCV2) Cap protein displayed by Lactococcus lactis
Hu et al. Generation and immunogenicity of porcine circovirus type 2 chimeric virus-like particles displaying porcine reproductive and respiratory syndrome virus GP5 epitope B
CN113087791B (en) Broad-spectrum anti-variant coronavirus IgY and composite antibody, preparation method and combined preparation
CN110423269A (en) A kind of 2 type Cap protein of recombinant porcine circovirus and its application of Dominant Epitopes of connecting
CN106148358A (en) A kind of method utilizing escherichia expression system to prepare pig parvoviral virus sample particle subunits vaccine and application
CN109055412A (en) A kind of pig circular ring virus-mycoplasma pneumoniae bigeminy subunit vaccine and preparation method thereof
CA3136141A1 (en) Porcine circovirus type 3 (pcv3) vaccines, and production and uses thereof
CN113862284A (en) Gene for coding recombinant avian influenza virus HA protein, virus-like particle, vaccine, preparation and application
CN109207502A (en) Porcine mycoplasmal pneumonia and porcine circovirus 2 type recombinant protein and prepare bigeminy vaccine
CN101932336B (en) Pcv2 orf2 virus like particle with foreign amino acid insertion
CN109195624B (en) HEV vaccine
CN113278634B (en) Novel vaccine for preventing and treating merkel cell carcinoma
CN109880839B (en) Preparation method of swine mycoplasma pneumonia and porcine circovirus bivalent genetic engineering vaccine
CN104388453B (en) Porcine circovirus (PCV) cap protein inserted swine fever virus B cell epitope recombinant virus and application thereof
KR20190023604A (en) A combination vaccine based on virus like particle
JP2016502845A (en) Porcine parvovirus 5A, method of use and vaccine
CN109134619A (en) Porcine circovirus 2 type antigen, the immunogenic composition of its preparation, preparation method and application
AU2013204339A1 (en) Methods of vaccine administration, new feline caliciviruses, and treatments for immunizing animals against feline parvovirus and feline herpes virus
RU2795055C1 (en) Immunobiological agent based on virus-like particles for induction of specific immunity against infection caused by human rotavirus a
CN109125720A (en) A kind of immunogenic composition of the 3 type antigen containing pig circular ring virus and its application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20170922