CN110407919B

CN110407919B - Recombinant gene sequence of porcine circovirus type 2 (PCV-2) Cap protein and application thereof

Info

Publication number: CN110407919B
Application number: CN201910504113.8A
Authority: CN
Inventors: 李守军; 辛波; 孙阳阳; 李思洁; 王丹娜; 刘海霞; 李蓬飞
Original assignee: Tianjin Ringpu Bio Technology Co Ltd
Current assignee: Tianjin Ringpu Bio Technology Co Ltd
Priority date: 2019-06-12
Filing date: 2019-06-12
Publication date: 2021-05-28
Anticipated expiration: 2039-06-12
Also published as: CN110407919A

Abstract

The invention provides a gene sequence of porcine circovirus type 2 recombinant Cap protein and application thereof, and specifically comprises the following steps: the method for replacing the escape epitope of the Cap protein sequence is adopted, the amino acid of the porcine circovirus type 2 Cap protein at the 163-175 th site is replaced by a section of T cell epitope HA-peptide for the first time, the similarity of the T cell epitope HA-peptide and the escape epitope amino acid in the original Cap protein is high, the secondary structure is the same, the space structure of the Cap protein is not changed after the replacement, the recombined Cap protein sequence effectively prevents antigen-antibody recognition caused by the escape epitope of the Cap protein, overcomes the defect of the prior art that the Cap protein is packaged into virus-like particles, simplifies the process and reduces the production cost. According to the invention, a porcine circovirus type 2 recombinant Cap protein gene sequence is applied to the preparation of subunit vaccine for the first time, and the vaccine has remarkably improved immune protection effect compared with that of the vaccine without modification.

Description

Recombinant gene sequence of porcine circovirus type 2 (PCV-2) Cap protein and application thereof

Technical Field

The invention belongs to the field of genetic engineering vaccines, and particularly relates to a recombinant gene sequence of a porcine circovirus type 2 Cap protein and application thereof.

Background

Porcine circovirus type 2 (PCV 2) is the major pathogen causing Postweaning Multisystemic Wasting Syndrome (PMWS). PMWS caused by PCV-2 shows a fulminant fashion trend in relevant pig-raising areas in China in recent years, and causes huge economic loss to the pig industry in China.

Cap protein is the main structural protein of PCV-2, can stimulate animal organism to produce the specific immune response to PCV-2, it is the ideal target antigen to develop PCV-2 subunit vaccine, but the study in recent years shows, Cap protein expression, can detect the higher antibody level, but the immune protective effect of subunit vaccine made of this protein is not good. The reason for this situation is that the production process of using escherichia coli or insect cell-baculovirus as expression host and further packaging it into virus-like particle (VLP) has many problems: for example, the tag protein has complex processes such as in vitro enzyme digestion and ultracentrifugation, the VLP has large self molecular weight and lower recovery rate compared with the VLP before packaging, the VLP is cracked into monomers due to in vitro purification, and the defects directly cause the poor immune protection effect, and simultaneously increase the difficulty and the cost of vaccine production. On the other hand, besides the defects of the process itself, it is still to be ascertained whether the inherent amino acid sequence and spatial structure of the Cap protein have certain defects, which result in low vaccine immune potency.

Disclosure of Invention

The invention aims to provide a recombinant Cap protein of porcine circovirus type 2 (PCV-2).

The invention aims to provide an amino acid sequence of a recombinant Cap protein of porcine circovirus type 2 (PCV-2).

The invention aims to provide a subunit vaccine containing porcine circovirus type 2 (PCV-2) recombinant Cap protein.

The invention aims to solve the problem of low immune efficacy of PCV-2 subunit vaccine.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

a porcine circovirus type 2 (PCV-2) recombinant Cap protein has a nucleotide sequence shown as SEQ ID NO 1 or SEQ ID NO 2.

Furthermore, the nucleotide sequence of the porcine circovirus type 2 (PCV-2) recombinant Cap protein is shown as SEQ ID NO. 3, and the corresponding amino acid sequence is shown as SEQ ID NO. 1.

Furthermore, the nucleotide sequence of the porcine circovirus type 2 (PCV-2) recombinant Cap protein is shown in SEQ ID NO. 4, and the corresponding amino acid sequence of SEQ ID NO. 2 is shown in SEQ ID NO. 4.

A subunit vaccine of porcine circovirus type 2 (PCV-2) recombinant Cap protein, wherein the nucleotide sequence of the recombinant Cap protein is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

Furthermore, the amino acid of the recombinant Cap protein is obtained by replacing the amino acid at the position 163-175 of the Cap protein with a T cell epitope HA-peptide.

Further, the T cell epitope HA-peptide is derived from amino acid 318 of influenza virus hemagglutinin protein 306.

Further, the sequence of the T cell epitope HA-peptide is PKYVKQNTLKLFT

Further, the sequence of the T cell epitope HA-peptide is PKYVKQNTIKLAT.

Furthermore, the T cell epitope HA-peptide HAs small influence on the structure of Cap protein by replacement after being compared by SWISS-Model homology modeling (shown in figure 1).

Furthermore, the T cell epitope HA-peptide is determined by screening 9251 segment epitope sequences from an epitope library and then performing sequence similarity analysis with escape epitope sequences of Cap protein respectively.

Compared with the prior art, the invention has the following advantages:

(1) the invention replaces the amino acid of the porcine circovirus type 2 Cap protein at the position 163-175 with a segment of T cell epitope HA-peptide for the first time.

(2) The T cell epitope HA-peptide HAs high similarity with escape epitope amino acid in the original Cap protein, HAs the same secondary structure, and does not change the space structure of the Cap protein after replacement.

(3) The recombined Cap protein sequence effectively prevents antigen-antibody recognition caused by escape epitopes of the Cap protein.

(4) The method for replacing the escape epitope of the Cap protein sequence overcomes the defect of the prior art that the Cap protein is packaged into the virus-like particles, simplifies the process and reduces the production cost.

(5) The invention applies a porcine circovirus type 2 recombinant Cap protein gene sequence to the preparation of subunit vaccine for the first time.

(6) Compared with the subunit vaccine without modification, the subunit vaccine of the recombinant Cap protein gene sequence has obviously improved immune protection effect.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate an embodiment of the invention and, together with the description, serve to explain the invention and not to limit the invention. In the drawings:

FIG. 1 is a schematic diagram of amino acid alignment and homology modeling according to an embodiment of the present invention; wherein a is a schematic structural diagram of an original Cap protein sequence, b is a schematic structural diagram of C2-1 protein after homologous modeling, and C is a schematic structural diagram of C2-2 protein after homologous modeling. The arrows indicate the structures of the dark portions corresponding to the PKPVLDSTIDYFQ, PKYVKQNTLKLFT and PKYVKQNTIKLAT sequences, respectively.

FIG. 2 is a schematic diagram of the detection of gene clone by electrophoresis according to the embodiment of the present invention; wherein, a is C2 and C2-1 clone detection; b is sumo gene clone detection; c, carrying out enzyme digestion detection on the vector; d is the result of PCR verification of the recombinant transformant colony.

FIG. 3 is a schematic diagram illustrating the detection of the expression result of the recombinant strain according to the embodiment of the present invention; wherein, a is the expression and purification result of the C2 fusion protein, and b is the expression and detection result of the C2-1 fusion protein.

FIG. 4 is a schematic diagram of enzyme digestion of a western-blot detection fusion protein according to an embodiment of the present invention; in the figure, 1 and 3 bands are fusion proteins C2-1 and C2; the 2 and 4 bands represent the protein system after enzyme digestion respectively. The labeled C2-1 and C2 in the figure represent the protein bands after sumo cleavage, respectively.

FIG. 5 is a schematic diagram of the efficacy test results according to the embodiment of the present invention; wherein a is an ELISA detection result; b is the detection result of the neutralizing antibody.

Detailed Description

The biological materials such as kits, vectors, enzymes, host bacteria and the like used in the examples are all from commercial products.

Example 1 preparation of porcine circovirus type 2 Cap protein (C2 protein) and recombinant Cap protein (C2-1 fusion protein);

1.1 cloning of Cap protein, recombinant Cap protein, SUMO Gene sequences

According to the full-length sequence (ID: EU257511.1) of the porcine circovirus strain TZ0601 Cap protein provided by GenBank, the amino acid sequence replaced in the C2-1 fusion protein is optimized according to the preference of an escherichia coli codon, and the nucleotide fragment of the C2-1 fusion protein is synthesized.

The primers for amplifying the C2 protein and the corresponding gene of the C2-1 protein are the same pair of primers S-Cp2-F/2A-S-Cp2-R, and the sequences are respectively as follows: 5'ATGACGTATCCAAGGAGGCG 3' 5'ACCAGTCATGCTAGCCATATGTTATTCATTAAGGGTTAAGTGGGG 3'

See table 1 for amplification system:

TABLE 1, C2 and C2-1 protein corresponding gene fragment amplification system

And (3) uniformly mixing the system, and then placing the system in a PCR instrument for amplification. See table 2 for amplification methods:

TABLE 2, C2 and C2-1 protein corresponding gene fragment amplification method

The primers for amplifying the yeast-derived SUMO gene are respectively Su-C2-F/S-C2-R, and the sequences are respectively as follows: 5'GTGCCGCGCGGCAGCCATATGTCGGACTCAGAAGTCAATCAAGAAG 3' 5'TGGATACGTCATTGAGCCTCCAATCTGTTCGCGG 3'

The PCR amplification system is shown in table 3:

TABLE 3 amplification System of SUMO Gene

And (3) uniformly mixing the system, and then placing the system in a PCR instrument for amplification. The PCR amplification procedure is shown in table 4:

TABLE 4 amplification method of SUMO Gene

1.2 Single cleavage of expression vectors

The plasmid pET28a (+) for protein expression was extracted, the concentration thereof was determined, and single cleavage was performed using the restriction enzyme NdeI. The reaction system is shown in table 5:

TABLE 5 digestion system

After mixing gently, the mixture was reacted at 37 ℃ for 30 min.

1.3 detection, recovery and purification of PCR products of C2 and C2-1 genes and expression vector enzyme digestion products

And (3) carrying out 1.0% agarose gel electrophoresis detection on the DNA obtained by PCR in the step 1.1 and the plasmid DNA subjected to single enzyme digestion in the step 1.2, cutting a target band, and recovering a target fragment by using a DNA gel recovery kit, wherein the specific operation refers to the kit specification. The results of the electrophoretic detection after the enzyme cleavage are shown in FIGS. 2 a-c.

1.4C 2/C2-1 Gene was linked to SUMO Gene and vector, respectively

The C2/C2-1 gene was ligated to SUMO gene and vector, respectively, and used

The ligation of fragments was performed by the MultiS One step cloning Kit. Wherein, the plasmid after enzyme digestion in 1.3 is combined with SUMO and C2/C2-1 geneThe specific reaction system for carrying out ligation is shown in Table 6:

TABLE 6 ligation reaction System

1.5 transformation of ligation products

The ligation product in 1.4 was transformed into E.coli DH 5. alpha. competent cells, incubated for renaturation, plated on a Carna-resistant LB solid medium plate, and cultured overnight at 37 ℃ until single colonies appeared on the plate.

1.6 screening of Positive clones

1) 5 single colonies from the 1.5 resistant plates were inoculated into shake tubes containing kanamycin-resistant LB medium and cultured overnight at 37 ℃;

2) colonies from step 1 were picked for PCR validation and the results were checked by 1.0% agarose gel electrophoresis as shown in FIG. 2 d.

1.7 sequencing validation of recombinant plasmids

1) Selecting the positive clone in the step 1) in the step 1.6 and extracting plasmids;

2) in step 1) the plasmid was sequenced by Kinzhi corporation. The sequencing result is compared by NCBI website, the sequence of the target fragment in the recombinant plasmid is proved to be completely correct, and the sequence is renamed as follows: 28AS-C2 and 28 AS-C2-1.

1.8 construction of expression recombinant strains

Plasmids 28AS-C2 and 28AS-C2-1 obtained in step 1) of 1.7 were transformed into the expression host E.coli BL21, respectively (DE 3). Correct clones were obtained by screening kanamycin-resistant LB plates. The recombinant strains are named AS BL21(DE3) (28AS-C2) and BL21(DE3) (28 AS-C2-1).

1.9 inducible expression of two recombinant bacteria C2/C2-1 proteins

1) Picking single colony from the resistant plate, inoculating the single colony in a shake tube containing LB culture medium, and culturing at 37 ℃ overnight;

2) transferring the bacterial liquid obtained by the culture in the step 1 into a 500 mL triangular flask containing 50mLLB culture medium with the inoculation amount of 1%, and performing shaking culture at 37 ℃ until the bacterial liquid is culturedOD_620nmIs 0.6;

3) IPTG was added to the above culture solution at a final concentration of 1mM, and shaking-induced expression was carried out at 16 ℃ for 8 hours.

4) The cells were collected, washed twice with PBS, and then the PBS was used to resuspend the cell pellet while adjusting OD_620nmTo 30.

5) The bacterial cells were disrupted by ultrasonic wave, centrifuged at 12,000rpm for 10min, and the supernatant was collected.

6) The collected supernatant was purified by affinity chromatography on a nickel column. The purification results are shown in FIG. 3.

1.10 protease digestion and Western-Blot detection

SUMO protease (ULP) can completely cleave the fusion protein of SUMO with C2/C2-1. The total volume of the enzyme digestion system was 500. mu.l. The protease cleavage system is shown in table 7:

TABLE 7 protease cleavage System

After the enzyme digestion system is mixed, the mixture reacts for 1h in a metal bath at the temperature of 30 ℃, and after the reaction is finished, the enzyme digestion product is prepared into an SDS-PAGE sample. And verifying the enzyme digestion condition of the fusion protein by using a protein immunoblotting method. The method comprises the following steps:

1) detecting SDS-PAGE, and running an electrophoresis strip to the lower edge area of the glass plate;

2) preparing a film transfer: cut out filter paper and nitrocellulose membrane (NC membrane) with proper size, soak in the buffer solution of the transfer membrane, and place for standby at 4 ℃.

3) And (3) rotating the die: cutting the gel into proper size, and putting the gel, the soaked filter paper and the NC membrane into a membrane transferring instrument. From bottom to top in sequence: three layers of filter paper, NC membrane, gel and three layers of filter paper, and air bubbles need to be removed in the process. Turning on the power supply, adjusting the current to 45mA, keeping the total time for 45min, supplementing the membrane transfer buffer solution at intervals of 15min, and supplementing twice, wherein each time is about 10 mL.

4) And (3) sealing: after the membrane transfer was completed, the membrane was placed in 15mL of a blocking solution containing 5% skim milk powder and incubated on a horizontal shaker for 1.5h at room temperature. After blocking, the membrane was removed and washed 3 times with TBST for 5min each.

5) Immune reaction: the primary antibody was diluted to the appropriate concentration with TBST containing 2% skim milk, and the membrane was placed in the primary antibody dilution and incubated on a horizontal shaker for 1.5h at room temperature. After completion, the reaction mixture was washed 3 times with TBST for 5 min. In the same way secondary antibodies were diluted with TBST containing 2% skim milk and incubated for 1.5h at room temperature. After completion, the reaction mixture was washed 3 times with TBST for 5 min.

6) And (3) developing and exposing: mixing the developer A solution and the developer B solution in equal volume. And (3) placing the membrane on an exposure plate, dropwise adding a developer by using a liquid-transferring gun, and exposing and imaging by using a BIO-RAD gel imager, so that the expression condition of the protein can be observed. As shown in fig. 4. The protein bands marked in the figure are the cleaved C2 and C2-1 proteins.

1.10 Sterilization

The collected supernatant was added to a 10% formaldehyde solution at a final concentration of 0.2% in proportion, and inactivated at 37 ℃ for 12h to remove E.coli. The bacteria-free inspection is carried out according to the pharmacopoeia of the people's republic of China, and no bacteria grow.

Example 2 preparation and testing of vaccines

1. And (4) carrying out seedling preparation on the sterile protein supernatant. Preparing seedlings by using aluminum hydroxide glue and subpackaging. The bacteria-free inspection is carried out according to the pharmacopoeia of the people's republic of China, and no bacteria grow.

2. Safety inspection

5 healthy susceptible piglets aged for 14-28 days are injected with 4.0mL of vaccine through neck muscles, and any local and general malaise reaction caused by the injection of the vaccine does not occur after 14 days of continuous observation.

3. Animal experiments

Immunization was carried out according to the animal protocol described in the Ministry of agriculture, publication No. 2168. The piglet immunity challenge test is to feed 5 healthy susceptible pigs of 21 days old at 2.0 mL/head of each neck intramuscular injection vaccine, 3 control pigs at 3 heads at 2.0 mL/head of each neck intramuscular injection sterile normal saline in an isolated way. Challenge experiments were performed 35 days after immunization. Adopts a circovirus type 2 strain ZJ/C strain to challenge (the virus content is 10)^6.25TCID₅₀Per mL), each nose drop1.0mL and 2.0mL for intramuscular injection, and isolated feeding. The medicine is killed 28 days after the toxin is attacked. Blood is collected 21 days, 35 days after immunization and 7 days after challenge before immunization, and the level of ELISA antibody and the level of neutralizing antibody aiming at escape epitope are detected.

3.1 ELISA detection of antibody levels against escape epitopes

We used chemically synthesized polypeptide peptide sequences of escape epitopes: STIDYFQPNNKR (denoted by C-p). Afterwards, escape epitope antibody detection was performed with 96-well plates [4 ]. The specific operation method comprises the following steps:

1) coating with C-p with the concentration of 4ug/mL and the volume of 100uL, and standing overnight at 4 ℃;

2) after PBST washing, blocking by PBS-GS (PBS + 10% goat serum);

3) adding 1:400 diluted serum to be detected into each hole, and incubating for 2h at room temperature;

4) the plates were washed with PBST and 100uL of a 1:2000 fold dilution of peroxidase-labeled goat anti-pig secondary antibody (Accurate Chemical & Scientific Corporation, USA.) was added to each well. Incubating for 1h at room temperature;

5) PBST washing plate, each hole is added with 100uLABTS to terminate the reaction;

6) the excitation was carried out using a microplate reader at 405nm and the reading was carried out. The S/P value is used to represent the final result.

The result is shown in fig. 5a, and it can be seen that the vaccine prepared by the C2 protein generates antibodies to the C-P peptide fragment, the S/P value of the antibodies can reach 0.58 +/-0.23 21 days after immunization, and the S/P value is significantly different from that of the C2-1, the control negative group and the commercial vaccine group; the antibody can reach 0.7 +/-0.12 after 35 days of immunization, and is also obviously higher than that of the C2-1 group and the commercial vaccine group. It can thus be demonstrated that C2-1 no longer generates antibodies against the escape epitope after partial replacement of the escape epitope. The original C2 protein with unchanged escape epitope still can trigger antigen-antibody reaction against the escape epitope antigen.

3.2 detection of neutralizing antibody levels

3.2.1 detection method:

1) using MEM culture solution containing fetal calf serum to perform gradient multiple dilution on the obtained serum sample to be detected;

2) add 100TCID per well₅₀PC/mLV2b virus solution, incubating for 1 hour at 37 ℃, setting 4 replicates, and setting virus positive control and blank control;

3) transferring the mixed solution to a 96-well plate, culturing ST cells for 1 day, incubating for 3 days at 37 ℃, and fixing the cells by using 80% acetone;

4) adding PCV2 antibody diluted by PBS 1:2000, then adding F ITC labeled anti-mouse antibody, and incubating for 30min at 37 ℃;

5) and (5) observing the result under a fluorescence microscope. If the specific cell fluorescence decreases by 90% or more, the pore is considered positive for PCV2 specific neutralization. The titer of serum neutralizing antibodies was defined as the log of the maximum dilution factor of serum that gave a positive reaction in half of the cells, according to the method of Spearman and Karber₂Value, i.e. log₂50% neutralising Activity in NA₅₀/mL。

3.2.2 test results

The results are shown in fig. 5b, compared with the immune effect of the C2 vaccine, the C2-1 fusion protein vaccine stimulates the body to produce higher titer of neutralizing antibodies, and the level of the neutralizing antibodies is obviously higher than that of the C2 vaccine 35 days after the immunization, and is equivalent to that of the commercial product. Meanwhile, 7 days after challenge, the neutralizing antibody still keeps a higher level, thereby proving that the C2-1 with modified sequence has good neutralizing effect and obviously improving the problems of the C2 vaccine.

Example 3 challenge protection experiment

Preparing 3 kinds of commercial circovirus type 2 vaccines which respectively contain C2 protein and C2-1 protein according to the method in example 2, wherein; taking 23 healthy susceptible pigs aged 21 days, 3 pigs in a control group and the rest 20 pigs which are randomly divided into 4 groups, wherein each group comprises 5 pigs, namely a challenge group, a commercial vaccine group, a C2 protein group and a C2-1 protein group, and each head and neck of the 5 pigs, the control group and the challenge group are injected with sterile normal saline at a dose of 2.0 mL/pig; the commercial vaccine group is injected with the commercial vaccine through each head and neck part muscle, and the C2 protein group is injected with the vaccine containing the C2 protein through each head and neck part muscle, wherein the volume per head is 2.0 mL; c2-1 proteome each head and neck intramuscular injection vaccine containing C2-1 protein, 2.0 mL/head; and (5) isolated feeding of each group. Performing challenge experiment 35 days after immunization, and adopting circovirus type 2 strain ZJ/C strain to challenge virus (virus)The content is 10^6.25TCID₅₀Per mL), each nasal drop is 1.0mL, intramuscular injection is 2.0mL, and each group is isolated and raised. The challenge protection test results are shown in table 8.

TABLE 8 immune grouping and challenge protection results

Note: the pathological changes include lung excess, swollen lymph nodes, bad dead points of kidney, mild swelling of spleen, and intestinal tympanites.

As can be seen from the results, the group immunized with C2-1 has a protection rate of 80%, and the immunization effect is equivalent to the immunization result of the commercial vaccine.

The C2-1 protein-containing vaccine used in the experiment has the nucleotide sequence shown in SEQ ID NO. 1, and in addition, the vaccine challenge test of the C2-2 protein of which the nucleotide sequence is SEQ ID NO. 2 is also carried out, and the experimental result is the same as the result of the vaccine of which the nucleotide sequence is SEQ ID NO. 1.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Claims

1. A porcine circovirus type 2 (PCV-2) recombinant Cap protein, which is characterized in that: the nucleotide sequence is shown in SEQ ID NO. 1 or SEQ ID NO. 2.

2. The porcine circovirus type 2 (PCV-2) recombinant Cap protein of claim 1, characterized in that: the corresponding amino acid sequence of the nucleotide sequence SEQ ID NO. 1 is shown as SEQ ID NO. 3.

3. The porcine circovirus type 2 (PCV-2) recombinant Cap protein of claim 1, characterized in that: the corresponding amino acid sequence of the nucleotide sequence SEQ ID NO. 2 is shown as SEQ ID NO. 4.

4. A subunit vaccine of porcine circovirus type 2 (PCV-2) recombinant Cap protein, which is characterized in that: the nucleotide sequence of the recombinant Cap protein is shown as SEQ ID NO. 1 or SEQ ID NO. 2.