CN107177681A - Application of the pig SNP marker in daily gain in pigs behavior study and/or pig breeding - Google Patents
Application of the pig SNP marker in daily gain in pigs behavior study and/or pig breeding Download PDFInfo
- Publication number
- CN107177681A CN107177681A CN201710427052.0A CN201710427052A CN107177681A CN 107177681 A CN107177681 A CN 107177681A CN 201710427052 A CN201710427052 A CN 201710427052A CN 107177681 A CN107177681 A CN 107177681A
- Authority
- CN
- China
- Prior art keywords
- pig
- daily gain
- snp marker
- pigs
- breeding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biotechnology and molecular marking technique field, application of the more particularly to boar SNP marker in daily gain in pigs behavior study and/or pig breeding.Described pig SNP marker site is shown in SEQ ID NO.1, positioned at the nucleic acid single base of sequence fragment the 321st mutation, to be named as：g15588826C>T.The SNP marker corresponds to the 15588826th nucleotide site C on the international version 3 chromosome of pig reference gene group 10.2>T is mutated.The advantage allele that the present invention passes through the preferably SNP marker, by increasing capacitance it is possible to increase the genetic progress for the character that increases weight in broad daylight, reduces the breeding time of great Bai daily gain character, so as to effectively improve the economic benefit of kind of pig breeding.
Description
Technical field
The invention belongs to molecular biotechnology and molecular marking technique field, a more particularly to boar SNP marker exists
Application in daily gain in pigs behavior study and/or pig breeding.
Background technology
Daily gain character is to assess the important indicator of pig growth performance, therefore is the emphasis in kind of swine improvement research.
In the last hundred years, the breeding objective of Modern China often focuses on lifting lean meat percentage and the reduction thickness of backfat, and this is carried to a certain extent
The high genetic progress of daily gain, but also lack relatively straightforward selection always.Traditional breeding method is difficult for phenotype
Produced little effect with the character (such as daily gain) of identification, and molecular marker assisted selection (marker assisted selection,
MAS this technology barriers) has then been broken.This method can be used for improving pork quality (such as intramuscular fat) and disease resistance trait (such as anti diar rhea)
It is difficult the character that measurement or somatometry spend very big (such as daily gain) Deng live body, and breeding (such as litter size) is lived in life
The later sex-limited character of expression in dynamic.And MAS is difficult affected by environment, sex, age effects, therefore early stage choosing can be carried out
Select, and then the purpose (Liu little Chun etc., 2008) for shortening the generation inteval, improving choosing seed selection efficiency can be played.Therefore if utilizing
The daily gain character of MAS technique improvement boars, will be provided with wide application prospect.
Large White is one of bacon hogs kind famous in the world.In the breeding of method of modern pig, great Bai is with reproductive capacity
The advantages of height, good growing and fattening, strong adaptability and it is famous.Because its combination property is outstanding, therefore can be as many synthesis
The male parent or female parent of market pig, application are quite varied.Therefore, the daily gain character to Large White is improved, Ke Yiyou
Shorten the fattening time of market pig to save aquaculture cost in effect ground.
The content of the invention
In order to overcome the shortcomings of prior art to daily gain hereditary and selection and shortcoming, it is an object of the invention to provide one kind
Application of the pig SNP marker in daily gain in pigs behavior study and/or pig breeding.
The purpose of the present invention is achieved through the following technical solutions：
Application of the one boar SNP marker in daily gain in pigs behavior study and/or pig breeding；SNP points of described pig
The SNP site of son mark corresponds to the C at 15588826bp on the international version 3 chromosome of pig reference gene group 10.2>T dashes forward
Become；The SNP site of the molecular labeling is that the M wherein in sequence is T or C, causes daily gain character shown in SEQ ID NO.1
Difference；
Described pig is at least one of great Bai and its synthesis system；
For identifying that the primer of above-mentioned pig SNP marker is preferably PCR-F and PCR-R；
Sense primer PCR-F：5'-CAGGTAGGACACCTCCACT-3'；
Anti-sense primer PCR-R：5'-TGACAGCAGCACTAAATGAC-3'；
Described daily gain in pigs behavior study is preferably to identify daily gain in pigs character using above-mentioned pig SNP marker；
Described daily gain in pigs behavior study preferably also adjusts daily gain in pigs using above-mentioned pig SNP marker；
Described breeding is preferably molecular mark；
A kind of method for detecting daily gain in pigs character, is comprised the following steps：
The mononucleotide for detecting above-mentioned pig SNP marker on No. 3 chromosomes of pig is C or T；
Described pig is at least one of great Bai and its synthesis system；
The method of the genetic improvement of one boar, is comprised the following steps：
The above-mentioned pig SNP marker of boar in nucleus herds of breeding pigs is determined, and is made accordingly according to pig SNP marker
Selection：CT types and TT on the international version 3 chromosome of pig reference gene group 10.2 of the Systematic Breeding of boar at 15588826bp
Type individual, eliminates the CC types individual of the point；With the frequency for the allele T that the site is improved by generation, so as to improve offspring pig
Daily gain；
Described boar is at least one of great Bai and its synthesis system；
The present invention has the following advantages and effect relative to prior art：
(1) present invention studies and determined the molecular labeling for influenceing daily gain related, is marked using the molecular labeling auxiliary
Selection is helped, the daily gain process of its synthesis system of Herba Phaii tankervilliaes can be greatly increased.
(2) present invention provides a kind of primer pair for being used to identify influence daily gain in pigs trait molecular marker, passes through the molecule
Mark and primer pair, can set up the molecular mark technology of efficiently and accurately, are applied to kind of daily gain in pigs character and lose
Pass in improvement, so as to improve the daily gain of pig, and then save food, reduce enterprise's production cost, improve enterprise profit, increase core
Heart competitiveness.
(3) the advantage allele that the present invention passes through the preferably molecular labeling, by increasing capacitance it is possible to increase the something lost for the character that increases weight in broad daylight
Exhibition is come into, the breeding time of great Bai daily gain character is reduced, so that the economic benefit of kind of pig breeding is effectively improved, wherein, lead to
The molecular labeling is crossed, the present invention is by the whole seed selections of CC types individual into TT types individual, then every pig average daily gain can be improved
88.7g, ten thousand pig farms of a scale can then increase pork 62.09t in 70 days, it can be seen that outstanding daily gain performance
The potentiality for providing income for pig industry are huge.
Brief description of the drawings
Fig. 1 is the daily gain analysis chart of different genotype pig.
Fig. 2 is that full-length genome of the Large White on daily gain character on No. 3 chromosomes associates (GWAS) analysis chart；Its
In：Abscissa represents the chromosome numbers of pig；Ordinate represents-logP values.
Embodiment
With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited
In this.
Embodiment 1
In embodiment, 689 purebred great Bai have been used altogether；Wherein, reached by OSBORNE system measurement pigs in body weight
Age in days during 30kg is simultaneously recorded as Day1, and age in days when record pig body weight reaches 100Kg is simultaneously recorded as Day2.The calculating of daily gain is public
Formula is：70/(Day2-Day1).Above-mentioned experiment is carried out in the Shahu Lake kind pig farm of Guangdong Wen'S Foodstuffs Group Co., Ltd.,
Drunk water in the stage of measure per column stable breeding 10~12 pigs (every 2 square metres of pig area occupied) free choice feeding, and by unified raising
Standard, unified feeding daily ration.
(1) extracting method of Large White ear sample tissue DNA extracts complete genome DNA with reference to mark phenol chloroform method.With
Nanodrop-ND1000 spectrophotometers carry out quality testing and concentration mensuration to the DNA of purebred great Bai colonies.A260/280 ratios
It is qualified that value is determined as in 1.8~2.0, A260/230 ratios 1.7~1.9.Qualified DNA sample is uniformly finally diluted to 50
Nanogram/microlitre.
(2) pig full-length genome 80K SNP genotype detections：GeneSeek Genomic Profiler Porcine80K
SNP parting platforms, carry out chip hybridization using Illumina Infinium operation instruction and normal process and are scanned with result.
Genotype data is read finally by GenomeStudio softwares.Matter is carried out to the genotype data of acquisition with PLINK v1.07
Amount control, rejects recall rate<99.7%, this gene frequency (mimor allel frequency, MAF)<0.01% or inclined
From Hardy's Weinberg equilibrium (Hardy-Weinberg Equilibrium, HWE) P≤10-6SNP marker, exclude recall rate<
90%, family Mendel error rate is higher than 0.1 individual；After remaining 58991 SNP markers of Quality Control and 689 samples are used for
Continuous data analysis.
(3) full-length genome association (GWAS) analysis：Using the GenABEL software kits in R softwares to progress of increasing weight in broad daylight
GWAS is analyzed, and model is：Y=1u+Xb+Sc+Za+ α.Wherein, y is measured phenotypic number and (average daily gain value), and u is total
Body average value, b is sex and fixed effect value, and c answers for remaining minor effect, c-N (0, б c2), and α is random additive genetic effect
Vector, and α~N (0, б α 2) (G is the molecule blood relationship correlation matrix between individual, and б α 2 are additive genetic variance), e is residual error, X, S
It is the incidence matrix to fixed effect and random benefit with Z, field year season (herd-year-season) effect is included in batch effect
Ying Zhong.Determine that whole-genome association obtains conspicuousness threshold value using Bonferroni methods, the remarkable threshold of genomic level is
0.05 divided by effectively SNP site quantity, i.e. 0.05/58991=8.46E-7；Chromosome level remarkable threshold is 1 divided by effective
SNP site quantity, i.e. 1/58991=1.70E-5.GWAS analysis results are as shown in Figure 2.As can be seen from Figure 2, in its synthesis of Herba Phaii tankervilliaes
In system, there is the site for significantly affecting daily gain character in No. 3 chromosome, g.15588826C most strongly connected SNP is>T(P
=4.97E-6).
(4) correlation analysis of different genotype and daily gain phenotype：It can be seen from table 1, the SNP site of molecular labeling
g.15588826C>The T and extremely significantly correlated (P of daily gain character<0.001), illustrate that this molecular labeling significantly affects the daily gain of pig
Character, so as to improve colony's daily gain, and then can accelerate breeding process by the assisted Selection of this SNP site to pig.
Also known according further to table 1 and Fig. 1, TT types are higher than the average daily gain of CC and TC types, illustrate homozygote CC to average daily gain
It is worst.Daily gain is the important indicator of growth traits, and the growth performance of daily gain high explanation pig is good.Therefore, CC genes
The growth performance of the pig of type is worst, and we need to eliminate the boar of CC types during breeding is carried out, and retain TT and TC
The boar of type, with the frequency for the allele T that the site is improved by generation.
The SNP site of the molecular labeling of table 1 is g.15588826C>T and the correlation of daily gain
Embodiment 2
(1) the amplification purpose fragment contained with the purpose fragment of the significantly correlated SNP site of weight gain performance in broad daylight is No. 3 dyes
The nucleotide sequence of one section of 695bp in colour solid, the upstream and downstream primer of sequence amplification is：
Sense primer PCR-F：5'-CAGGTAGGACACCTCCACT-3'；
Anti-sense primer PCR-R：5'-TGACAGCAGCACTAAATGAC-3'.
(2) system and condition setting of PCR amplifications
Configure 20uL systems, the wherein μ L of DNA sample 3.5, the μ L of sense primer 0.6, anti-sense primer 0.6 μ L, PCR mix
10mL, ddH2O 5.3 μ L, PCR conditions are 98 DEG C of pre-degenerations 2min, 98 DEG C of denaturation 10s, 56.5 DEG C of annealing 15s, 72 DEG C of extensions
40s, totally 35 circulations, finally extend to 72 DEG C of 10min.
(3) DNA sequence dna sequencing identification：Sequence is carried out in Shenzhen Huada Genetic Technology Co., Ltd, and genetic fragment is surveyed
Positive and negative two reactions.By measured sequence and NCBI genomic sequence comparisons, the mutation of correspondence SNP site is drawn.
Sequencing result is as follows：
CAGGTAGGACACCTCCACTTGGCTCTCCAGGGACTCTCCCAGGTGGGTTGGTTTGAGTACCTTTGAAACACAATGGC
TGGGTTCCAAGACTAAGCATCTCTAAAGAGCCAGTTGGAAGTTGTGTTTTTTGACTTTGCCACCAGTCACCCAGTGT
CATGTCTACTGCAGTCACAATTCAAAGGAAGCCCTGGGTTCAAGAGGAGGGGACGTGGACCCCACTTCTGGCTGGGC
AGAATAACCTTACAAAAGAGCATGTGGGCGACATGGCTGCAGAGATTTTGGGACCATGTAATCTACACGTGGGAGAC
TGTTCAACCCAC_CTCCCAGCTCAGGTGGATTAGCCATCAGCCATCCAAGGGCAGAGGGCCTGGGACTGCA
TCTGCAGTCTCTCCCTGCTCTGTTTCCCTGTTAACTCTGCCATCTCTTTGATGGGGCGTCACTGCTGCCACATCTGG
TCCTTGCAACCTCGGTCTGGTCTTCCACCCGAGAAGGAATTGAATTCAGTCCAGCGGCCATTTCCAGAGCTGTGCAT
GCAAGGACAGGAGCGAAACATTGCCTCAGGCCCTGTGCGGGCCGAGAGGAAAGGGTGTCTGCCTGGAACGTGCCGCG
GTGAGACGTGTGACAGGTGTGCAGCTGACCGCAACACAGGCCAGATGTCATTTAGTGCTGCTGTCAGGTAGAAGCAA
AGCATTGG
Note：The M marked in sequence table is mutational site, (is mutating alkali yl in bracket, is equipotential with display is underlined
Gene mutation), it is shown as primer sequence in the head and the tail overstriking of the sequence.
The SNP site of the molecular labeling of embodiment 3 is g.15588826C>T effect analysis
The present invention, which provides one, can dramatically increase the daily gain SNP marker of big white race pig and its synthesis system, be entered using the SNP
Line flag assisted Selection, can greatly increase the daily gain breeding process of big white race pig and its synthesis system.The influence of the present invention
The whole seed selections of CC types individual of the molecular labeling of daily gain in pigs character are into TT types individual, then every pig average daily gain can be improved
88.7g, ten thousand pig farms of a scale can then increase pork 62.09t in 70 days, it can be seen that outstanding daily gain performance
The potentiality for providing income for pig industry are huge.In this SNP marker individual, increasing day by day between CC types individual and TT types individual
Principal characteristic can have significant difference (P<0.01), by preferred Herba Phaii tankervilliaes its synthesis be the SNP advantage allele (T), can be most
The purpose for the economic benefit for improving market pig is realized eventually.
Above-described embodiment is preferably embodiment, but embodiments of the present invention are not by above-described embodiment of the invention
Limitation, other any Spirit Essences without departing from the present invention and the change made under principle, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Agricultural University Of South China
<120>Application of the pig SNP marker in daily gain in pigs behavior study and/or pig breeding
<130> 1
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 695
<212> DNA
<213> Artificial Sequence
<220>
<223>Pig SNP marker
<400> 1
caggtaggac acctccactt ggctctccag ggactctccc aggtgggttg gtttgagtac 60
ctttgaaaca caatggctgg gttccaagac taagcatctc taaagagcca gttggaagtt 120
gtgttttttg actttgccac cagtcaccca gtgtcatgtc tactgcagtc acaattcaaa 180
ggaagccctg ggttcaagag gaggggacgt ggaccccact tctggctggg cagaataacc 240
ttacaaaaga gcatgtgggc gacatggctg cagagatttt gggaccatgt aatctacacg 300
tgggagactg ttcaacccac tctcccagct caggtggatt agccatcagc catccaaggg 360
cagagggcct gggactgcat ctgcagtctc tccctgctct gtttccctgt taactctgcc 420
atctctttga tggggcgtca ctgctgccac atctggtcct tgcaacctcg gtctggtctt 480
ccacccgaga aggaattgaa ttcagtccag cggccatttc cagagctgtg catgcaagga 540
caggagcgaa acattgcctc aggccctgtg cgggccgaga ggaaagggtg tctgcctgga 600
acgtgccgcg gtgagacgtg tgacaggtgt gcagctgacc gcaacacagg ccagatgtca 660
tttagtgctg ctgtcaggta gaagcaaagc attgg 695
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223>Primer PCR-F
<400> 2
caggtaggac acctccact 19
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223>Primer PCR-R
<400> 3
tgacagcagc actaaatgac 20
Claims (10)
1. application of the boar SNP marker in daily gain in pigs behavior study and/or pig breeding, it is characterised in that：It is described
The SNP site of pig SNP marker correspond to 15588826bp on the international version 3 chromosome of pig reference gene group 10.2
The C at place>T is mutated.
2. application of the pig SNP marker according to claim 1 in daily gain in pigs behavior study and/or pig breeding,
It is characterized in that：
Described pig is at least one of great Bai and its synthesis system.
3. application of the pig SNP marker according to claim 1 in daily gain in pigs behavior study and/or pig breeding,
It is characterized in that：
For identifying that the primer of the pig SNP marker described in claim 1 is PCR-F and PCR-R；
Sense primer PCR-F：5'-CAGGTAGGACACCTCCACT-3'；
Anti-sense primer PCR-R'：5'-TGACAGCAGCACTAAATGAC-3'.
4. application of the pig SNP marker according to claim 1 in daily gain in pigs behavior study and/or pig breeding,
It is characterized in that：
Described daily gain in pigs behavior study is to utilize the pig SNP marker identification daily gain in pigs described in claim 1
Character.
5. application of the pig SNP marker according to claim 4 in daily gain in pigs behavior study and/or pig breeding,
It is characterized in that：
Described daily gain in pigs behavior study also increases day by day using the pig SNP marker regulation pig described in claim 1
Weight.
6. application of the pig SNP marker according to claim 1 in daily gain in pigs behavior study and/or pig breeding,
It is characterized in that：
Described breeding is molecular mark.
7. a kind of method for detecting daily gain in pigs character, it is characterised in that comprise the following steps：
The mononucleotide for detecting the pig SNP marker on No. 3 chromosomes of pig described in claim 1 is C or T.
8. the method for detection daily gain in pigs character according to claim 7, it is characterised in that：
Described pig is at least one of great Bai and its synthesis system.
9. the method for the genetic improvement of a boar, it is characterised in that comprise the following steps：
The pig SNP marker described in the claim 1 of boar in nucleus herds of breeding pigs is determined, and according to pig SNP marker
Make corresponding selection：On the international version 3 chromosome of pig reference gene group 10.2 of the Systematic Breeding of boar at 15588826bp
CT types and TT types individual, eliminate the point CC types individual；With the frequency for the allele T that the site is improved by generation, so as to carry
The daily gain of high offspring pig.
10. the method for the genetic improvement of pig according to claim 9, it is characterised in that：
Described boar is at least one of great Bai and its synthesis system.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710427052.0A CN107177681A (en) | 2017-06-08 | 2017-06-08 | Application of the pig SNP marker in daily gain in pigs behavior study and/or pig breeding |
| CN201810576313.XA CN108676897B (en) | 2017-06-08 | 2018-06-06 | SNP marker influencing daily gain traits of pigs and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710427052.0A CN107177681A (en) | 2017-06-08 | 2017-06-08 | Application of the pig SNP marker in daily gain in pigs behavior study and/or pig breeding |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107177681A true CN107177681A (en) | 2017-09-19 |
Family
ID=59836741
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710427052.0A Withdrawn CN107177681A (en) | 2017-06-08 | 2017-06-08 | Application of the pig SNP marker in daily gain in pigs behavior study and/or pig breeding |
| CN201810576313.XA Active CN108676897B (en) | 2017-06-08 | 2018-06-06 | SNP marker influencing daily gain traits of pigs and application thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810576313.XA Active CN108676897B (en) | 2017-06-08 | 2018-06-06 | SNP marker influencing daily gain traits of pigs and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN107177681A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107267631A (en) * | 2017-07-18 | 2017-10-20 | 华南农业大学 | A kind of SNP marker for influenceing daily gain in pigs character and its application |
| CN107586854A (en) * | 2017-09-20 | 2018-01-16 | 广东温氏食品集团股份有限公司 | A kind of molecular labeling for influenceing duroc waistline character and application |
| CN107868832A (en) * | 2017-11-14 | 2018-04-03 | 中国农业大学 | The SNP marker related to the multiple economic characters of pig and its application |
| CN108913779A (en) * | 2018-06-14 | 2018-11-30 | 华南农业大学 | A kind of SNP marker and its application influencing daily gain in pigs character |
| CN111154893A (en) * | 2020-02-14 | 2020-05-15 | 广西扬翔股份有限公司 | SNP (single nucleotide polymorphism) marker related to pig growth speed and application thereof |
| CN112458183A (en) * | 2020-11-30 | 2021-03-09 | 华南农业大学 | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898107B (en) * | 2014-04-17 | 2015-07-22 | 江西农业大学 | Major SNP (single nucleotide polymorphism) marker influencing growth traits of pigs and application thereof in genetic improvement of productivity of breeding pigs |
| CN105648077B (en) * | 2016-02-29 | 2017-03-29 | 华南农业大学 | A kind of molecular marker for affecting daily gain in pigs character and its application |
| CN106636346A (en) * | 2016-11-07 | 2017-05-10 | 广西柯新源原种猪有限责任公司 | SNP molecular marker related to daily gain of Duroc and application thereof |
-
2017
- 2017-06-08 CN CN201710427052.0A patent/CN107177681A/en not_active Withdrawn
-
2018
- 2018-06-06 CN CN201810576313.XA patent/CN108676897B/en active Active
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107267631A (en) * | 2017-07-18 | 2017-10-20 | 华南农业大学 | A kind of SNP marker for influenceing daily gain in pigs character and its application |
| CN107586854A (en) * | 2017-09-20 | 2018-01-16 | 广东温氏食品集团股份有限公司 | A kind of molecular labeling for influenceing duroc waistline character and application |
| CN107586854B (en) * | 2017-09-20 | 2019-01-11 | 温氏食品集团股份有限公司 | It is a kind of influence duroc waistline character molecular labeling and application |
| CN107868832A (en) * | 2017-11-14 | 2018-04-03 | 中国农业大学 | The SNP marker related to the multiple economic characters of pig and its application |
| CN107868832B (en) * | 2017-11-14 | 2020-05-15 | 中国农业大学 | SNP molecular marker related to multiple economic traits of pig and application thereof |
| CN108913779A (en) * | 2018-06-14 | 2018-11-30 | 华南农业大学 | A kind of SNP marker and its application influencing daily gain in pigs character |
| CN111154893A (en) * | 2020-02-14 | 2020-05-15 | 广西扬翔股份有限公司 | SNP (single nucleotide polymorphism) marker related to pig growth speed and application thereof |
| CN112458183A (en) * | 2020-11-30 | 2021-03-09 | 华南农业大学 | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108676897A (en) | 2018-10-19 |
| CN108676897B (en) | 2020-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107177681A (en) | Application of the pig SNP marker in daily gain in pigs behavior study and/or pig breeding | |
| CN105648077B (en) | A kind of molecular marker for affecting daily gain in pigs character and its application | |
| CN107779516B (en) | It is a kind of influence pig birth weight character SNP marker and its application | |
| CN108728552B (en) | It is a kind of influence duroc eye muscle area character molecular labeling and application | |
| CN107937556B (en) | SNP (Single nucleotide polymorphism) site related to pig feed conversion rate and application thereof | |
| CN107267631A (en) | A kind of SNP marker for influenceing daily gain in pigs character and its application | |
| CN110129455B (en) | Application of growth-related molecular marker in genetic breeding of litopenaeus vannamei | |
| CN107164463A (en) | It is a kind of to be used for the SNP marker of measure and/or genetic improvement pig growth traits | |
| CN108913779B (en) | SNP marker influencing daily gain traits of pigs and application thereof | |
| KR20160128943A (en) | Pig production and traceability systems selected as a single nucleotide polymorphism markers for the introduction of the method | |
| CN106906303A (en) | One SNP marker for influenceing quality character of pork and its application | |
| CN109182534A (en) | Jian carp breeding of new variety method | |
| CN111926086A (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
| CN107858440B (en) | One kind SNP marker relevant to pig birth weight character and application thereof | |
| CN113564264B (en) | SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirth and litter size of sow and application thereof | |
| CN108004332B (en) | It is a kind of to influence the molecular labeling and its application that the main hoof of pig is grown | |
| CN107988388A (en) | A kind of and relevant SNP marker of pig dewclaw undue growth character and application thereof | |
| CN107779517B (en) | It is a kind of influence Duroc kind pig lean meat percentage character molecular labeling and its application | |
| CN112941198A (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| CN113699247B (en) | SNP molecular marker related to pig residual feed intake on pig chromosome 1 and application thereof | |
| CN113736890B (en) | SNP molecular marker related to healthy number and living number rate and application thereof | |
| CN111269989B (en) | Pig MID1 gene as mortality-related molecular marker and application thereof | |
| CN110643718B (en) | Method for detecting goat OPN4 gene CNV marker and application thereof | |
| CN112779339A (en) | SNP molecular marker related to total papilla number of large white pigs as well as acquisition and application thereof | |
| CN114231639A (en) | Method for identifying or assisting in identifying porcine eye muscle area and application of method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20170919 |
|
| WW01 | Invention patent application withdrawn after publication |