RU2795055C1 - Immunobiological agent based on virus-like particles for induction of specific immunity against infection caused by human rotavirus a - Google Patents

Abstract

FIELD: biotechnology; genetic engineering.

SUBSTANCE: invention relates to biotechnology and genetic engineering, specifically to immunobiological agent based on virus-like particles of rotavirus A An immunobiological agent based on rotavirus A virus-like particles is described. The agent contains an adjuvant and rotavirus capsid genes (VP2 and VP6), as well as surface proteins VP4 and VP7 of different rotavirus genotypes, specifically G1, G2, G4, G9, P4, P8, synthesized in baculovirus expression system and assembled into trilaminar virus-like particles (VLPs).

EFFECT: invention provides creation of an agent with high safety (as a protein product) and specific immunogenicity and effectiveness for the prevention of rotavirus infection caused by certain rotavirus A genotypes.

4 cl, 8 dwg, 1 tbl, 6 ex

Description

Technical field

The invention relates to the field of biotechnology and genetic engineering, in particular to an immunobiological agent based on virus-like particles of rotavirus A. The agent contains rotavirus capsid genes (VP2 and VP6), as well as surface proteins VP4 and VP7 of different rotavirus genotypes, synthesized in a baculovirus expression system and assembled into three-layer virus-like particles (VLPs). The proposed immunobiological agent can be used to induce specific immunity against infection caused by human rotavirus A.

State of the art

The relevance of the development of antiviral drugs or vaccines for the prevention of rotavirus infection is beyond doubt. The Russian Federation belongs to the regions with a high incidence of acute intestinal infections (AII). Among the foci of group morbidity caused by pathogens with a fecal-oral transmission mechanism, rotavirus infection occupies the 2nd place.

There are significant geographic differences in the prevalence of rotaviruses of different genotypes, and over time there is a change in the occurrence of genotypes in the same territory. According to the reference center for monitoring AEI in the period from 2012-2020, the predominant genotypes of group A rotaviruses are G9P[8], G3P[8], G2P[4], G4P[8], G1P[8], G12P[ 8].

Currently, vaccination is recognized as the only effective method of controlling the incidence rate [World Health Organization. 2018]. There are currently three World Health Organization (WHO) prequalified vaccines: Rotarix monovalent (RV1) vaccine (Glaxo Smith Kline) based on a human rotavirus strain, RotaTeq reassortant pentavalent (RV5) vaccine based on bovine rotavirus and monovalent vaccine Rotavac (Bharat Biotech). Since October 2012, the RotaTeq vaccine has been registered in Russia, and is included in the preventive vaccination schedule for epidemic indications in the Russian Federation [ Order of the Ministry of Health of Russia No. 125n dated 03/21/2014] . Currently, a pilot project for vaccination against rotavirus infection is underway in some regions of the Russian Federation [ http://24.rospotrebnadzor.ru/press/release/101613/ ]. Monitoring of circulating strains of group A rotaviruses is necessary both for a more accurate selection of the antigenic composition of vaccines and for assessing the possible impact of vaccination on the spectrum of circulating genotypes. The efficacy of live oral vaccines was found to be lower among poor and middle-income countries in Africa and Asia than in high-income countries, possibly also due to differences between circulating strains and vaccine antigens.

As a new direction in the fight against rotavirus infection, vaccines based on recombinant technologies have recently been proposed - based on virus-like particles or virus like particles (VLP). Virus-like particles or virus like particles (VLP or VLP) are structures of the order of 100-150 nm in size, which are the result of self-assembly of viral proteins without the nucleic acid of the genome inside.

VLPs can induce T-cell and B-cell immune responses. Due to the large number of repetitive fragments of viral surface and / or core proteins, which are conformational viral epitopes, VLP immunization stimulates dendritic cells that capture the appropriate antigens for presentation to T- and B-lymphocytes [Roy P., Noad R. Virus- like particles as a vaccine delivery system. myths and facts. Hum. Vaccines. 2008; 4 (1): 5-8.]. Because VLPs cannot replicate, they provide a safer alternative to live attenuated virus vaccines. Viral structural proteins in the process of self-assembly can combine into organized macromolecular structures (capsids), which are similar in structure and morphology to natural virions and contain functionally active and immunologically appropriate structural proteins.

VLPs can be produced in various expression systems. The most promising are VLPs based on proteins obtained in the baculovirus expression system. These systems give high levels of expression of recombinant proteins and allow the organization of subsequent large-scale production of the vaccine. VLPs produced in insect cells are considered safer than other expression systems because baculoviruses are found in vegetables and cannot replicate in mammalian cells. In addition, insect cells can be adapted to grow in serum-free, animal product-free media, can be identified by karyotype and isoenzyme analysis, are free of contaminants, adventitious agents, retroviruses, and have been shown to be non-oncogenic. This technology is believed to be safe and used for large-scale production of VLPs [Rong R, Progress in vaccine development based on baculovirus expression vector system PMID:31001944, DOI:10.13345/j.cjb.180301].

Currently, several vaccines have been developed and are at various stages of clinical trials:

- Parenteral vaccine Ro-VLP based on plant virus-like particles. [Natsuki Kurokawa et. al. Safety and immunogenicity of a plant-derived rotavirus-like particle vaccine in adults, toddlers and infants// VaccineVolume 39, Issue 39, 2021, PP 5513-5523];

- Trivalent parenteral subunit rotavirus vaccine VP2-P8 [Michelle J Groome et. al. Safety and immunogenicity of a parenteral trivalent P2-VP8 subunit rotavirus vaccine: a multisite, randomised, double-blind, placebo-controlled trial// Lancet Infect Dis 2020; 20:851-63].

These vaccines cover single rotavirus genotypes, which is insufficient for effective prevention of at least 6 rotavirus genotypes circulating in the Russian Federation.

In addition, with regard to subunit vaccine, a disadvantage of recombinant subunit vaccines is that the antigen presentation may differ from the natural virus and antibodies will be produced that are not able to effectively neutralize the pathogen.

The closest analogue of the claimed invention is a document (EP 1261629 B1, pub. 11/02/2006), which discloses a technical solution related to a recombinant baculovirus containing rotavirus VP2, VP6, VP7 and/or VP4 proteins, and also containing a capsid gene MS2. The patent materials also disclose the production of virus-like particles based on baculovirus. The disadvantage of this technical solution is that this design contains rotavirus surface antigens (VP7 and/or VP4), and P6 and P2 of the same genotype, therefore, does not cause the formation of antibodies against rotavirus surface proteins, specific for Russia rotavirus genotypes, allowing the formation of a specific immune answer.

Thus, there is a need to create VLPs formed by the rotavirus nucleocapsid (VP2, VP6 proteins) and rotavirus surface proteins of 6 VP4 and VP7 genotypes (G1, G2, G4, G9, P4, P8), which are most represented in Russia, allowing the formation of 6 types VLPs that can effectively form a wide range of antibodies and, therefore, induce specific immunity to viral genotypes circulating in the Russian Federation.

Disclosure of the essence of the invention

The technical objective of the invention is to develop an immunobiological agent containing VLPs formed by the rotavirus nucleocapsid (VP2, VP6 proteins) and surface proteins of rotavirus 6 VP4 and VP7 genotypes (G1, G2, G4, G9, P4, P8), and having the ability to effectively form specific immunity to the most represented in Russia 6 genotypes of rotavirus A.

The technical result of the claimed invention consists in expanding the arsenal of immunobiological agents for inducing specific immunity against infection caused by human rotavirus A and consists in creating an agent with a high degree of safety (as a protein drug) and specific immunogenicity and effectiveness for the prevention of rotavirus infection caused by certain rotavirus genotypes A.

The specified technical result is achieved due to the fact that an immunobiological agent has been created containing an adjuvant and several recombinant virus-like three-layer particles consisting of two proteins of the rotavirus capsid genes VP2 and VP6, having the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, and one or several of the VP4 and VP7 surface proteins of different rotavirus genotypes G1, G2, G4, G9, P4, P8, having the nucleotide sequences of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, which are obtained in a baculovirus expression system, while the virus-like particle mimics the rotavirus A virion.

In particular cases, the adjuvant may be an oil adjuvant, an oil-in-water emulsion, in particular a squalene-based water-in-oil emulsion.

Brief description of the drawings

In FIG. Figure 1 shows the results of infection with baculovirus eGFP-Delta92-VP2 of a suspension culture of T.ni insect cells (A. T.ni cell culture, in transmitted light. B. T.ni cell culture infected with wild-type baculovirus, in a fluorescent field. C. Culture eGFP-Delta92-VP2/VP6 baculovirus-infected T.ni cells in a fluorescent field). The results of infection of the T.ni insect cell culture with recombinant baculoviruses with different inserts at the same doses (G-F) and at optimized doses (G-I): D, G - VP2/VP6+VP7(G1)+VP4(P8); E, H - VP2/VP6+VP7; E, I - VP2/VP6+VP4.

In FIG. 2 shows an example of determining the purity of the VLP preparation by the EP method in PAAG. The electrophoregram shows 3 major bands corresponding in molecular weight to the proteins of rotavirus A.

In FIG. 3 shows the results of measuring the specific activity of purified VLP and PBA by ELISA

In FIG. Figure 4 shows the results of visualization of virus-like and viral particles by electron microscopy (baculoviruses that co-infected T. ni. cells are indicated) A. VP2/VP6 B. VP2/VP6+VP4(P8) C. VP2/VP6+VP4(P8) D VP2/VP6+VP7(G1) E. VP2/VP6+VP7(G2) F. VP2/VP6+VP7(G4) F. VP2/VP6+VP7(G9) D. VP2/VP6+VP4(P8)+ VP7(G1) I. Rotavirus A

In FIG. Table 5 describes the results of the detection of specific IgG to the VP6 protein and VLP PBA with different methods of administration with and without adjuvant by ELISA.

In FIG. Figure 6 shows the detection of specific IgG to the VP6 protein PBA by indirect ELISA in the blood sera of piglets on days 0, 14, 28 and 42 of the experiment. Graphs of mean values for each group are presented.

In FIG. 7 shows the results of measuring the titer of virus-neutralizing antibodies in the pH of the sera of piglets on the 28th and 42nd day of immunization for groups 1-3. - intramuscular injection of VLP (concentrations of 30, 150 and 750 mcg / dose, respectively)

In FIG. 8 shows the results of the reaction of blast transformation of peripheral blood monocytes of piglets after the first immunization. The groups of animals are indicated along the abscissa: groups 1-3 - intramuscular injection of VLP (concentrations of 30, 150 and 750 μg / dose, respectively), groups 4-6 - intranasal administration of VLP in combination with att. strain (concentrations 30, 150 and 750 µg/dose, µg/dose, respectively). The values of the ISP are given along the y-axis. * - statistically significant differences p <0.05, ns - CSI values do not differ statistically significantly p >0.05.

Implementation of the invention

Previously, we studied the genetic diversity of rotavirus A in Moscow, and based on these, as well as literature data, the most represented genotypes in the central part of Russia were determined, taking into account the primary sequence of genes encoding VP4 and VP7 proteins. More than 90% of the samples belonged to the G9P[8], G4P[8], G2P[4], G1P[8] genotypes. Thus, 6 genotypes of outer layer proteins (G1, G2, G4, G9, P4, P8), as well as VP2 and VP6 proteins required for HPV assembly, were selected for inclusion in the HPV composition.

To create the VP2/VP6 construct, the sequence of these genes was optimized for expression in insect cells, obtained synthetically, and then cloned into the corresponding regions of the pFastBacDual vector. This vector is designed to create a recombinant baculovirus that simultaneously expresses two different cloned genes. According to the literature data, the addition of eGFP to VP2 does not affect the ability of the chimeric protein to participate in the formation of HPV, while the control over the growth of the recombinant protein in cell culture is greatly simplified by the possibility of visual observation of the process in real time using a fluorescent microscope.

Example 1 Preparation of trilayer virus-like particles using recombinant baculoviruses.

Nucleotide sequences encoding the selected VP4 and VP7 protein genotypes were optimized for production in insect cells and obtained synthetically, then cloned into the pFastBacHTa transfer vector. A feature of this vector is the presence of a polyhistidine fragment gene at the N-terminus of the protein, for product purification by metal affinity chromatography and detection using specific antihistidine mAbs. Each sequence was cloned into a separate transfer vector.

Rotavirus A protein genes were transferred into the baculovirus genome using transfer vectors. After transfection of Sf-21 cells with bacmids containing the genes for VP6 and eGFP-Delta92-VP2 proteins, the next passage of the virus was performed on T. ni cells and the appearance of fluorescence was observed by comparing cells infected with wild-type baculovirus with cells infected with eGFP-Delta92-VP2 /VP6. The results are presented in figure 1 (G-E).

The accumulation kinetics of base VLP eGFP-Delta92-VP2/VP6 was assessed by fluorescence on an inverted Olympus microscope and by indirect ELISA with monoclonal antibodies to polyhistidine. As a result, it was shown that the maximum accumulation of antigens was observed on the second day after infection. However, when co-infected with a recombinant baculovirus with a VP2/VP6 insert with one or two other recombinant baculoviruses (VP4, VP7), there is a significant decrease in the number of infected cells. This may be due to interference between viruses. Reducing the dose of baculoviruses with the insertion of VP4 and VP7 made it possible to solve this problem and achieve the required level of expression of the VP2/VP6 genes during coinfection comparable to that during monoinfection (Fig. 1 (G-I).

Thus, the optimal recombinant baculoviruses for each construct were selected, as well as the duration of incubation of the culture of insect cells infected with various recombinant baculoviruses.

The data obtained were used to carry out co-infection, that is, the simultaneous infection of a continuous T.ni insect cell line with various combinations of recombinant baculoviruses.

Structural protein analysis and VLP purity were assessed by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) according to Laemmli (1970). -Rad, USA) under reducing conditions at a constant voltage of 200 V. The separating gel contained 12% acrylamide, 0.5% N,N-methylene-bis-acrylamide, 0.375 M Tris-HCl pH 8.8 and 0.1 % SDS. The focusing gel contained 4% acrylamide, 10% N,N-methylenebisacrylamide in 0.125 M Tris-HCl buffer pH 6.8. For polymerization, 0.025% ammonium persulfate and 0.075% TEMED were added to both gels. The electrode buffer contained 0.025 M Tris-HCl, 0.192 M glycine, pH 8.3, and 0.1% SDS. All test samples contained a lysis buffer with a reducing agent (0.125 M Tris-HCl, pH 6.8, 5% SDS, 0.5% β-mercaptoethanol, 10.8% glycerol, 0.01% bromophenol blue) and were heated for 5 minutes at 100°. The pouring of the gel and the preparation of the electrophoresis apparatus for operation were carried out according to the manufacturer's recommendations. The proteins in the gels were stained for 1 hour with 0.1% Coomassie bright blue (CBB R-350) in an aqueous solution containing 10% acetic acid and 30% methanol. The dye excess was washed with a 10% acetic acid solution for the same time with several changes. 116 kD β-galactosidase was used as molecular weight marker proteins; phosphorylase B - 94 kD, BSA - 66 kD, ovalbumin - 45 kD, anhydrase carbonate - 30 kD, trypsin inhibitor - 20.1 kD. The figure 2 shows an example of the study of three-layer VLP containing VP2, VP6 and VP4.

Thus, it was determined that three rotavirus proteins are synthesized as a result of the synthesis of three-layer particles.

An enzyme immunoassay was performed to evaluate the VP6 viral product. The recombinant VP6 protein was stained with the specific monoclonal antibody RG23B9C5H11 (courtesy of Prof. Linda Saif, OSU). Since the VP2 and VP6 proteins were cloned in the same cassette, the expression of VP6 simultaneously confirmed the expression of VP2.

Thus, a preparation was obtained containing purified trilayer VLPs of rotaviruses.

Example 2 Purification of Rotavirus VLPs.

The culture fluid containing the virus or virus-like particles was subjected to low-speed centrifugation, freeing from cells and cell debris at 1000 rpm for 5 minutes and at 6000 rpm for 20 minutes, respectively (+4°C, Sorval® SS34 rotor) . The supernatant was then used to isolate and purify rotavirus-VLPs by ultracentrifugation.

The resulting clarified suspensions were layered on 6 ml of 25% or 35% (w/v) sucrose prepared in THC buffer (10 mM Tris-HCl, 140 mM NaCl, 10 mM CaCl2 pH 7.4). Centrifuged for 2 hours at 28,000 rpm (Optima XE-100 centrifuge, SW 32Ti rotor, Beckman Coulter, +4°C). The pellets obtained were resuspended in THC buffer and stored at +4°C.

Example 3 Determination of VLP by electron microscopy

3 μl of the preparation containing VLP at a concentration of 12-30 mg/ml was applied to a copper grid coated with a carbon substrate (Ted Pella, USA) and treated in a glow discharge atmosphere, incubated for 30 seconds at room temperature. Then a drop of 2% uranium acetate solution was applied to the grid, kept for 30 seconds, excess solution was removed from the grid with filter paper. The dyed meshes were stored in plastic containers until use. The samples were studied using a JEOL 2100 transmission electron microscope (JEOL, Japan) equipped with a lanthanum hexaborite cathode at an accelerating voltage of 200 kV. The images were obtained with a magnification of x25000 using a Gatan X100 CCD camera with a matrix size of 2000x2000 pixels (Gatan, USA). Virus-like particles visualized by electron microscopy are shown in Fig. 4.

Example 4 Determination of specific activity of purified VLPs by ELISA.

The specific activity of the purified VLP was assessed by ELISA. Mab against the VP6 protein of PBA was used as the adsorbed antigen. Purified VLP and PBA were titrated in x3 steps in dilutions from 1/100 to 1/218700. Peroxidase-labeled mAbs for the VP6 protein of PBA were used to detect VLPs and PBAs bound to the adsorbed antigen (Fig. 3). The ELISA results showed a high titer of purified VLP compared to PBA, which indicates their high specific activity.

Example 5 Administration Route Selection and Adjuvant Optimization in a Mouse Model

For the study, female mice of the Balb/c line, 3-4 weeks old, weighing 16-18 g (nursery of laboratory animals Branch "Stolbovaya" FGBUN "NTsBMT" FMBA, Russia) were used.

Conducted two immunization with an interval of 14 days. With intranasal administration, light ether anesthesia was used. A squalene-based adjuvant was used as an adjuvant. We formed 7 experimental groups:

Group No. 1. Intramuscular administration with adjuvant in a volume of 0.2 ml/mouse.

Group No. 2. Intramuscular administration without adjuvant in a volume of 0.2 ml/mouse.

Group No. 3. Intraperitoneal administration with adjuvant in a volume of 0.2 ml/mouse.

Group No. 4. Intraperitoneal administration without adjuvant in a volume of 0.2 ml/mouse

Group No. 5. Intranasal administration with adjuvant in a volume of 0.05 ml/mouse.

Group No. 6. Intranasal administration without adjuvant in a volume of 0.05 ml/mouse.

Group 7 - Control.

7 days after the second immunization, blood serum was obtained from all animals and the level of antibodies to the VP6 protein and VLP PBA was determined by indirect ELISA using a lysate of cells containing recombinant VP6 protein and VLP suspension as an adsorbed antigen. Serums were tested in double steps in dilutions from 1/200 to 1/25600. An anti-mouse IgG conjugate (Sigma A4416) was used at a 1/2000 dilution. The results are shown in FIG. 5.

The study of the method of administration and the use of the adjuvant showed that all the studied methods of administration of VLP in combination with adjuvant and without cause the formation of specific IgG to the PBA VP6 protein and to VLP. However, the highest level of antibodies is observed when administered intramuscularly with an adjuvant. Given the further use of the vaccine against RVI in clinical practice, in particular the vaccination of children under 2 years of age, two formulations of the prototype vaccine against RVI based on VLP and VLP were selected for further research on relevant animal species in combination with an attenuated RVA strain for intramuscular and intranasal administration. methods of administration.

Example 6 Dose selection of prototype vaccines in a neonatal minipig model

For the final formulation of the prototype vaccine based on VLP - recombinant proteins: VP6-VP7 (genotype G1), VP6-VP7 (genotype G2), VP6-VP7 (genotype G4), VP6-VP7 (genotype G9), VP6-VP4 (genotype P4 ), VP6-VP4 (genotype P8), relevant for epidemic isolates of genotypes most common in the Russian Federation, were mixed in equal amounts (by protein). The VLP mixture was mixed with the adjuvant in a ratio of 1:1.

The study used clinically healthy piglets aged 5 to 6 days from 5 pregnant sows that showed a negative result for the presence of specific IgG to PBA.

A total of 10 groups of animals were studied, of which six groups were administered prototype vaccines based on VLP, two were given placebo, and two more groups were controls. Grouping was performed on the day of the first immunization (Table 1).

Table 1 - Characteristics of the experimental groups of pygmy pigs group number Number of goals Group name/vaccine administered The volume of the administered vaccine, ml Method of administration 1 4 Suspension VLP
30 mcg/dose with adjuvant 0.5 Intramuscularly in the outer surface of the right thigh 2 4 Suspension VLP
150 mcg/dose with adjuvant 0.5 3 4 Suspension VLP
750 mcg/dose with adjuvant 0.5 4 4 Suspension VLP
30 mcg/dose with adjuvant 0.5 Intranasally, evenly in both nostrils 5 4 Suspension VLP
150 mcg/dose with adjuvant 0.5 6 3 Suspension VLP
750 mcg/dose with adjuvant 0.5 7 4 Carrier with adjuvant 0.5 Intramuscularly in the outer surface of the right thigh 8 3 Carrier with adjuvant 0.5 Intranasally, evenly in both nostrils 9 3 Control followed by infection 0.5 - 10 2 Control without infection 0.5 -

Investigation candidate VLP-based vaccines were administered intramuscularly and intranasally to animals as possible routes of application in clinical practice. The introduction was carried out three times, with an interval of 2 weeks (on the 0th, 14th and 28th day of the experiment).

On the 0th, 14th, 28th, 42nd days of the study, blood was taken from animals in test tubes with a coagulation activator (Guangzhou Improve Medical Instruments Co., Ltd, China, series C31003, expiration date 08.2022) in the volume 2.0 ml. The blood was centrifuged (3000 rpm, 15 minutes, at room temperature), the resulting serum was used to detect specific antibodies by ELISA and in pH. The ELISA results are shown in Fig. 6.

study of humoral immunity.

The results of the determination of specific IgG to the VP6 protein of PBA showed that already after the second immunization of animals with the prototype vaccine based on VLP intramuscularly, the level of specific antibodies increases sharply and increases after three immunizations. At the same time, the minimum studied dose of VLP 30 μg after a triple immunization causes a significant increase in the level of specific antibodies compared with doses of 150 μg and 750 μg (Fig. 6).

Determination of the level of virus-neutralizing antibodies

Determination of the level of virus-neutralizing antibodies was carried out on the 28th and 42nd day of the study. As a result, it was found that the formation of virus-neutralizing antibodies is observed after the second immunization with the prototype vaccine based on VLP in groups No. 1-3 in all doses studied. At the same time, during immunization with the minimum and maximum studied doses of 30 μg and 750 μg, respectively, after the third immunization, the titer of neutralizing antibodies doubles (Fig. 7).

Study of T-cell immunity

The cell-mediated immune response induced by the VLP-based vaccine was investigated by the lymphocyte blast transformation assay (RBTL).

10 days after the first immunization, all animals (see Table 1) were taken peripheral blood to investigate and assess the level of T-cell immunity. The figure 8 shows the results of the lymphocyte blast transformation reaction (RBTL) normalized to: unstimulated monocytes, monocytes stimulated with a non-specific antigen (CCHF), carrier, adjuvant.

The results of RBTL showed that all concentrations studied by us are able to stimulate the proliferation of peripheral blood monocytes in piglets with intramuscular injection of VLP and intranasal administration of VLP. Comparison of ISP values in groups with intramuscular route of administration (1-3) did not show statistically significant differences in stimulation of proliferation at the minimum (30 µg/dose) and maximum (750 µg/dose) concentrations used (ISP 29.5±7 and ISP 19 .7±4.6, respectively). When comparing the values of ISP in groups with intranasal route of administration (4-6), it was shown that the administration of the minimum studied dose to piglets in group 4 (30 μg/dose) induces the most intense proliferation (ISP 21.9±2.3) compared with groups 5 (150 µg/dose) and 6 (750 µg/dose), p<0.05. It should be noted that in the groups of animals with intramuscular and intranasal administration of VLP suspension, the highest values of ISP 29.5±7 and ISP 21.9±2.3, respectively, are noted in the minimum concentration studied (groups 1 and 4) and the values of ISP do not differ. statistically significant, p>0.05.

The results obtained indicate a specific cellular response in all studied immunized animals after the first immunization, both with intranasal and intramuscular administration of the VLP suspension.

Thus, the presented examples show the achievement of the claimed technical result and the industrial applicability of the claimed invention.

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing originalFreeTextLanguageCode="en"

dtdVersion="V1_3" fileName="HPV Rotavirus A.xml" softwareName="WIPO

Sequence" softwareVersion="2.2.0" productionDate="2022-12-05">

<ApplicationIdentification>

<IPOfficeCode>EN</IPOfficeCode>

<ApplicationNumberText></ApplicationNumberText>

<FilingDate></FilingDate>

</ApplicationIdentification>

<ApplicantFileReference>1</ApplicantFileReference>

<ApplicantName languageCode="en">federal state

budget institution "National Research Center

epidemiology and microbiology named after honorary academician N.F. Gamaleya"

Ministry of Health of the Russian Federation</ApplicantName>

<ApplicantNameLatin>federalnoe gosudarstvennoe biudzhetnoe

uchrezhdenie Natsionalnyi issledovatelskii tsentr epidemiologii i

mikrobiologii imeni pochetnogo akademika N F Gamalei Ministerstva

zdravookhraneniia Rossiiskoi Federatsii</ApplicantNameLatin>

<InventionTitle languageCode="en">IMMUNOBIOLOGICAL SUBSTANCE ON

ON THE BASIS OF VIRUS-LIKE PARTICLES FOR THE INDUCTION OF SPECIFIC IMMUNITY

AGAINST HUMAN ROTAVIRUS A INFECTION</InventionTitle>

<SequenceTotalQuantity>8</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>3185</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..3185</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ctcgagatggtgtccaagggagaggagctgttcacgggagtggtgccaa

ttctggtggagctggacggagacgtgaacggccacaagttcagcgtgagcggagagggagaaggagacgc

cacatacggcaagctgaccctgaagttcatttgcaccaccggaaaattgcccgtgccctggccaacactg

gtgacaacactgacctacggcgtgcagtgcttcagccgttaccccgaccacatgaagcagcacgacttct

tcaagagcgccatgcccgagggatacgtgcaggagcgcaccatcttcttcaaggacgacggcaactacaa

gacccgcgccgaagtgaagttcgagggagacaccctggtgaaccgcatcgagctgaagggcatcgacttc

aaggaggacggcaacatcctgggccacaagctggagtacaactacaacagccacaacgtgtacatcatgg

ccgacaagcagaagaacggcatcaaggtcaacttcaagatccgccacaacatcgaggacggaagcgtgca

atggccgaccactaccagcagaacaccccaatcggcgacggcccagtgctgctgccagataatcactacc

tgagcacccaaagcgccctgagcaaggatcccaacgagaagcgcgaccacatggtgctgctggagttcgt

gacagccgccggaattaccctgggcatggacgagctgtacaagagcggactgcgtagtcgagcccaggcc

agcaactccgctgtggatggtacagctggtccaggaagcacaggaagccgtagccgaggaagcaagacca

tcccaaccttcgagcccaaggagcatcctgaagaagctggaggacatcaagcccgagcaggccaagaa

gcagaccaagctgttccgcatcttcgaaccacgccagctgccaatctatcgcgctaacggagagaaggag

ctgcgcaaccgttggtattggaagctgaagaaggacaccctgccggatggagattacgacgtgcgagagt

acttcctgaacctgtacgaccaggtgctgaccgagatgccagactacctgctgctgaaggacatggccgt

ggagaacaagaactcgcgcgatgccggaaaggtggtggatagcgaaaccgccagcatttgcgacgccatc

ttccaagatgaggaaacagaaggagccgtgcgccgtttcatcgccgaaatgcgacagcgcgtgcaggccg

atcgaaacgtggtgaactaccccagcatcctgcaccccatcgactacgccttcaacgagtacttcctgca

gcaccagctggtggagcccctgaacaacgacatcatcttcaactacatccgagcgcatccgcaacgac

gtgaactacatcctgaacatggaccgcaacctgccaagtaccgcccgctacattcgcccaaacctgctgc

aggatcgcctgaacctgcacgacaacttcgagagcctgtgggacaccatcaccaccagcaactacatcct

ggccgtagcgtggtgccagatctgaaggagctggtgtccaccgaggcccagatccagaagatgagccag

gacctgcagctggaagccctgaccattcagagcgagacccagttcctgaccggcatcaacagccaggccg

ccaacgattgcttcaagaccctgatcgccgccatgctgagtcaacgtaccatgagcctggacttcgtgac

caccaactacatgagcctgatctccggcatgtggttgctgaccgtggtgcccaacgacatgttcatccgc

gagagcctggtcgcttgccaactggccatcgtgaacaccatcatctaccccgccttcggcatgcagcgaa

tgcactaccgcaacggcgatccacagcgtccattccaaatcgccgagcagcagatccagaacttccaagt

ggccaattggctgcacttcgtgaacaacaaccagttccgccaggtggtgatcgacggagtgctgaaccag

gtgctgaacgacaacatccgcaacggccacgtgatcaaccagctgatggaggccctgatgcagctgagtc

gccagcagttcccaaccatgccagtggactacaagcgcagcatccagcgaggcatcctgttgctgagcaa

tcgcctgggacagctggtggatctgacccgactgctggcctacaactacgagaccctgatggcctgcgtc

accatgaacatgcagcacgtgcagaccctgaccaccgaaaagctgcagctgaccagcgtgaccagcttgt

gcatgctgatcggcaacgccaccgtgatcccaagcccccagaccctgttccactactacaacgtgaacgt

gaacttccacagcaactacaacgagcgcatcaacgacgccgtggctatcatcaccggagccaaccgcctg

aacctgtaccagaagaagatgaaggccatcgtggaggacttcctgaagcgcctgcacatcttcgacgtgg

cccgcgtgcccgacgatcagatgtaccgtctgcgagatcgtctgcgactgttgccagtggaagtgcgccg

cctggacatcttcaacctgatcctgatgaacatggaccagatcgagcgcgccagcgataagattgcccaa

ggagtgatcatcgcctaccgcgacatgcagctggagcgagacgagatgtacggctacgtgaacatcgccc

gcaatctggacggattccaacagatcaacctggaggagctgatgcgcaccggagattacgcccagatcac

caacatgctgctgaacaatcagccagtggccctggtgggagctttgcccttcgtgaccgatagcagcgtg

atcagcctgatcgccaacgtggacgctaccgtcttcgcccagatcgtgaagctgcgaaaggtggacaccc

tgaagcccatcctgtacaagatcaacagcgacagcaacgacttctacctggtggccaactacgattgggt

gcccaccagcaccaccaaggtgtacaagcaggtgccccagcagttcgacttccgcaacagcatgcacatg

ctgaccagcaacctgaccttcaccgtgtacagcgacctgctggctttcgtgtccgccgatacagtggagc

caatcaacgccgtggccttcgacaacatgcgcatcatgaacgagctgtaggctagc</INSDSeq_sequ

ence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>1234</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..1234</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q4">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ggatccatggaagtcctgtactccttgagcaagactctgaaagatgccc

gtgacaagatcgtggaaggcactctctctactccaacgtgtctgacctgatccagcagttcaatcagatgat

cgtgaccatgaatggaaacgactttcagactggtggcattggcaaccttcctatcaggaactggaccttt

gactttggtctccttggcactacactgttgaatctggatgccaattacgttgagaccgccaggactacca

ttgagtacttcatcgacttcatcgacaacgtgtgcatggatgagatggcccgtgagtctcagcgcaatgg

tgtcgctccacagtctgaagctctgcgcaaacttgctggcatcaagttcaagcgcatcaacttcaacaac

agctctgagtatatcgagaactggaacttacagaacagacgtcaacgcactggcttcgtgtttcacaaac

ccaacatctttccatactctgcctccttcaccttgaacagatctcaacctatgcacgacaacctcatgggg

aaccatgtggctgaatgctggctctgagattcaagttgctggctttgctggctctgagattcaagttgct

ggctttgactacagctgtgcactgaatgctcctgccaatattcaacagtttgaacacatcgtccaactgc

gtagagccttgaccactgccaccatcactctgttgcctgatgctgagcgcttcagcttccctagagtgat

caactctgctgatggtgccactacatggttcttcaatcccatcattctgagacccaacaatgtggaagtt

gagttcttgctgaatggtcagatcattaacacctaccaagctaggtttggcaccatcattgctcgcaact

ttgacaccattcgtctgtccttccaactgatgagacctcccaacatgactccagctgtgaatgctctctt

tcctcaagctcaaccctttcaacaccatgccaccgttggtctgactcttcgcatcgagtctgctgtgtgt

gaatcagtgcttgccgatgccaatgagaccttgcttgctaatgtgactgctgttcgtcaagagtatgcca

ttccagttggtcctgtgtttccacctggcatgaactggactgaactgatcaccaactactctccttcccg

tgaagacaacttgcaaagagtcttcaccgttgccagcatccgtagcatgttgatcaagtaagctt</INS

DSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>993</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..993</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q6">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gaattcatgtacggcatcgagtacaccaccatcctgatcttcctgatca

gcatcatcctgctgaactacatcctgaagagcgtgacccagatgatggactacatcatctaccgcagcct

gctgatcagtgtggccctgtttgccctgacacgagcccagaactacggcatcaacctgcccatcaccggga

agcatggacgccgcttacgccaatagcacccaggagggcatattcctgaccagcaccctgtgcctgtact

acccaaccgaggctagcacccagatcaacgacggcgagtggaaggacagcctgagccagatgttcctgac

caagggttggcccaccggaagcgtgtacttcaaggagtactccagcatcgtggagttcagcgtggaccccc

cagctgtattgcgactacaacctggtgctgatgaagtacgaccagaacctggagctggacatgagcgagc

tggccgatctgatcctgaacgagtggctgtgcaaccccatggacatcaccctgtactactaccagcagag

cggcgagagcaacaagtggatcagcatgggtagctcctgcaccgtgaaggtctgcccactgaacacccag

acactgggaatcggttgccagaccaccaacgtggacagcttcgagatggtggccgagaacgagaagctgg

ccatcgtggacgtcgtggacggcatcaaccacaagatcaacctgaccaccaccacttgcaccatccgcaa

ttgcaagaagctgggacccgcgagaacgtggctatcatccaggtcggaggcagcaacgtgctggatatc

accgccgatcccaccaccaatccacagaccgagcgcatgatgcgcgtgaattggaagaagtggtggcagg

tgttctacaccatcgtggactacatcaaccagatcgtgcaggtcatgagcaagcgcagtcgcagtctgaa

tagcgccgccttctactatcgcgtgtgagagctc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>993</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..993</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q8">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gaattcatgtacggcatcgagtacaccaccatcctgaccatcctgatct

tcatcatcctgctgaactacatcctgaagaccatcaccaacaccatggactacatcatcttccgcttcct

gctgctgatcgccctgatgagtccattcgtgcgcacccagaactacggcatgtacctgcccatcaccggga

agcctggacgccgtgtataccaacagcaccagcggagagagctttctgaccagcaccctgtgcctgtact

acccaaccgaggccaagaacgagatcagcgacaacgagtgggagaacaccctgagccagctgttcctgac

caagggttggccaaccggcagcgtgtacttcaaggactacaacgacatcaccaccttcagcatgaacccc

cagctgtactgcgactacaacgtggtcctgatgcgctacgacaacaccagcgagctggacgctagcgagc

tggccgatctgattctgaacgagtggctgtgcaaccccatggacatcagcctgtactactaccagcagaa

cagcgagagcaacaagtggatcagcatgggtaccgactgcaccgtgaaggtctgcccactgaacacccag

accctgggaatcggttgcaagaccaccgacgtggacaccttcgagatcgtggctagcagcgagaagctgg

tgatcaccgacgtggtgaacggcgtgaaccacaagatcaacatcagcatcagcacttgcaccatccgcaa

ttgcaacaagctgggaccacgcgagaacgtggctatcatccaagtgggcggcccaaacgctctggatatc

accgccgatccaaccaccgtgccacaagtgcagcgcatcatgcgcgtgaattggaagaagtggtggcagg

tgttctacaccgtggtggactacatcaaccagatcatccaggtcatgagcaagcgcagtcgcagtctggga

tacagccgccttctactaccgcatctgagagctc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>996</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..996</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q10">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gaattcatgtacggcatcgagtacaccgccgtgctgttctacctgatca

gcttcgtgttcgtgtcctacatcctgaagaccatcatcaagatcatggactacatcatctaccgcatcac

cttcgtgatcgtcgtgctgagcgtgctgagtaacgcccagaactacggcatcaacctgcccatcaccggga

agcatggataccgcctacgccaacagcacccaggacaacaacaacttcctgagcagcaccctgtgcctgt

actacccaagcgaggctccaacccagatcagcgacaccgagtggaaagacaccctgagccagctgttcct

gactaagggctggccaaccggaagcgtgtacttcaacgagtactccaacgtgctggagttcagcatcgag

cccaagctgtattgcgactacaacgtcgtgctgatcaagttcaccagcggcgaggagctggacatcagcg

aactggccgacctgatcctgaacgagtggctgtgcaaccccatggacatcaccctgtactactaccagca

gaccggcgaggccaacaagtggatcagcatgggcagcagttgcaccgtgaaggtctgccccctgaacaca

cagaccctgggaatcggttgccagaccaccaataccgccaccttcgagacagtggccgacagcgagaagc

tggccatcatcgacgtcgtggacagcgtgaaccacaagctggacgtgaccagcaccacttgcaccatccg

caactgcaacaagctgggaccacgcgagaacgtggctatcatccaggtcggaggcagcaacgtgctggat

atcaccgccgatcccaccaccagtccacagaccgagcgcatgatgcgcgtgaattggaagaagtggtggc

aggtgttctacaccgtggtggactacatcaaccagatcgtgcaggtgatgagcaagcgcagccgtagcct

ggatagcagcagcttctactaccgcgtgtgagagctc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>993</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..993</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q12">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gaattcatgtacggcatcgagtacaccaccatcctgaccttcctgatca

gcatcgtgctgctgaactacatcctgaagagcctgaccagcgccatggacttcatcatctaccgcttcct

gctgctgatcgtgatcgccagccccttcgtgaagacccagaactacggcatcaacctgcccatcaccggc

agcatggataccgcttacgccaacagcagccagcaggaaaccttcctgaccagcaccctgtgcctgtact

acccaaccgaggctagcaccgatcggcgataccgagtggaaggacaccctgagccagctgttcctgac

caagggttggccaaccggcagcgtgtacttcaaggagtacaccgacatcgccagcttcagcatcgacccc

cagctgtattgcgactacaacgccgtgctgatgaagtacgacagcaccctggagctggacatgagcgagc

tggccgatctgatcctgaacgagtggctgtgcaaccccatggacatcaccctgtactactaccagcagac

cgacgaggccaacaagtggatcagcatgggtcagagttgcaccatcaaggtctgccccctgaacacccag

accctgggaatcggttgcatcaccaccaacaccgccaccttcgaggaagtggctacctccgagaagctgg

tgatcaccgacgtggtggacggagtgaaccacaagctggacgtgaccaccaacacttgcaccatccgcaa

ttgcaagaagctgggaccacgcgagaacgtggctatcgtgcaagtgggaggcagcaacgtgctggatatc

accgccgatccaaccaccacaccacagaccgagcgcatgatgcgcgtgaattggaagaagtggtggcagg

tgttctacaccgtggtggactacatcaaccagatcgtgcaggtcatgagcaagcgcagtcgcagtctgaa

tagcgccgccttctactatcgcgtgtgagagctc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="7">

<INSDSeq>

<INSDSeq_length>2340</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..2340</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q14">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gaattcatggctagcctgatctaccgccagctgctgaccaacagctaca

gcgtggacctgcacgacgagatcgagcagatcggcagcgagaagacccagaacgtgaccgtgaaccccgg

accattcgctcagacacgctacgccccagtgaattggggacacacggcgagatcaacgatagcaccaccgtg

gagccagtgttggacggaccataccagccaaccaccttcaagccccccaacgactactggctgctgatca

gcagcaacacagacggcgtggtgtacgagagcaccaacaacagcgacttttggaccgccgtgatcgccgt

ggaaccacacgtgtcccagacaaaccgccgttacgtgctgttcggcgagaacaagcagttcaacatcgag

aacagcagcgacaagtggaagttctttgagatgttcaagggcagcagccagagcgacttcagcaaccgcc

gcaccctgacaagcgataaccgcctggtgggcatgctgaagtacggaggacgcgtctggaccttccacgg

tgaaacaccacgcgctaccaccgatagcagcaataccgccgacctgaacaacatcagcatcatcatccac

agcgagttctacatcatccccgcagccaggagagcaagtgcaacgagtacatcaacaacggcctgccac

caatccagaatacccgcaatgtggtgccactgagcctgagcagtcgcagcatccagtaccgtcgcgccca

agtgaacgaggacatcaccatcagcaagaccagcctgtggaaggagatgcagtacaaccgcgacatcatc

atccgcttcaagttcggcaacagcgtgatcaagctgggcggactgggctacaagtggagcgagatcagct

acaaggccgccaactaccagtacagctacagccgcgacggagaacaggtgacagcccacaccacctgcag

cgtgaacggcgtgaacaacttcagctacaacggcggcagcctgccaaccgatttctccatcagccgctac

gaggtcatcaaggagaacagctacgtgtacatcgactattgggacgacagcaaggccttccgcaacatgg

tctacgtgcgcagcctggccgctaacctgaacagcgtgaagtgcttgggcggaagctacgatttccgact

gccagtgggcgagtggccaattatgaacggaggagccgtgtccctgcattttgccggagtgaccctgagc

acccagttcaccgacttcgtgtccctgaacagcctgcgctttcgcttcagcctgaccgtggacgagccaa

gcttcagcatcatccgcaccgcaccatgaacctgtacggactgccagccgctaaccccaacaacggcaa

cgagtactacgaggtgtccggccgcttcagcctgatcagcctggtgccaaccaacgacgactaccagacc

cccatcatgaacagcgtgaccgtgcgacaggatctggagcgacagctgaacgacctgcgagaggagttca

acagcctgagccaggagatcgccatgagccagctgatcgatctggccttgctgcccctggacatgttctc

gatgttctccggcatcaagagcaccatcgacctgaccaagagcatggccaccagcgtgatgaagaagttc

cgcaagagcaagctggccaccagcatcagcgagatgaccaacagtctgagcgacgccgctagcagcgcta

gccgaagcgctagcattcgcagcaacctgagcaccatcagcaactggtcggatgccagcaagagcgtgct

gaacgtgaccgacagcgtgaacgacatcagcacccagaccagcaccatcagcaagaagctgcgcctgaag

gagatgatcacccagaccgagggcatcagcttcgacgatatttccgccgccgtgctgaagaccaagatcg

acatgagcacccagatcggcaagaacaccctgccagacatcgtgaccgaggctagcgagaagttcatccc

caagcgcagctaccgcgtgttgaaggacgacgaggtgatggaggtcaacaccgagggcaagttcttcgcc

tacaaggtggacaccctgaacgagatccccttcgacatcaacaagttcgccgagctggtgaccgatagcc

cagtgatcagcgccatcatcgacttcaagaccctgaagaacctgaacgacaactacggaatcacccgcat

cgaggccctgaacctgatcaagagcaaccccaacgtgctgcgcaacttcatcaaccagaacaaccccatc

atccgcaaccgcatcgagcagctgatcctgcagtgcaagctgtgagagctc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="8">

<INSDSeq>

<INSDSeq_length>2340</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..2340</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q16">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gaattcatggctagcctgatctaccgccagctgctgaccaacagctaca

gcgtggacctgcacgacgagatcgagcagatcggcagcgagaagacccagaacgtgaccgtgaaccccgg

accattcgctcagacacgctacgccccagtgaattggagccacggagagatcaacgacagcaccaccgtg

gagccaatcctggacggaccataccagccaaccaccttcaccccccccaccgattattggatcctgatca

ccagcaacaccaacggcgtggtgtacgagagcaccaacaacagcgacttttggaccgccgtgatcgccgt

ggaaccacacgtgaacccagtggaccgccagtacaacgtgttcggcgagaacaagcagttcaacgtgcgc

aacgacagcgacaagtggaagttcttggagatgttccgcggcagcagccagaacgatttctacaaccgcc

gcaccctgaccagcgatacacgcctggtgggcatcctgaagtacggaggacgcgtctggaccttccacgg

tgaaacaccacgcgctaccaccgatagcagcaataccaccaacctggacggcatcagcatcaccatccac

agcgagttctacatcatccccgcagccaggagagcaagtgcaacgagtacatcaacaacggcctgccac

caatccagaatacccgcaatgtggtgccactgagcctgagcagtcgcagcatccagtacaagcgcgccca

ggtcaacgaggacatcaccatcagcaagaccagcctgtggaaggagatgcagtacaaccgcgacatcatc

atccgcttcaagttcggcaacagcatcgtgaagctgggaggactgggctacaagtggagcgagatcagct

acaaggccgccaactaccagtacaactacctgcgcgacggcgagcaagtgacagcccacaccacctgcag

cgtgaacggcgtgaacaacttcagctacaacggcggcagtctgccaaccgatttctccgtgtcccgctac

gaggtcatcaaggagaacagctacgtctacgtggactattgggacgacagcaaggccttccgcaacatgg

tctacgtgcgcagcctggccgctaacctgaacagcgtgaagtgcacgggaggcagctacaacttcagcat

ccccgtgggagcttggccagtgatgaacggaggagccgtgtccctgcattttgccggagtgaccctgagc

acccagttcaccgacttcgtgtccctgaacagcctgcgcttccgctttagcctgaccgtggatgagccca

gcttcagcatcctgcgcacccgcacagtgaacctgtacggactgccagccgctaaccccaacaacggcaa

cgagtactacgagatcagcggccgcttcagcctgatcagcctggtgccaaccaacgacgactaccagacc

cccatcatgaacagcgtgaccgtgcgacaggatctggaacgacagctgaccgacctgcgaggagagttca

acagcctgagccaggagatcgccatgagccagctgatcgatctggccttgctgcccctggacatgttctc

gatgttctccggcatcaagagcaccatcgacctgaccaagagcatggccaccagcgtgatgaagaagttc

cgcaagagcaagctggccacaagcgtgtccgagatgaccaacagtctgagcgacgccgctagcagcgcta

gccgtagcgtgtccgtgcgcagcaacatcagcgccatcagcaactggaccaacgtgtccaacgacgtctc

caacgtgaccaacagcgtgaacgacatcagcacccagaccagcaccatcagcaagaacctgcgcctgaag

gagatgatcacccagaccgagggcatgagcttcgacgatatttccgccgccgtgctgaagaccaagatcg

acatgagcacccagatcggcaagaacaccctgccagacatcgtgaccgaggctagcgagaagttcatccc

caagcgcagctaccgcatcctgaaggacgacgaggtgatggagatcaacaccgagggcaagttcttcgcc

tacaagatcgacaccctgaacgaggtgcccttcgacgtgaacaagttcaccgagctggtgaccaatagcc

ccgtgatcagcgccatcatcgacttcaagaccctgaagaacctgaacgacaactacggaattacccgcac

cgaggccctgaacctgatcaagagcaaccccaacgtgctgcgcaacttcatcaaccagaacaaccccatc

atccgcaaccgcatcgagcagctgatcctgcagtgcaagctgtgagagctc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (4)

1. An immunobiological agent for inducing specific immunity against infection caused by human rotavirus A, containing an adjuvant and several recombinant virus-like three-layer particles consisting of two proteins of the rotavirus capsid genes VP2 and VP6, having the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2 , and one or more of the surface proteins VP4 and VP7 of different genotypes of rotavirus G1, G2, G4, G9, P4, P8, having the nucleotide sequences of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO : 6, SEQ ID NO: 7, SEQ ID NO: 8, which are obtained in the baculovirus insect expression system, while the virus-like particle mimics the rotavirus A virion. 2. The immunobiological agent according to claim 1, wherein the adjuvant is an oil adjuvant. 3. An immunobiological agent according to any one of claims 1, 2, where the adjuvant is a water-oil emulsion. 4. An immunobiological agent according to any one of claims 1 to 3, wherein the adjuvant is a squalene-based oil-in-water emulsion.

Images