CN110687302A - Test paper strip and method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold - Google Patents
Test paper strip and method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold Download PDFInfo
- Publication number
- CN110687302A CN110687302A CN201911045715.8A CN201911045715A CN110687302A CN 110687302 A CN110687302 A CN 110687302A CN 201911045715 A CN201911045715 A CN 201911045715A CN 110687302 A CN110687302 A CN 110687302A
- Authority
- CN
- China
- Prior art keywords
- line
- porcine circovirus
- circovirus type
- cap
- recombinant protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/01—DNA viruses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a test strip and a method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold. The colloidal gold test strip adopts gold-labeled protein CAP recombinant protein which is dominant epitope peptide of a denucleation positioning signal and is provided with a His label, and is expressed to supernatant through low-temperature induction of a prokaryotic expression system; anti-porcine circovirus type 2 CAP recombinant protein polyclonal rabbit serum marked on a T line (antigen detection test strip) or a C line (antibody detection test strip) is coupled with CAP recombinant protein through CNBr activated sepharose FF and then purified. The kit can quickly detect the antigen or the antibody in the pig serum, has high sensitivity, strong specificity, better stability and simple operation, can better meet the requirements of different levels, and is easy to popularize to the basic level.
Description
Technical Field
The invention belongs to a test strip of a diagnosis technology in the technical field of biology, and particularly relates to a colloidal gold test strip for detecting porcine circovirus type 2 (PCV2) antigen or antibody, a preparation method and a use method thereof.
Background
Porcine circovirus type 2 (PCV2) is a main pathogen causing Postwelting Multisystemic Wasting Syndrome (PMWS) of pigs and weaned pigs, and causes symptoms of progressive wasting, slow growth, dyspnea and the like of affected animals. In addition, PCV2 is also related to pig dermatitis and diseases such as nephrotic syndrome, hyperplastic necrotizing pneumonia, pig respiratory disease syndrome, reproductive disorders and the like. Related diseases caused by PCV2 infection are widely distributed in the world, the death rate of pigs is different from 10% to 30%, and serious economic loss is caused to the pig industry.
The main detection methods for porcine circovirus type 2 adopted at home and abroad include virus isolation culture, polymerase chain reaction, indirect immunofluorescence, enzyme-linked immunosorbent assay and the like. These methods can detect the antigen and antibody of PCV2, but have the limitations of long operation time, complex process, need of professional operators and special instruments and equipment, and are difficult to popularize and popularize in the basement. The rapid, simple and accurate detection method is developed, the PCV2 pathogen and antibody level in the swinery are monitored in real time, and the method has important significance for preventing and controlling diseases.
Disclosure of Invention
The invention aims to provide a porcine circovirus type 2 (PCV2) antigen and antibody detection colloidal gold test strip, which can effectively detect an antigen or an antibody in porcine serum and is used for diagnosing the antigen and the antibody infected by PCV 2.
The invention aims to provide a colloidal gold test strip for rapid detection, reduce the detection cost and provide a field diagnosis method capable of being applied in a large scale aiming at the current situations that the PCV2 infection generally causes huge economic loss and lacks an effective field usable test strip in China.
The test paper strip for detecting the porcine circovirus type 2 antigen or antibody colloidal gold is realized by the following technical scheme:
a test paper strip for detecting porcine circovirus type 2 antigen or antibody colloidal gold comprises a PVC plate, a sample pad, a gold label pad, a nitrocellulose membrane, a water absorption pad, a C line and a T line, wherein the water absorption pad is arranged at the upper end of the PVC plate and is used as a handheld part; the middle end of the PVC plate is a reaction area, a nitrocellulose membrane is arranged on the reaction area, a gold label pad, a C line and a T line are arranged on the nitrocellulose membrane, the C line is a quality control line, the T line is a detection line, and the gold label pad, the T line and the C line are sequentially arranged on the nitrocellulose membrane in the direction from the sample pad to the water absorption pad; the lower end of the PVC plate is provided with a sample pad which is used as an area of a serum sample to be detected; the gold-labeled pad is adsorbed with gold-labeled protein; when the test strip is used for detecting antigen colloidal gold, the gold-labeled protein adsorbed on the gold-labeled pad is porcine circovirus type 2 CAP recombinant protein labeled by colloidal gold, the T line on the nitrocellulose membrane layer is polyclonal rabbit serum resisting the porcine circovirus type 2 CAP recombinant protein, and the C line is goat anti-rabbit IgG polyclonal antibody; when the test strip is used for antibody colloidal gold detection, the gold-labeled protein adsorbed on the gold-labeled pad is porcine circovirus type 2 CAP recombinant protein labeled by colloidal gold, the T line on the nitrocellulose membrane layer is protein A recombinant protein, and the C line is polyclonal rabbit serum resisting the porcine circovirus type 2 CAP recombinant protein.
When the test strip is prepared, the porcine circovirus type 2 CAP recombinant protein marked by colloidal gold is adsorbed on a gold-labeled pad; a T line (antigen detection test strip) or a C line (antibody detection test strip) marked on a nitrocellulose membrane by anti-porcine circovirus type 2 CAP recombinant protein polyclonal rabbit serum is assembled by a PVC plate, a sample pad, a gold label pad, the nitrocellulose membrane and a water absorption pad in sequence.
After all parts of the test strip are assembled, the test strip is cut into strips with the width of 4mm on a cutting machine, and the strips are sealed and stored for later use, so that the utilization rate of the test strip is improved.
The porcine circovirus type 2 CAP recombinant protein (CAP recombinant protein for short) is a denucleated positioning signal, and is obtained by purifying a genetic engineering recombinant protein which is provided with a His label and is expressed to supernatant by using a prokaryotic expression system through a nickel column at low temperature, wherein the porcine circovirus type 2 CAP recombinant protein is specifically combined with porcine circovirus type 2 positive serum.
The existing detection method of porcine circovirus type 2 antigen or antibody colloidal gold has high requirements on the antigen amount in serum. The invention is provided withPurification by nickel columnThe porcine circovirus type 2 CAP recombinant protein is specially prepared, and an accurate result can still be stably detected under the condition of a smaller amount of antigen in a serum sample to be detected, so that the recognition rate is improved, and the technical problem that the original small amount of antigen cannot be recognized is solved.
The polyclonal rabbit serum for resisting the porcine circovirus type 2 CAP recombinant protein is obtained by collecting rabbit serum after immunizing a New Zealand white rabbit with the porcine circovirus type 2 CAP recombinant protein, coupling the rabbit serum with the porcine circovirus type 2 CAP recombinant protein through CNBr activated sepharose FF, and purifying the coupled rabbit serum.
The test strip uses the judgment standard as follows:
when the T line and the C line can be clearly seen, the T line and the C line are red, the lines are single, clear and light in background color, and then the detection result of the serum sample to be detected is judged to be positive;
when the T line cannot be clearly seen but the C line can be clearly seen, and the C line is red, the detection result of the serum sample to be detected is judged to be negative;
and if the T line and the C line cannot be clearly seen, namely the T line and the C line are not red, judging that the detection result of the serum sample to be detected is invalid.
The porcine circovirus type 2 CAP recombinant protein is prepared by the following method:
1) design of primers and PCR amplification:
four primer sequences of two pairs of primers are designed and synthesized by utilizing a PCV2 sequence, and PCR amplification is carried out by taking the recombinant plasmid pMD-PCV as a template, wherein the four primer sequences are as follows:
cap-F1: 5-ctggatccaatggcatcttcaacacccgc-3 as shown in SEQ ID NO. 1;
cap-R1: 5-agcagggccagaattcaaccttaacctttc-3 as shown in SEQ ID NO. 2;
cap-F2: 5-ggttgaattctggccctgctccccaatcac-3 as shown in SEQ ID NO. 3;
cap-R2: 5-cccaagctttcacttagggttaagtggggg-3 as shown in SEQ ID NO. 4;
the cap-F1 and the cap-R2 are respectively provided with BamH I and Hind III enzyme cutting sites.
The concentration of the solutions of cap-F1, cap-R1, cap-F2 and cap-R2 is 0.5 mu mol/mu l.
Firstly, respectively carrying out first round PCR amplification on two groups of which one group is cap-F1 and cap-R1 and one group is cap-F2 and cap-R2, respectively, carrying out hot start at 94 ℃ for 5 minutes, denaturation at 94 ℃ for 45 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, circulating for 30 times, and finally extension at 72 ℃ for 10 minutes;
then mixing two products obtained by two groups of PCR amplification by the mass of 1:1 solution to be used as a template of a second round, carrying out fusion PCR amplification of the second round by taking F1 and R2 as primers, carrying out denaturation at 94 ℃ for 45 seconds, annealing at 60 ℃ for 30 seconds, extending at 72 ℃ for 60 seconds, circulating for 20 times, and finally extending at 72 ℃ for 10 minutes;
finally obtaining a final PCR amplification product;
2) constructing a prokaryotic expression vector and performing induced expression:
carrying out mass recovery on the final PCR amplification product by using a gel recovery test strip, carrying out double digestion on a pET32a plasmid and the final PCR amplification product by using BamH I and Hind III, then connecting and converting the plasmid and the final PCR amplification product to BL21 competent cells, selecting a monoclonal colony, adding the colony into 1mM IPTG after propagation, and carrying out low-temperature induction expression in a shaking table at 16 ℃ to obtain a culture medium;
3) and (3) purifying the recombinant protein:
centrifuging the culture medium for 5 minutes at 8000g of centrifugal force, collecting bacterial liquid, and adding 7ml of PBS for heavy suspension; and (3) ultrasonically crushing until bacterial liquid is clear, centrifuging for 5 minutes at 8000g of centrifugal force, collecting supernatant, separating and purifying target protein by a nickel column, and verifying the size, purity and antigenicity of the protein by SDS-PAGE and western blot after specific implementation.
According to the invention, an immune program is formulated by utilizing the porcine circovirus type 2 CAP recombinant protein expressed by escherichia coli pronucleus, a polyclonal antibody is prepared by immunizing a New Zealand white rabbit, and the polyclonal antibody is specifically purified by coupling the porcine circovirus type 2 CAP recombinant protein with CNBr activated sepharose FF.
The polyclonal rabbit serum for resisting the porcine circovirus type 2 CAP recombinant protein is prepared by the following steps:
using porcine circovirus type 2 CAP recombinant protein obtained by separation and purification of a nickel column as an antigen, immunizing 2 New Zealand white rabbits by a multipoint injection method for 1 time every 2 weeks for 3 times, immunizing for the first time with a Freund's complete adjuvant, then immunizing for the second time with a Freund's incomplete adjuvant, collecting blood from the heart after 10 days of last immunization, and separating serum; then, coupling the CNBr activated sepharose FF with the porcine circovirus type 2 CAP recombinant protein, and purifying through the sepharose to obtain immune rabbit serum containing an IgG antibody of the specificity anti-porcine circovirus type 2 CAP recombinant protein.
Secondly, a preparation method of the porcine circovirus type 2 antigen or antibody colloidal gold test reagent strip, wherein the test strip is prepared as follows:
(1) preparing a colloidal gold solution: 5ml of 1% HAuCl4Quickly adding into 500ml boiling water, adding sodium citrate 0.1125g, heating for 5min, adjusting rotation speed to cool the solution to 50 deg.C, and sealing at 4 deg.C;
(2) preparing a gold-labeled protein solution: adding 12 mul of K with the concentration of 0.2mol/L into each 1ml of colloidal gold solution2CO3 solution and 10 mu g of porcine circovirus type 2 CAP recombinant prepared by nickel column separation and purificationAdding 10% Bovine Serum Albumin (BSA) solution to make the final concentration 1%, stirring and oscillating for 30min, standing in a refrigerator at 4 deg.C for 2h, centrifuging at differential speed, collecting gold-labeled protein, dissolving in buffer solution at 4 deg.C, and storing to obtain gold-labeled protein solution;
(3) preparing a test strip: arranging a sample pad and a water absorption pad at two ends of a PVC (polyvinyl chloride) plate respectively, arranging a nitrocellulose membrane between the sample pad and the water absorption pad, wherein two ends of the nitrocellulose membrane are tightly jointed with the sample pad and the water absorption pad respectively, arranging a gold label pad, a T line and a C line on the nitrocellulose membrane in sequence from the sample pad to the water absorption pad, adsorbing a 1:5 diluted gold label protein solution on the gold label pad, and sealing the nitrocellulose membrane for 1 h; wherein, the T line of the test strip for detecting the antibody is arranged to be protein A recombinant protein with the concentration of 4mg/ml, and the C line is arranged to be polyclonal rabbit serum of anti-porcine circovirus type 2 CAP recombinant protein with the concentration of 0.5 mg/ml; the test strip T line for detecting the antigen is arranged into polyclonal rabbit serum of anti-porcine circovirus type 2 CAP recombinant protein with the concentration of 0.5mg/ml, and the C line is arranged into goat anti-rabbit IgG polyclonal antibody;
after all parts of the test strip are assembled, the test strip is cut into strips with the width of 4mm on a cutting machine, and the strips are sealed and stored for later use.
The PVC board below the sample pad is provided with a detection hole, and the detection hole is used for adding a serum sample to be detected.
Thirdly, the application method of the reagent strip for detecting the porcine circovirus type 2 antigen or antibody colloidal gold comprises the following steps:
(1) and (3) detection procedures: diluting a serum sample to be detected by using a sample diluent, adding 100 mu l of a stock solution of the serum sample to be detected, diluted according to a volume ratio of 1:50, diluted according to a volume ratio of 1:100 and diluted according to a volume ratio of 1:200 into sample areas at the lower ends of different test strips, standing for 5-10min, and observing;
(2) and (4) judging a result: in each test strip for sample detection, the following judgment method is adopted:
when the T line and the C line can be clearly seen, the T line and the C line are red, the lines are single, clear and light in background color, and then the detection result of the serum sample to be detected is judged to be positive;
when the T line cannot be clearly seen but the C line can be clearly seen, and the C line is red, the detection result of the serum sample to be detected is judged to be negative;
and if the T line and the C line cannot be clearly seen, namely the T line and the C line are not red, judging that the detection result of the serum sample to be detected is invalid.
The detection sample of the test strip is serum. For whole blood samples, the samples are placed at 37 ℃ for 2 hours or at 4 ℃ overnight, then centrifuged at 1000g for 10 minutes in a centrifuge, and the supernatant is taken for detection.
The colloidal gold test strip can quickly detect the antigen or antibody in the pig serum, the colloidal gold test strip contains the colloidal gold CAP recombinant protein which is the dominant epitope peptide of the denucleation positioning signal and is provided with the His label, and the colloidal gold test strip is subjected to low-temperature induction expression to obtain supernatant through a prokaryotic expression system; polyclonal rabbit serum of anti-porcine circovirus type 2 CAP recombinant protein marked on a T line (antigen detection test strip) or a C line (antibody detection test strip) is obtained by coupling CAP recombinant protein through CNBr activated sepharose FF and purifying.
Compared with the prior art, the invention has the advantages and positive effects that:
firstly, the epitope peptide sequence selected by the invention is a highly conserved segment in PCV2, and has good immunogenicity, so that the detection result has good specificity.
And the anti-CAP rabbit polyclonal antibody used in the invention is a polyclonal antibody which is purified again after the CNBr activated sepharose FF coupling CAP recombinant protein, has stronger capability of identifying and capturing antigens in a sample and better specificity, can identify corresponding antigens in serum with lower antigen content, and has obvious advantages and innovation compared with the test strip which can only detect the antigens in tissues in the prior art.
Thirdly, the antigen detection test strip and the antibody detection test strip are combined for use, so that the infection of the current disease or the past infection can be judged, and the method has practical reference significance for prevention and control of diseases.
Fourthly, the time required by detection is greatly shortened, only 20 minutes are needed at most from the time of obtaining a serum sample to the time of finally obtaining a detection result, other special equipment is not needed, the requirement of detection hardware is lowered, and the method can be widely popularized and used in basic departments.
In summary, the invention has the advantages of high sensitivity, strong specificity, better stability, simple operation, capability of better meeting the requirements of different levels and easy popularization in basic level detection.
Drawings
FIG. 1 is a graph showing the results of induced expression of recombinant CAP protein.
FIG. 2 is a schematic diagram of a test strip.
Fig. 3 is a diagram illustrating result determination.
FIG. 4 shows the result of the sensitivity test of the antigen test strip.
FIG. 5 is a graph showing the test results of the antibody test strip.
FIG. 6 is a graph showing the test results of the antigen test strip.
Detailed Description
The present technology is further described in conjunction with the appended drawings and the specific embodiments, it is to be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The instruments and equipment involved in the following examples are conventional instruments and equipment unless otherwise specified; the related reagents are all conventional reagents in the market, if not specifically indicated; the test methods involved are conventional methods unless otherwise specified.
The examples of the invention are as follows:
example 1 preparation of porcine circovirus type 2 CAP antigen
A PCV2(GU325755) sequence published by GenBank is taken as a reference, a corresponding fragment is amplified and connected to a prokaryotic expression vector pET32a, a prokaryotic expression system is utilized to express and obtain a soluble recombinant protein, namely the porcine circovirus type 2 CAP recombinant protein, the corresponding gene sequence is shown as SEQ ID NO.5, the recombinant protein is used as an immune antigen of PCV2 after HIS affinity purification, and the protein purification result is shown as figure 1.
Example 2 preparation of polyclonal antibody against porcine circovirus type 2 CAP antigen
(1) Taking 3 New Zealand white rabbits (2.5 Kg), adding equal volume of Freund's complete adjuvant to emulsify the initial immune antibody according to the dosage of 1mg CAP recombinant protein, and injecting 6-8 spots of 0.1-0.2ml each at the back of the body. Immunizations were performed every two weeks, followed by emulsification with Freund's incomplete adjuvant. Blood was collected from the heart 10 days after the third immunization.
(2) The pH of the carbonate buffer solution of recombinant CAP protein (10mg) was adjusted to 9.0, 1ml of CNBr Sepharose FF was aspirated and the solvent on the surface was washed. And soaking the filler into the recombinant protein buffer solution, and shaking and mixing uniformly for 6 hours in a shaking table at 25 ℃. Then, blocking treatment was continued for 6 hours by adding 0.1mol/L Tris-HCl (pH 8.3). The packing was packed into a column and 10 bed volumes were washed with 1mol/L NaCl solution.
(3) Preparing a gold-labeled protein solution: adjusting the pH value of the colloidal gold solution to 8.2, dropwise adding the monoclonal antibody until the final concentration is 12.5 mu g/ml, adding a 5% Bovine Serum Albumin (BSA) solution until the final concentration is 1%, continuously stirring and oscillating for 30min, standing for 2h in a refrigerator at 4 ℃, collecting gold-labeled protein through differential centrifugation, and dissolving the gold-labeled protein with a buffer solution at 4 ℃ for storage;
(4) preparing a test strip: referring to fig. 2, the test strip consists of a PVC plate, a sample pad, a gold label pad, a nitrocellulose membrane, and a water absorbent pad, and the upper end is a hand-held part, i.e., a water absorbent pad part; the middle end is a reaction area, namely a nitrocellulose membrane area, wherein a line C is a quality control line, goat anti-mouse IgG is coated according to 2mg/ml, a line T is a detection line, an anti-toxoplasma SAG3 monoclonal antibody is coated according to 2mg/ml, and the optimal sealing condition of the nitrocellulose membrane is 1 h; placing a gold-labeled pad on the nitrocellulose membrane, diluting the gold-labeled antibody complex according to a ratio of 1:5, and adsorbing the gold-labeled antibody complex; the lower end is a sample area, namely a sample pad area; after all parts of the test strip are assembled, cutting the test strip into strips with the width of 4mm on a cutting machine, and sealing and storing for later use;
(5) and (3) detection procedures: diluting the serum to be detected with normal saline or PBS, adding 100 μ l of the diluted serum into a sample area at the lower end of the test strip, standing for 10-15min, and observing;
(6) and (4) judging a result: in the test strip for sample detection, a T line and a C line can be clearly seen, and if the lines are single, clear and light in background color, the detection result of the sample is judged to be positive; in the test paper strip for sample detection, the T line cannot be clearly seen, but the C line is clearly red, the detection result of the sample is judged to be negative, and the T line and the C line are not red, so the detection result is invalid. See fig. 3.
On the premise that all the test strips for detection can clearly see the C line, clear red T lines and red C lines can be seen on the test strips for positive standard serum, clear C lines can be seen but the T lines cannot be seen on the test strips for negative standard serum, the lines are single, clear and light in background color, the result of sample detection can be judged, and otherwise, the result is redone.
The test sample of the test strip is serum, a whole blood sample is required to be placed at 37 ℃ for 2 hours or at 4 ℃ overnight and then is centrifuged in a centrifuge for 10 minutes at 1000g, and the supernatant is taken for detection.
EXAMPLE 3 determination of the sensitivity of detection of antigen test strips
CAP recombinant protein is diluted by PBS in a multiple ratio from 70 mug/mL to 14 mug/mL, 2.8 mug/mL, 0.56 mug/mL, 112ng/mL, 22.4ng/mL and 4.48ng/mL, and each diluted CAP recombinant protein and PBS used as a control are dripped into an antigen detection test strip, and the result is shown in FIG. 4, 22.4ng/mL CAP recombinant protein can be detected by the test strip at the lowest energy, and the test strip has good detection sensitivity.
Example 4 test strip detection of PCV2 antibody in porcine serum
When the PCV2 antigen detection test strip is used, a serum sample of a pig to be detected is diluted into a sample solution to be detected by using normal saline or PBS1:50, 1:100 and 1:200, 100 mu l of the sample solution is respectively sucked and added into a sample area at the lower end of the test strip, and the sample solution is kept stand for 5-10min and then observed. The red-brown lines appearing on the C lines of the T line indicate that the sample is positive in PCV2, the red-brown lines appearing on the blank C lines of the T line indicate that the sample is negative in PCV2, and the absence of lines appearing on the test strip indicates that the test strip is failed. The results of the detection after 1 part of ELISA positive serum sample and 1 part of ELISA negative serum sample were diluted respectively are shown in FIG. 5, the negative sample stock solution and the samples diluted at 1:50, 1:100 and 1:200 did not show T-line bands, and the positive sample diluted at 1:50, 1:100 and 1:200 showed T-line bands, which were consistent with the ELISA results.
Example 5 test strip detection of PCV2 antigen in porcine serum
When the PCV2 antigen detection test strip is used, 100 mu l of a pig serum sample to be detected is sucked and added into a sample area at the lower end of the test strip, and the pig serum sample is observed after standing for 5-10 min. The red-brown lines appearing on the C lines of the T line indicate that the sample is positive in PCV2, the red-brown lines appearing on the blank C lines of the T line indicate that the sample is negative in PCV2, and the absence of lines appearing on the test strip indicates that the test strip is failed. The results of the detection of 12 ELISA-positive sera by using the antigen test strip are shown in FIG. 6, 2 bands appeared in 11 samples, which are positive for PCV2, and only a band appeared in C line in 1 sample, which is negative for PCV2, and the coincidence rate with the ELISA result is 91.7%.
On the premise that all the test strips for detection can clearly see the C line, clear red T lines and red C lines can be seen on the test strips for positive standard serum, clear C lines can be seen but the T lines cannot be seen on the test strips for negative standard serum, the lines are single, clear and light in background color, the result of sample detection can be judged, and otherwise, the result is redone.
While the invention has been described in connection with a preferred embodiment, it will be understood that various changes and modifications may be effected therein by one skilled in the art after reading the foregoing description, and equivalents may be resorted to, falling within the scope of the invention as defined by the appended claims.
The gene sequence table related in the invention is as follows:
SEQ ID No.1；
name: Cap-F1 primer gene sequence
The source is as follows: artificially synthesized
ctggatccaatggcatcttcaacacccgc
SEQ ID No.2；
Name: Cap-R1 primer gene sequence
The source is as follows: artificially synthesized
agcagggccagaattcaaccttaacctttc
SEQ ID No.3；
Name: Cap-F2 primer gene sequence
The source is as follows: artificially synthesized
ggttgaattctggccctgctccccaatcac
SEQ ID No.4；
Name: Cap-R2 primer gene sequence
The source is as follows: artificially synthesized
cccaagctttcacttagggttaagtggggg
SEQ ID No.5；
Name: porcine circovirus type 2 CAP recombinant protein gene sequence
The source is as follows: porcine circovirus type 2 CAP recombinant protein
Sequence listing
<110> Zhejiang province academy of medical science
<120> porcine circovirus type 2 antigen or antibody colloidal gold rapid detection test strip and method
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ctggatccaa tggcatcttc aacacccgc 29
<210>2
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
agcagggcca gaattcaacc ttaacctttc 30
<210>3
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ggttgaattc tggccctgct ccccaatcac 30
<210>4
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cccaagcttt cacttagggt taagtggggg 30
<210>5
<211>1077
<212>DNA
<213> Unknown (Unknown)
<400>5
atgagcgata aaattattca cctgactgac gacagttttg acacggatgt actcaaagcg 60
gacggggcga tcctcgtcga tttctgggca gagtggtgcg gtccgtgcaa aatgatcgcc 120
ccgattctgg atgaaatcgc tgacgaatat cagggcaaac tgaccgttgc aaaactgaac 180
atcgatcaaa accctggcac tgcgccgaaa tatggcatcc gtggtatccc gactctgctg 240
ctgttcaaaa acggtgaagt ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg 300
aaagagttcc tcgacgctaa cctggccggt tctggttctg gccatatgca ccatcatcat 360
catcattctt ctggtctggt gccacgcggt tctggtatga aagaaaccgc tgctgctaaa 420
ttcgaacgcc agcacatgga cagcccagat ctgggtaccg acgacgacga caaggccatg 480
gctgatatcg gatccaatgg catcttcaac acccgcctct cccgcaccat cggttatact 540
gtcaagaaaa ccacagtcag aacgccctcc tggaatgtgg acatgatgag atttaatatt 600
aatgattttc ttcccccagg agggggctca aaccccctca ctgtgccctt tgaatactac 660
agaataagaa aggttaaggt tgaattctgg ccctgctccc caatcaccca gggtgacagg 720
ggagtgggct ccactgctgt tattctagat gataactttg taacaaaggc caatgcccta 780
acctatgacc cctatgtaaa ctactcctcc cgccatacca taacccagcc cttctcctac 840
cactcccggt actttacccc gaaacctgtc cttgatagga caatcgatta cttccaaccc 900
aataacaaaa gaaatcaact ctggctgaga ctacaaacta ctggaaatgt agaccatgta 960
ggcctcggca ctgcgttcga aaacagtata tacgaccagg actacaatat ccgtataacc 1020
atgtatgtac aattcagaga atttaatctt aaagaccccc cacttaaccc taagtga 1077
Claims (9)
1. A colloidal gold test strip for detecting porcine circovirus type 2 antigen or antibody comprises a PVC plate, a sample pad, a gold label pad, a nitrocellulose membrane, a water absorption pad, a C line and a T line, wherein the water absorption pad is arranged at the upper end of the PVC plate and is used as a handheld part; the middle end of the PVC plate is a reaction area, a nitrocellulose membrane is arranged on the reaction area, a gold label pad, a C line and a T line are arranged on the nitrocellulose membrane, the C line is a quality control line, and the T line is a detection line; the lower end of the PVC plate is provided with a sample pad which is used as an area of a serum sample to be detected; the method is characterized in that: the gold-labeled pad is adsorbed with gold-labeled protein; when the test strip is used for detecting antigen colloidal gold, the gold-labeled protein adsorbed on the gold-labeled pad is porcine circovirus type 2 CAP recombinant protein labeled by colloidal gold, the T line on the nitrocellulose membrane layer is polyclonal rabbit serum resisting the porcine circovirus type 2 CAP recombinant protein, and the C line is goat anti-rabbit IgG polyclonal antibody; when the test strip is used for antibody colloidal gold detection, the gold-labeled protein adsorbed on the gold-labeled pad is porcine circovirus type 2 CAP recombinant protein labeled by colloidal gold, the T line on the nitrocellulose membrane layer is protein A recombinant protein, and the C line is polyclonal rabbit serum resisting the porcine circovirus type 2 CAP recombinant protein.
2. The reagent strip for detecting porcine circovirus type 2 antigen or antibody colloidal gold according to claim 1, which is characterized in that: the porcine circovirus type 2 CAP recombinant protein is obtained by removing a core positioning signal, carrying His label, and carrying out low-temperature induction expression on the recombinant protein of supernatant by using a prokaryotic expression system, and finally purifying through a nickel column, wherein the porcine circovirus type 2 CAP recombinant protein is specifically combined with porcine circovirus type 2 positive serum.
3. The reagent strip for detecting porcine circovirus type 2 antigen or antibody colloidal gold according to claim 1, which is characterized in that: the polyclonal rabbit serum for resisting the porcine circovirus type 2 CAP recombinant protein is obtained by collecting rabbit serum after immunizing a New Zealand white rabbit with the porcine circovirus type 2 CAP recombinant protein, coupling the rabbit serum with the porcine circovirus type 2 CAP recombinant protein through CNBr activated sepharose FF, and purifying the coupled rabbit serum.
4. The reagent strip for detecting porcine circovirus type 2 antigen or antibody colloidal gold according to claim 1, which is characterized in that: the test strip uses the judgment standard as follows:
when the T line and the C line can be clearly seen, the T line and the C line are red, the lines are single, clear and light in background color, and then the detection result of the serum sample to be detected is judged to be positive;
when the T line cannot be clearly seen but the C line can be clearly seen, and the C line is red, the detection result of the serum sample to be detected is judged to be negative;
and if the T line and the C line cannot be clearly seen, namely the T line and the C line are not red, judging that the detection result of the serum sample to be detected is invalid.
5. The reagent strip for detecting porcine circovirus type 2 antigen or antibody colloidal gold according to claim 1, which is characterized in that: the porcine circovirus type 2 CAP recombinant protein is prepared by the following method:
1) design of primers and PCR amplification:
four primer sequences of two pairs of primers are designed and synthesized by utilizing a PCV2 sequence, and PCR amplification is carried out by taking the recombinant plasmid pMD-PCV as a template, wherein the four primer sequences are as follows:
cap-F1: 5-ctggatccaatggcatcttcaacacccgc-3 as shown in SEQ ID NO. 1;
cap-R1: 5-agcagggccagaattcaaccttaacctttc-3 as shown in SEQ ID NO. 2;
cap-F2: 5-ggttgaattctggccctgctccccaatcac-3 as shown in SEQ ID NO. 3;
cap-R2: 5-cccaagctttcacttagggttaagtggggg-3 as shown in SEQ ID NO. 4;
firstly, respectively carrying out first round PCR amplification on two groups of which one group is cap-F1 and cap-R1 and one group is cap-F2 and cap-R2, respectively, carrying out hot start at 94 ℃ for 5 minutes, denaturation at 94 ℃ for 45 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, circulating for 30 times, and finally extension at 72 ℃ for 10 minutes;
then mixing two products obtained by two groups of PCR amplification by the mass of 1:1 solution to be used as a template of a second round, carrying out fusion PCR amplification of the second round by taking F1 and R2 as primers, carrying out denaturation at 94 ℃ for 45 seconds, annealing at 60 ℃ for 30 seconds, extending at 72 ℃ for 60 seconds, circulating for 20 times, and finally extending at 72 ℃ for 10 minutes;
finally obtaining a final PCR amplification product;
2) constructing a prokaryotic expression vector and performing induced expression:
recovering the final PCR amplification product by using a gel recovery test strip, carrying out double digestion on the pET32a plasmid and the final PCR amplification product by using BamH I and Hind III, then connecting and transforming the plasmid and the final PCR amplification product to BL21 competent cells, selecting a monoclonal colony, adding the colony into 1mM IPTG after propagation, and carrying out low-temperature induction expression in a shaking table at 16 ℃ to obtain a culture medium;
3) and (3) purifying the recombinant protein:
centrifuging the culture medium for 5 minutes at 8000g of centrifugal force, collecting bacterial liquid, and adding 7ml of PBS for heavy suspension; and (3) carrying out ultrasonic crushing until bacterial liquid is clear, centrifuging for 5 minutes at 8000g of centrifugal force, collecting supernatant, and finally separating and purifying target protein from the supernatant through a nickel column.
6. The reagent strip for detecting porcine circovirus type 2 antigen or antibody colloidal gold according to claim 1, which is characterized in that: the polyclonal rabbit serum for resisting the porcine circovirus type 2 CAP recombinant protein is prepared by the following steps: using porcine circovirus type 2 CAP recombinant protein obtained by separation and purification of a nickel column as an antigen, immunizing 2 New Zealand white rabbits by a multipoint injection method for 1 time every 2 weeks for 3 times, immunizing for the first time with a Freund's complete adjuvant, then immunizing for the second time with a Freund's incomplete adjuvant, collecting blood from the heart after 10 days of last immunization, and separating serum; then, coupling the CNBr activated sepharose FF with the porcine circovirus type 2 CAP recombinant protein, and purifying through the sepharose to obtain immune rabbit serum containing an IgG antibody of the specificity anti-porcine circovirus type 2 CAP recombinant protein.
7. The preparation method of the reagent strip for detecting the porcine circovirus type 2 antigen or antibody colloidal gold, which is applied to any one of claims 1 to 6, is characterized by comprising the following steps:
(1) preparing a colloidal gold solution: 5ml of 1% HAuCl4Quickly adding into 500ml boiling water, adding sodium citrate 0.1125g, heating for 5min, adjusting rotation speed to cool the solution to 50 deg.C, and sealing at 4 deg.C;
(2) preparing a gold-labeled protein solution: adding 12 mul of K with the concentration of 0.2mol/L into each 1ml of colloidal gold solution2Adding a CO3 solution and 10 mu g of porcine circovirus type 2 CAP recombinant protein prepared by nickel column separation and purification, adding 10% Bovine Serum Albumin (BSA) solution to make the final concentration of the protein 1%, continuing stirring and oscillating for 30min, then standing for 2h in a refrigerator at 4 ℃, collecting the gold-labeled protein through differential centrifugation, dissolving the gold-labeled protein with a buffer solution at 4 ℃ and storing to obtain a gold-labeled protein solution;
(3) preparing a test strip: respectively arranging a sample pad and a water absorption pad at two ends of a PVC (polyvinyl chloride) plate, arranging a nitrocellulose membrane between the sample pad and the water absorption pad, sequentially arranging a gold-labeled pad, a T line and a C line on the nitrocellulose membrane from the sample pad to the water absorption pad, adsorbing a gold-labeled protein solution diluted by 1:5 on the gold-labeled pad, and sealing the nitrocellulose membrane for 1 h; wherein, the T line of the test strip for detecting the antibody is arranged to be protein A recombinant protein with the concentration of 4mg/ml, and the C line is arranged to be polyclonal rabbit serum of anti-porcine circovirus type 2 CAP recombinant protein with the concentration of 0.5 mg/ml; the test strip T line for detecting the antigen is arranged to be polyclonal rabbit serum of anti-porcine circovirus type 2 CAP recombinant protein with the concentration of 0.5mg/ml, and the C line is arranged to be goat anti-rabbit IgG polyclonal antibody.
8. The method for preparing the reagent strip for detecting porcine circovirus type 2 antigen or antibody colloidal gold according to claim 7, which is characterized in that:
the PVC board below the sample pad is provided with a detection hole, and the detection hole is used for adding a serum sample to be detected.
9. The use method of the colloidal gold test reagent strip for the porcine circovirus type 2 antigen or antibody according to any one of claims 1 to 6, which is characterized by comprising the following steps:
(1) and (3) detection procedures: diluting a serum sample to be detected by using a sample diluent, adding 100 mu l of a stock solution of the serum sample to be detected, diluted according to a volume ratio of 1:50, diluted according to a volume ratio of 1:100 and diluted according to a volume ratio of 1:200 into sample areas at the lower ends of different test strips, standing for 5-10min, and observing;
(2) and (4) judging a result: in each test strip for sample detection, the following judgment method is adopted:
when the T line and the C line can be clearly seen, the T line and the C line are red, the lines are single, clear and light in background color, and then the detection result of the serum sample to be detected is judged to be positive;
when the T line cannot be clearly seen but the C line can be clearly seen, and the C line is red, the detection result of the serum sample to be detected is judged to be negative;
and if the T line and the C line cannot be clearly seen, namely the T line and the C line are not red, judging that the detection result of the serum sample to be detected is invalid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911045715.8A CN110687302A (en) | 2019-10-30 | 2019-10-30 | Test paper strip and method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911045715.8A CN110687302A (en) | 2019-10-30 | 2019-10-30 | Test paper strip and method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110687302A true CN110687302A (en) | 2020-01-14 |
Family
ID=69114860
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911045715.8A Pending CN110687302A (en) | 2019-10-30 | 2019-10-30 | Test paper strip and method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110687302A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110903356A (en) * | 2019-12-16 | 2020-03-24 | 中国农业大学 | Porcine circovirus type II antigen and colloidal gold immunochromatographic test strip for detecting porcine circovirus type II antibody |
| CN114958776A (en) * | 2022-06-30 | 2022-08-30 | 天康制药(苏州)有限公司 | PCV2 monoclonal antibody and hybridoma cell strain 1A6 secreting same |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1584599A (en) * | 2004-06-15 | 2005-02-23 | 浙江大学 | Reagent strip for determining antibody and antigen of swine circular virus II |
| CN101833003A (en) * | 2010-05-26 | 2010-09-15 | 吉林大学 | Vesicular stomatitis virus antibody colloidal goldtest paper tape and preparation method thereof |
| CN106496328A (en) * | 2016-11-22 | 2017-03-15 | 浙江达美生物技术有限公司 | The preparation method of hyaluronic acid binding protein polyclonal antibody |
| CN107190012A (en) * | 2016-03-14 | 2017-09-22 | 苏州派动生物技术有限公司 | Recombinant mutant pig circular ring virus 2 virus capsid protein |
| CN109942700A (en) * | 2019-03-21 | 2019-06-28 | 山西大学 | A kind of recombinant type buckwheat trypsase inhibitor mutant and trypsase affinitive material |
-
2019
- 2019-10-30 CN CN201911045715.8A patent/CN110687302A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1584599A (en) * | 2004-06-15 | 2005-02-23 | 浙江大学 | Reagent strip for determining antibody and antigen of swine circular virus II |
| CN101833003A (en) * | 2010-05-26 | 2010-09-15 | 吉林大学 | Vesicular stomatitis virus antibody colloidal goldtest paper tape and preparation method thereof |
| CN107190012A (en) * | 2016-03-14 | 2017-09-22 | 苏州派动生物技术有限公司 | Recombinant mutant pig circular ring virus 2 virus capsid protein |
| CN106496328A (en) * | 2016-11-22 | 2017-03-15 | 浙江达美生物技术有限公司 | The preparation method of hyaluronic acid binding protein polyclonal antibody |
| CN109942700A (en) * | 2019-03-21 | 2019-06-28 | 山西大学 | A kind of recombinant type buckwheat trypsase inhibitor mutant and trypsase affinitive material |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110903356A (en) * | 2019-12-16 | 2020-03-24 | 中国农业大学 | Porcine circovirus type II antigen and colloidal gold immunochromatographic test strip for detecting porcine circovirus type II antibody |
| CN110903356B (en) * | 2019-12-16 | 2021-07-13 | 中国农业大学 | Porcine circovirus type II antigen and colloidal gold immunochromatographic test strip for detecting porcine circovirus type II antibody |
| CN114958776A (en) * | 2022-06-30 | 2022-08-30 | 天康制药(苏州)有限公司 | PCV2 monoclonal antibody and hybridoma cell strain 1A6 secreting same |
| CN114958776B (en) * | 2022-06-30 | 2024-02-06 | 天康制药股份有限公司 | PCV2 monoclonal antibody and hybridoma cell strain 1A6 secreting same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104862285A (en) | Porcine epidemic diarrhea virus antibody capture based ELISA detection method and application | |
| CN110687302A (en) | Test paper strip and method for rapidly detecting porcine circovirus type 2 antigen or antibody colloidal gold | |
| CN114736290B (en) | Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application | |
| CN105925597B (en) | Concatenated recombination of a kind of PEDV S gene Main Antigenic and its preparation method and application | |
| CN111912991A (en) | Test strip for detecting serum antibody of African swine fever virus and application thereof | |
| CN116217737A (en) | P49 mutant fusion protein of African swine fever virus immunogen, recombinant vector, engineering bacteria, preparation method and application | |
| CN113588946B (en) | Recombinant protein and method for detecting mycoplasma hyopneumoniae antibody by indirect ELISA (enzyme-linked immunosorbent assay) | |
| WO2010048252A1 (en) | Lawsonia intracellularis vaccines | |
| CN114152748A (en) | Double-antibody sandwich ELISA diagnostic kit for detecting African swine fever virus and method thereof | |
| CN112125961B (en) | Bovine viral diarrhea-bovine infectious rhinotracheitis bigeminal subunit fusion vaccine and identification method thereof | |
| JP2001507447A (en) | H. pylori diagnostics | |
| US20010002311A1 (en) | Treponema pallidum fused antigen and assay for anti-treponema pallidum antibodies using the same fused antigen | |
| CN112457414A (en) | Cat herpesvirus type I gB-gD recombinant protein and preparation method and application thereof | |
| CN109679970B (en) | Preparation method for rapidly detecting feline herpes type I virus | |
| CN116284431A (en) | Preparation and application of novel coronavirus polyclonal antibody | |
| CN112730829B (en) | Colloidal gold test strip for rapidly detecting oyster herpesvirus OsHV-1 and application thereof | |
| CN114807178A (en) | C-terminal multi-epitope recombinant antigen of African swine fever virus P72 protein and application thereof | |
| CN113698474B (en) | African swine fever polyclonal antibody and African swine fever antigen detection test strip | |
| CN111208302B (en) | Chemiluminescence detection kit for detecting O-type antibody of pig foot-and-mouth disease by using multi-epitope tandem protein | |
| CN110540597B (en) | Preparation method of latex microsphere immunochromatographic test paper based on haemophilus influenzae surface protein | |
| CN113325176A (en) | Double-antibody sandwich direct ELISA (enzyme-Linked immuno sorbent assay) method for detecting avian leukosis P27 | |
| CN113980908A (en) | Actinobacillus pleuropneumoniae ApxIV protein monoclonal antibody and blocking ELISA kit thereof | |
| Johnson et al. | Use of a recombinant Coccidioides immitis complement fixation antigen-chitinase in conventional serological assays | |
| Mohabati et al. | Expression and Purification of Recombinant ROP1 of Toxoplasma gondii in Bacteria | |
| CN105424928A (en) | Immunochromatography strip detecting porcine reproductive and respiratory syndrome virus antibodies and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200114 |
|
| RJ01 | Rejection of invention patent application after publication |