KR20160128943A - Pig production and traceability systems selected as a single nucleotide polymorphism markers for the introduction of the method - Google Patents

Abstract

The present invention relates to a method for selecting a single nucleotide polymorphism marker for introducing a pig production and traceability system. More specifically, the single nucleotide polymorphism marker extracts tissue of Jeju native pig, Landrace, Yorkshire, Berkshire, and Duroc, and single nucleotide polymorphism markers commonly included in the five species of pigs are discriminated. Then, 96 single nucleotide polymorphism markers capable of being used as pig traceability agents are selected through an analyzing device.

Description

Pig production and traceability systems selected as a single nucleotide polymorphism markers for the introduction of the method}

The present invention relates to a method for selecting a single nucleotide polymorphism marker for the introduction of a pig production and traceability system, and in more detail, the single nucleotide polymorphism marker collects tissues of Jeju native pigs, Landrace, Yorkshire, Barkshire, and Duroc. The introduction of a pig production and traceability system, characterized in that after selecting the single nucleotide polymorphism markers that jointly belong to the five varieties of pigs, and then selecting 96 single nucleotide polymorphism markers that can be used as a pig tracer through an analyzer. It relates to a method for selecting a single nucleotide polymorphism marker for

Pig or domestic pig refers to domesticated wild boar, and its scientific name is Sus domestica. In Korea, it was called Tonap or Toyaji, and pigs were domesticated about 4,800 years ago in Southeast Asia and about 3,500 years ago in Europe, and improved breed pigs were introduced to Korea in 1903. Currently, there are about 1,000 varieties of pigs raised around the world, and can be divided into fat type (lard type), processing type (bacon type), and growth type (meat type) according to usage.

The production tracer system for pig production and traceability is to establish a system that can trace the entire process from pork production to distribution by computerization.It responds to consumers' safety and safety needs and converts domestic and Jeju pork to domestic and Jeju-made pork from sales outlets in large cities. It is being implemented in order to ensure that consumers can purchase accurate products by preventing them from being sold in advance, and to improve income for pig farms and stabilize the management of the meat processing industry.

Research using DNA markers has been actively conducted both domestically and internationally in order to provide accurate information on individual identification and ancestry in livestock. Previously, paternity identification and individual tracking were performed using a microsatellite marker, but the high cost of analysis and high error rate in the process of reading are emerging as a problem. According to the results of recent studies, it is possible to perform mass analysis of genotype at low cost using single base polymorphism (SNP) markers, and this is applied to trace the history of livestock products or to identify the knowledge of origin.

Korean Patent Publication No. 10-1341813 (a single-base polymorphic gene marker for individual identification and history management of pigs and a method for individual identification of pigs using the same) has been registered, and the prior art uses a marker to accurately measure heritability. It is about a method that enhances the reliability of analysis by utilizing it as a genetic analysis technique for history management of meat and pork, and enabling a change of functional individual time-specific tools such as RFID and genetic analysis methods.

Korean Patent Publication No. 10-0721232 (use of breed-specific DNA markers for obedience identification of major pig breeds in Korea) was registered, and the above prior art was used to distinguish five pig breeds in Korea. will be.

Korean Patent Publication No. 10-2011-0041668 (a single nucleotide polymorphism marker in pigs and a method for determining the origin of domestic pork using the same) has been disclosed, and the prior art is a single nucleotide that can be usefully used to determine the origin of domestic pork. It relates to a method for determining the origin of domestic pork by using a polymorphic marker and a kit used in this method.

Korean Patent Publication No. 10-2011-0011443 (development of a parental labeling factor specific to Korean native pig breeds and a method for discriminating Korean native pigs using the same) has been disclosed, and the prior art uses PCR-RELP technology, a molecular genetic analysis method. Thus, by detecting a DNA marker specific to Korean native pigs for the KIT gene, it provides accurate breed identification technology between Korean native pigs and other improved breed pigs.

The prior art relates to a method of identifying an individual and has a problem in that it is not easy to track the production and history of pigs because a single polymorphism marker for tracking the production and history of pigs is not selected.

KR 10-1341813 B1 (2013.12.10) KR 10-0721232 B1 (2007.05.16) KR 10-2011-0041668 A (2011.04.22) KR 10-2011-0011443 A (2011.02.08)

In order to solve the above problems, the present invention can be used as a pig tracer by analyzing genes after collecting tissues from five breeds of pigs consisting of publicly announced animals such as Jeju native pig, Landrace, Yorkshire, Barkshire, and Duroc. The purpose is to select a monobasic polymorphism marker.

In addition, the selected single nucleotide polymorphism marker has the purpose of improving the safety of food and consumer confidence, which is an essential element in the production and distribution process of pigs.

The present invention is a method for selecting a single nucleotide polymorphism marker for the introduction of a pig production and traceability system according to the present invention in order to achieve the above object. Characterized in that, after selecting single nucleotide polymorphism markers that belong to five varieties of pigs, 96 single nucleotide polymorphism markers that can be used as pig history are selected through an analyzer.

In addition, the 96 single nucleotide polymorphism markers are characterized by having a nucleotide sequence for individual identification and traceability.

In addition, regions where pig blood was collected for the selection of the monobasic polymorphism marker are Gangwon, Gyeonggi, Gyeongsangdae, Gwangju, Daegu, Daejeon, Seoul, Jeonbuk, Jeju, Chungbuk, and Busan.

After tissue is collected from 5 breeds of pigs consisting of the publicly announced animals Jeju native pigs, Landrace, Yorkshire, Barkshire, and Duroc through the selection of a single nucleotide polymorphism marker for pig production and traceability in pigs according to the present invention. By analyzing genetic traits and selecting a single nucleotide polymorphism marker that can be used as a pig history, it is effective in improving the safety of food and consumer confidence, an essential element in the production and distribution of pigs.

1 is a table showing the results of analyzing the frequency of selection alleles for each group according to the present invention
Figure 2 is a table showing the PIC results for each sample and single nucleotide polymorphism markers used for each device according to the present invention
3 is a table showing the single nucleotide polymorphism markers used for each device and NE-I results for each sample according to the present invention.
Figure 4 is a table showing the single nucleotide polymorphism markers used for each device and NE-SI results for each sample according to the present invention
5A to 5D are tables showing 96 nucleotide sequences in which the number of selected single nucleotide polymorphism markers according to the present invention

The present invention relates to a method for selecting a single nucleotide polymorphism marker in pigs for pig production and traceability.

Pigs used in the present invention were selected from five varieties of Jeju native black pigs, Landrace, Yorkshire, Berkshire, and Duroc raised in Korea, and the tissues of the pigs were extracted to extract genomic DNA, and then the single nucleotide polymorphism markers of the pigs were selected. It is desirable to select.

The Jeju native black pig (Korean native pig) used in the present invention is a kind of native pig living in Korea and lives only in Jeju Island. Native pigs distributed throughout the country appear to have originated from a small-sized native species among pigs raised in northern China during the Goguryeo period, and it seems that they were transmitted to Jeju Island at a similar time and grew as an indigenous species. Like other conventional pigs, the entire body is covered with shiny black hair, and the face is narrow and the snout is long. The ears are small, not folded, but raised above. Compared to other foreign species, the body is smaller and the abdomen is narrow, the chest is relatively wide, the hips are small and fleshless, and the legs are short and well-balanced. Females usually have 10 to 12 nipples and give birth to 5 to 8 offspring. Cubs grow relatively slower than those of foreign breeds, so they reach 3.5 kg after 3 weeks and 25 kg after 100 days. It has strong resistance to disease and good adaptability to environmental changes. The quality of the meat is excellent and the taste is good, so it is mainly bred for food.

In addition, Landrace is a large-sized pig for processing, which is a hybrid of a native Danish breed and a large white breed from England. The first lineage registration of the Danish Landrace species was in 1906, and it was imported in the mid-1960s in Korea and is currently being raised. It is also called the American Land Race, the Swedish Land Race, and the British Land Race, given the name of the improved country. The color is white, the body is long, the back is curved in an arched shape, the ears are large and stretched forward, the neck is thin, and the leather is thin. In addition, the weight is about 250 kg for females and 300 to 350 kg for males at maturity, and it is fertile, giving birth to an average of 11.7 at a time, and has a defect in that the legs are not strong compared to other breeds.

In addition, Yorkshire is a breed made by crossing Berkshire, España, Chinese, and Neopolitan species with white native species in Yorkshire, England around 1860. The color of the fur is white, and there are two types, the Great Yorkshire species and the Soyokshire species, and these two varieties were crossed to make the important Kshire species. Important Kshire species were introduced to Korea, but in recent years, large Yorkshire species have been multiplied. The United States includes the Great Yorkshire species as the Great Yorkshire species without distinction between the Great Yorkshire species and the Great Yorkshire species. The Great Yorkshire species weighs 300 to 330 kg, has a carcass rate of 75 to 80%, and gives birth to 11 to 14 offspring.

In addition, Berkshire is native to Berkshire, England, and has a short neck and legs, a short snout, and a lot of curvature in the stomach. The ears are standing upright, and the chin is too thick. The color of the fur is black, and there are white spots on the face, tail, and four legs, indicating six hundred. It has a strong constitution and is easy to breed as it adapts well to preferences and climate. It digests coarse feed well, is premature, and has strong maternal love. It has a high carcass rate of 80-90% and is suitable for ham or growth because of its excellent meat quality, but it has a lot of fat.

*In addition, Duroc is a native of the eastern United States, has a large body, a deep and thick body, and has a slightly arched back and a well-balanced back. The head is small compared to the body size, the ears are drooping forward, and the coat has several layers from red to dark red. With a strong constitution, it withstands heat well and has strong adaptability to climate conditions. The weight is 280~400kg, the boar is 340~500kg, and the carcass rate is 73~78%, which has good meat quality and is a premature breed. It gives birth to about 10 offspring at a time, and it is gentle and raises offspring well. It is also raised a lot in Korea, and it is widely used as a male when producing a three-way hybrid (三原交雜種).

In addition, the sample axis used in the present invention was sampled from 95 commercial pigs for each region, 1,045 pigs from a total of 11 different regions, and DNA was extracted from each muscle tissue and genotyping was performed to develop a single nucleotide polymorphism marker. .

In addition, as for the pigs airborne in the present invention, 11 regions were selected: Gangwon, Gyeonggi, Gyeongsang National University, Gwangju, Daegu, Daejeon, Seoul, Jeonbuk, Jeju, Chungbuk, and Busan, and single nucleotide polymorphism markers for the regions were selected.

Hereinafter, the present invention will be described in more detail through Examples and Experimental Examples. However, it is obvious to those skilled in the art that the following examples are for illustrative purposes only and do not limit the scope of the present invention. That is, simple modifications or changes of the present invention can be easily implemented by those skilled in the art, and all such modifications or changes can be seen to be included in the scope of the present invention.

In addition, FIG. 1 is a table showing the results of analyzing the frequency of selection alleles for each group according to the present invention, and FIG. 2 is a table showing the results of PIC for each sample and single nucleotide polymorphism markers used for each device according to the present invention. A table showing the single nucleotide polymorphism marker used for each device and the NE-I results for each sample according to the present invention, FIG. 4 is a table showing the single nucleotide polymorphism marker used for each device and the NE-SI result for each sample according to the present invention, and FIG. 5A To FIG. 5D is a table showing 96 nucleotide sequences for the number of selected single nucleotide polymorphism markers according to the present invention.

Example 1.

To select Single Nucleotide Polymorphism (SNP) for individual identification, Jeju native pigs (KNP) 19 heads, Landrace 17 heads, Yorkshire 168 heads, Berkshire 84 heads, Genomic DNA was extracted from the pig's blood using 96 duoc (Duroc) heads. For the genomic DNA extraction method, 300 µl of blood was treated with 900 µl of red cell lysis solution (0.8% ammonium chloride, 10 mM Tris-HCl) to hemolyze red blood cells, and then the recovered leukocytes were collected by Miller et al. (1998). Was partially modified and extracted, and RNA was removed by treatment with RNase (iNtRON, USA). The DNA recovered from the removal of the RNA using the Ethanol precipitation method was dissolved in TE buffer and stored, and the absorbance was measured with a NanoDrop ND-1000 spectrophotometer (Thermo, USA), and DNA with A260/A280 1.8 or higher was 50 ng/µl. And used as a template for PCR amplification.

The allele was analyzed using the high-purity quantified DNA (200 ng/µl) and Porcine SNP60 DNA analysis Kits (Illnmina, USA), and the analysis method was performed by amplification of DNA, followed by fregmentation, and injection into porcine SNP60 BeadChip to perform hybridzation After completion, an X-stain process was performed, followed by flourophore labeling. The scanned results classified alleles for each single nucleotide polymorphism marker through Bead Studio version 3.1.3.0 (Illumina, USA).

The minor allele frequency (MAF) 5% or less, genotyping error 10 using Plink (Shaun et al., 2007) for single nucleotide polymorphism marker alleles for obedience of the 5 varieties. By removing monobasic polymorphism markers with a Hardy-Weinberg equeilibrium equal to or less than 0.001%, 39,785 Jeju native pigs, 42,156 Landraces, 44,961 Yorkshire, 41,408 Berkshire and 39,652 Duroc were each 1 The first selection was performed, and the frequency of minor alleles was calculated among the first selected single nucleotide polymorphism markers, and 40% or more of the single nucleotide polymorphism markers were selected, and 312 single nucleotide polymorphism markers jointly belonging to the five cultivars were secondarily selected. After analyzing the linkage disequilibrium (LD) value for each chromosome pairwise for the secondly selected single nucleotide polymorphism marker, a total of 133 single nucleotide polymorphisms of 4 to 9 for each chromosome is given priority to the marker with a low chain disequilibrium value. Markers were selected.

Experimental Example 1

Among the 133 single nucleotide polymorphism markers selected through Example 1 above, 69 single nucleotide polymorphism markers capable of probe design were selected so as to proceed with ^{Fluidigm's SNPtype TM Assay, and selected through a prior study at the Institute of Livestock Science.} One additional 27 single nucleotide polymorphism markers were selected, and a total of 96 single nucleotide polymorphism markers were used as single nucleotide polymorphism markers for individual identification for pig history, and the fluidigm analyzer was used.

Experimental Example 2

PIC, NE-I, and NE-SI according to the allele frequency range were investigated for the selected 96 single nucleotide polymorphism markers using a fluidigm analyzer.

The PIC is short for polymorphic information content and refers to the amount of polymorphic information at a locus. The PIC always has a smaller value than the heterozygous degree as a probability of determining which of the two alleles inherited from one parent at the locus of the offspring. In addition, as a value indicating the degree of genetic polymorphism for each marker, the higher the value, the higher the polymorphism and is used when selecting an individual identification marker.

The NE-I is an average non-exclusion probability for identity of two unrelated individuals, which is a probability that cannot be distinguished between two individuals, and NE-SI is an average non-exclusion probability for identity two siblings, which is a probability that discrimination between brothers and sisters is impossible. Hereinafter, it is specified as PIC, NE-I, and NE-SI.

The experiment was conducted by dividing the frequency range of the allele into two. In the selection range 1, the allele frequency was designated in the range of 0.35 to 0.65, and in the selection range 2, the single nucleotide polymorphism marker was selected by adjusting the allele frequency in the range of 0.3 to 0.7. Single nucleotide polymorphism markers were selected using the allele frequency value, and distributions of NE-I, NE-SI, heterozygotes, and homozygotes were considered.

Among 96 single base polymorphism markers that can be used with the Fluidigm's analyzer, single base polymorphism selected from 11 regions consisting of Gangwon, Gyeonggi, Gyeongsang National University, Gwangju, Daegu, Daejeon, Seoul, Jeonbuk, Jeju, Chungbuk, and Busan The number of markers was 34 in the criterion of the selection range 1, and 49 were selected as the criterion of the selection range 2.

Experimental Example 3

Allele frequency and identity analysis were measured using an analysis program using Fluidigm and AB analyzers.

In order to analyze the allele frequency and identity of the analyzers of the two companies, an experiment was conducted by classifying them into three groups. The first group of the three groups was analyzed using 59 monobasic polymorphism markers and 465 samples that can be used equally by the two companies of Fluidigm and AB, and the second group can be used equally by the two companies of Fluidigm and AB. Analysis using 59 mononucleotide polymorphism markers and 417 samples, the third group limited the frequency range of alleles to 0.3-0.7, and among the selected mononucleotide polymorphism markers, the fluidigm company and AB company can use the same. Analysis was performed using 30 monopolymorphism markers and 417 samples.

The used sample was a muscle sample of the selected regional pig, and the second group and the third group sample were analyzed as samples that did not contain 48 monobasic polymorphism markers requested by the company AB.

The results of analyzing the allele frequency are shown in the table below.

<Analysis of selection allele frequency by group> Group 1 Group 2 Group 3 Analysis monopolymorphism marker 59 59 30 Allele frequency
Value difference 0.05 or more 17 14 4 minor allele change 7 8 5 Change of selection target 8 8 One

Identity analysis was performed based on the results of analyzing the frequency of the alleles.

Through the identity analysis, it was investigated whether the same samples of Fluidigm and AB in the three groups showed exact identity. Matching accuracy was investigated after identity analysis based on 50% of the single nucleotide polymorphism markers used for the minimum identity loci and half the minimum identity polymorphism markers for the maximum identity genetic loci.

As a result of the above identity analysis, the first group showed a ratio of 84.1% of 391 identity analysis results out of a total of 465 samples, and the second group showed a ratio of 91.6% of 382 identity analysis results among a total of 417 samples, and the third group. In 417 samples, 391 identity analysis results showed 93.8% of the total. Compared to the first group and the second group, the number of monobasic polymorphism markers used in the third group was small, but the identity ratio was increased.

Experimental Example 4

The monobasic polymorphism markers and samples used by Fluidigm and AB were classified according to various criteria to compare the probability.

The single nucleotide polymorphism markers used in this experiment were classified into a total of 5 categories, the first was compared to all single nucleotide polymorphism markers used by each company, and the second was to classify the single nucleotide polymorphism into two categories. The selection range 1 is a value considering the distribution of PIC, NE-I (removing more than 0.4), NE-SI (removing more than 0.62), heterozygous, and homozygous while the allele value is between 0.35 and 0.65. In the selection range 2, the range was adjusted upward from the selection range 1, and the allele frequency was compared with a value of 0.3 to 0.7. The fourth was compared with a single nucleotide polymorphism marker used in the same manner by Fluidigm and AB, and the fifth was compared with a single nucleotide polymorphism marker selected in the range of the selection range 2 among the fourth classified monobasic polymorphism markers.

In addition, analysis was performed with monobasic polymorphism markers classified into the above five according to the number of samples used in this experiment. This experiment was conducted by classifying the number of samples using each sample into three types. First, 1,045 samples used by Fluidigm and 474 samples used by AB were analyzed together with a monobasic polymorphism marker, and secondly, 465 samples used identically in Fluidigm and AB were monobasic polymorphism markers. In the third analysis, 417 samples were analyzed with monobasic polymorphism markers excluding 48 samples requested for exclusion from the AB company, and the comparison contents were PIC, NE-I, NE-SI, and the result was It is shown in the table below.

<Single base polymorphism markers used by device and PIC by sample> Total Selection range 1 Selection range 2 Same use Selected during the same use Number of analysis markers
And number of samples 102 27 37 59 30 AB company 1.474 0.344 0.3712 0.3639 0.3416 0.3579 2. 465 0.3441 0.3712 0.3639 0.3417 0.3579 3. 417 0.3443 0.3709 0.3638 0.3421 0.3581 Number of analysis markers
And number of samples 96 34 49 59 30 Fluidium 1.1045 0.3608 0.3731 0.3719 0.3565 0.372 2. 465 0.3605 0.373 0.3717 0.356 0.372 3. 417 0.3605 0.3727 0.3715 0.3558 0.3704

<Single nucleotide polymorphism markers used by device and NE-I by sample> Total Selection range 1 Selection range 2 Same use Selected during the same use AB company Number of analysis markers and number of samples 102 27 37 59 30 1.474 2.34E-40 4.16E-12 5.50E-16 1.66E-23 6.51E-13 2. 465 2.26E-40 4.17E-12 5.49E-16 1.61E-23 6.48E-13 3. 417 2.17E-40 4.26E-12 5.54E-16 1.52E-23 6.41E-13 Fluidigm company Number of analysis markers and number of samples 96 34 49 59 30 1.1045 5.54E-40 3.90E-15 2.02E-21 1.49E-24 2.12E-13 2. 465 5.98E-40 3.96E-15 2.08E-21 1.62E-24 2.11E-13 3. 417 6.02E-40 4.07E-15 2.15E-21 1.68E-24 2.43E-13

<Single nucleotide polymorphism markers used by device and NE-SI by sample> Total Selection range 1 Selection range 2 Same use Selected during the same use AB company Number of analysis markers and number of samples 102 27 37 59 30 1.474 1.67E-21 9.5E-07 9.06E-09 1.11E-12 0.00000036 2. 465 1.63E-21 9.5E-07 9.06E-09 1.11E-12 0.00000036 3. 417 1.59E-21 9.5E-07 9.06E-09 1.11E-12 0.00000036 Fluidigm company Number of analysis markers and number of samples 96 34 49 59 30 1.1045 2.20E-21 2E-08 1.10E-11 3.06E-13 0.00000019 2. 465 2.32E-21 2E-08 1.12E-11 3.22E-13 0.00000019 3. 417 2.33E-21 2E-08 1.15E-11 3.30E-13 0.00000021

As a result of a comparative analysis of the results of the SNP genotyping related to pig hysteresis conducted by Fluidigm and AB, the single nucleotide polymorphism markers used by Fluidigm and AB were 96 and 102, respectively, of which the same was used. There were 59 monobasic polymorphism markers, and 1,045 and 474 samples were used to select the monobasic polymorphism marker, respectively. The single nucleotide polymorphism markers were classified into selection range 1 and selection range 2 and selected, and as a result of the above experiment, the selected single nucleotide polymorphism markers were 27 selected as a result of using an analyzer of AB company, and the selection range 2 was 37. As a result of using Fluidigm's analyzer, the selection range 1 was 34 and the selection range 2 was 49. The number of single nucleotide polymorphism markers selected based on the selection range 1 and selection range 2 was 61 and 86, respectively.

The call rate, which means the proportion of individuals whose genotype was determined, was 96.56% for Fluidigm and 84.98% for AB, indicating that the fluidigm genotyping result was 10% or more high. In addition, as a result of investigations on PIC, NE-I, NE-SI, etc., the genetic analysis conducted by Fluidigm showed that the PIC value was closer to the optimal value than the result of the gene analysis of AB company. The NE-SI value also appeared to be a smaller value.

Through the above experiment, the final single nucleotide polymorphism markers for the final pig history were corrected, and the number of selected single nucleotide polymorphism markers was 96, which are summarized in the following table.

Sequence number SNP name Base sequence One ALGA0003632 GCTGCTTTTAGAATCCTTGCTTTAACTTTTGCCATTTTTATTGTAATATGTCTTGGTGTG[A/G]GTCTGTTTGGCCTCACCTTGATTGGAGCTCTCTGTGCTTGCTGTATCTTGATGTCTGTTT 2 ALGA0005188 ACTAGTTAAGCAAGCCTGCCTTGTTCTGAGGGCTTTCCTGAACTTCCAGTGGCCTCTCAG[T/C]ATCCCCCAGCTTTCCCTCTTTATCCGTGATCCCCTATTGGTGCTTCTACAACCACCTGTG 3 ALGA0010607 GGTCTGTGGACCCCGGGAACGCGACAGGATTAATGACACAGACCATGACCTGAATTTCAC[A/G]GCAGCTCCACCAAACTCCTAGCTGGGGACCTTGGACTTGGGACTTCTGGGTGATTTCCAG 4 ALGA0012333 TTCTGTGCCAACCCCCTGGGGCCTGCCTGATGCTCTAAGAATCACAGACTCGCCCAGCAG[A/G]GAGGGATTAGCAAGCTGCTAAAAAGCCTAACCCCTTCAGGACAGAGATGAGGAGCCCCAG 5 ALGA0028052 AGAAAAGCAACAAAAAATTACTCAAAATTATTTCAGACTTTTAAAAAGGCCCCTGAAGCT[A/G]GCCATGTTCTGTGCTCCTCCTTGTTCCTTTAAGTGTACACAGACAGGGAGTTCCCATCAT 6 ALGA0033986 CCTCAGAAAACAGGATGTAAGTTGGTTGGTGTCACATCTTGGTTAGGATAAGCAGCTGCT[A/G]TTGATAGCAACTGATTAGTTCTAAGGACTGGTTATATACCACACGTGAACTTCAAAAGTG 7 ALGA0034886 GCTATAGACTCCGTAAGATACTGAATAAAACTGAACTCATAGCTCCCCCCTATCCACTCC[A/G]CTTTTTAGGGCTGCACTTGTGGCATATGGAAGTGCCCAGGCTAGCGATCAATATCAGAGC 8 ALGA0038635 AATAGAGTTCCCCTTTGTTAAGGATGAATCAACAAAGCCTAGGAAGTTGGTGGTGATTCG[A/C]CTTCCTAGGACTCTTGGGGATGACAGCTCAGTCATCTTTGCCCCTTGGGTTTTACTGTTT 9 ALGA0043483 TTAGCCACAGGGTAGGAAAAGAATCTATCTCTCAGTCTTTTCCAATAAACCATAAGCTGC[T/C]TGAAGCSAGGGATATCCTCATTCATTCTTTTGGTCTCAATTGCCCAGCATAATGCCAGGT 10 ALGA0056803 CTGGGCTGCTTATCTGGAAAGCGGCGAGGATGATAGTAGTCAATGGAATACCTAACAGCT[A/G]GCGACTGCCTCTGTGGGCAGCACTTGGGCAAATATTTTACATCAATGATCGCCAAGTAAA 11 ALGA0059061 GGCACTGCCTGTTGTCCCAGCACCCCCAGAGTGTGGGCCAGCTCCCATCACATGYACTGA[A/G]GAAAGAGCCTCTGCCAATCCAGGCCCCATGTCCCATCTGACTGCCCACAAAGGCTGTGGT 12 ALGA0064392 GCTGCAACCAGAGTCACAGAAGTGACAACACTGGTTCCTTATCCCGCTGAGCCATGAGAA[T/G]CTGTACTTTTAGAAGAGCTGAGTCGTCTCTTAGCTGCCTTAAACCTAGTCCTGGTCCCAA 13 ALGA0067483 ATGTTTTCTGAACCAAAGTAAGAACATGGGATCTGACAAATGTACTTATGGGGGACCTGG[A/G]GTGTGCTGTCCTTGAGACTGGAATTGGGACTCTTAGCCAAAATCACACAAAAATTAAGTA 14 ALGA0072858 AGCTTCCCTCCTAAAATTATTATCTATTAATAGTAATAATGATAATAGCTAACACATGTA[A/G]TGCTTACTATATGATAGGCACTATCCTAAGAACTCATGAAATGATTCAATATTCTTAGTT 15 ALGA0075911 TTGGGTTGCTACTGTGATGCTGTTTGAGCCCTATCTCCAGAACTTCCACATGCTATGAGT[A/G]CAGCTAAATTTTTAAAAAGCCCCCCCCCCCACATCTTTCTTTGTGTAAATTTGGCCAA 16 ALGA0085130 CTCCTCTTTTGAACTGTGAGAAATAAACTTGTCTTTTCAGTTAAGATCATCTCCTGATCT[A/G]TCAGCTTTCCTCTACCTCAAAATTTTTATTAGTACTCTGTATTTTAAGACAAGATGTTGT 17 ALGA0089251 TACGGTTTACTTATCAGTGAGATGTCCCCCCTTAGTTTAGAGAGTTTCCTTACATATCTG[T/G]TATAATATCTGGCCCCAGAAGCTATGTCTTGGGGATAATATATATATATGATCCTCTGAT 18 ALGA0092844 CACCATTAGAGGGGATGCTCTCTAAGGCTGCTTCGTTCAAACTTCCTGATTCCAGCTGCA[T/C]GCAGGTAGGGAACAGAGCTGACCATGACCGAAGGACACTTGGAAATCCACATATTAGCAC 19 ALGA0093942 AGATGCCTGGTTCTCCAGGCATGGAGACAAACCCACAAGAGCCAGGGTCTCTGAGAAGCT[A/G]TTCTGGAGGACACACACTAGGGTTGAGTATTGGAAAGAAAGTGGGAGACAAAGGAGAAGC 20 ALGA0095059 TGGATGGCTGACCACCACCCATGCTCCCTGCCCTCTGGCTTCTAGCTGAGTTTGACCAAT[A/G]GAAGAACCAGTGGGAAAGTCAAGGGGAAAGGAGAGTAAGGTTCTCTTGCCTGTCTTCCTA 21 ALGA0097857 GGGTTGGCGAAAATCAAGGGTATCCTCAGAGAAGAGACTCAGACACAGCCCTCAAAGTGC[A/G]CACTCAGGCACTTGACGTAGCTTTAGTGCTACCTCTTCAATATCTTCGAGAGTGAGGAAA 22 ALGA0110410 TGGGGCTTCACCACCCAAATGGTGGTAGGTTGATGAGGCCAGAGATGGTGAACCCATGTC[A/G]GGAATAGGTAACTGGTAAGCCGATTGCTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNN 23 ALGA0115847 CTGTTGAGTCTGGGGATGCTCAGGCCTCAGAGAGGTGTTCAGGGATGCTCCTGAAAATCC[A/C]AGAATCAGGTCTCTCTGACCTGGGAACACCCAGNNNNNNNNNNNNNNNNNNNNNNNNN 24 ALGA0119982 GTTTCTATGGGGCATCTCAGGAAGCAGTGGTGGGCAGTGAGGGAGGTGATACAGGTACAG[A/G]CTGTGTCACTTCGAAGTTGTCCCGTGGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNN 25 ASGA0006871 CTTTTCCAATTCTCACTGGCACCTGGATCTTAGACCTCATCCAGATGCCTAGAATCAAGG[A/G]TTGGCATTGAGGGTGAGCCAAGTGAGAAGTGAGCTAATTGCAAGCCCAAGAATGACTTGG 26 ASGA0009403 TTGAAGTCAGGTAATTCTAAATGTGACTTACAAGTTCCTTTTCCAGGAATAACAAGAAGC[A/G]GCAAGCRCATTATGGATTAAGCTCTTGTGGAGTGCCAGATTTGGTTCTAGGTGTTGTGTT 27 ASGA0011793 AAAGCTTGACAAGCCAATGGGTGAACTAGGGAATACGCCATGGGGCTATCAAACACTTGT[A/G]CGAGCAGCTCATCAGTAAGCAGCCAAGTGGCAAATTGGGATTGACTGGGAATGCTGAGCA 28 ASGA0017082 TAAACAAAACCAAATGTGCATATTAAACACGAAACTTGGTGATCAATAAATTCCAAAGGC[A/G]GAGCAGGTTAAGTTGCAAGAGGCGATCCAGCTCAGCTGGGTTCCCTCACAGCTGGAACAC 29 ASGA0018449 AATGACTTACACAAAGCCATTCACCAGTCAACAGGAGAGTTCAAGATGCACAGTTCTCCC[A/G]TGTTCCACCATTCTGTCTCTTGAGCTGTATGTTTCCCTTGAGAGCTGATGCAGGTCTCAA 30 ASGA0031089 AAGTGGACCAGAGAAGTGGCACATCGCCTCCCTTTAAGCAGACTTCCCAGAAGTCATTCA[A/G]ATATTTCAGCTTACAGCTCAAGTCAAAGCTTGATAGTGGGGCCACACCTATTCTCAGAGG 31 ASGA0035601 TCAGGCTTCAAGCCACTTCCCCAAAGAGCTTCACTCTCCTCCTCAAAAGATAAAATGAGA[A/G]TGATGATGCCCACCTCAGATGCAAAGTGGGCTAAGGTACCCTGGGTTAGGGCTAACTGCC 32 ASGA0040082 CCAGGAGGGAGACGTTCAAATAGGTTCCTCCAGCTACTTGCAAGTGAACTTGAAAAATGA[T/C]GGGCCACCCGCAGGACTCCTTTCTAACGTGACAGAGCGGATGCATTTGCGCATCAGCGAG 33 ASGA0041336 AGTATGTCTGAAACATTCATGCGACCCAGAGGAGCAAATTCTGCATGTGGATTCTAATGG[A/G]TTTGTCTTTCTCCCTGACTAGCTCAAGGTTCCCCCAAATCCAACTCCCACTTCACTCTGT 34 ASGA0042099 ATTCATAACACTCAACCTGATCCCCTTGGCCTTTTTCAGTATTGAACATGGAATAACCTA[C/G]AGCTTAGTCTGTTGGTCCATTCATGAATGTCATGTGGTGTGAGTCATCTATGCACATGAC 35 ASGA0060257 GAGAGAACCCCGCCCCGCCTTTGGGATAGAAAAGCTCCGCCGTGTCCCAAGAACAAGTAY[A/G]TGGTTTGGCCCTTGAGATGATGTGCAGACACAGGGACCCAGGGATTCACAATCCACTGGA 36 ASGA0060872 AGACTACGCTTTATCTTCCCACTGGAGCCAAGTAGGGAACGTGAAATGGGGCAAAGGAGG[A/G]AGACAAAGCAGAGGACAGAGCCCAGGAGCTGGATCGAGAACCTGCCAGCCTCTGGGGCCT 37 ASGA0094977 GTGATATTATGTTGCTTCCAAGACAAGGTCAAGTGTAATTTCTGCCTCTTGCTGTCTCTC[A/G]GATGGCTTGCTCTGGGTGAAGCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 38 ASGA0096881 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGGAGTGACAGGACATCC[T/C]GTCTCTCTCCTGATTCTAATCTGAGAGTCCTACCTCCAAGGCCCTTGGTACCTGCTGC 39 H3GA0000077 GGTCCTCATGAGAACCCTAGGAGTAGATCGTTTAAAAGACTGTCCTTCATTCTGCAGAAG[A/C]GGCGGCCGAGCCCTGAGAGGTTACGTGAGTTTCCCCAGCTGCACAGTGGGCCCCTGACAG 40 H3GA0009291 TCGACCTGTCCTGCACGTTGTGATAAATGGTCCAAAGGAAAGGAGAAGAGGCCACAGGAA[A/G]TGGAGGAGGAGGATTCAGAGGTGAAGGGAACTCCCTCTGGGGAGGTGACACTGAGGCTGA 41 H3GA0012015 GTGGAAGTGAATGAGGTCAGAGCATTGGGAGGAGAAGAGCTAAGACAGGAAAGTCCAGAT[A/G]GAATTTTGATGCTGGCCGAAATCCATCATATGGCTAAAGCGCATCTTCCTACATTCTACT 42 H3GA0027004 TCTCAGCTAAGAAGGAAAACAAGAAATGTCACTTGCTACTTTCTTTTTCCTAAATCAGGA[A/G]ACAACCAATGAGATGGCCCCTCTGCAATGAAATGAGCTAGTAAAGAATGTGTGACATCAC 43 H3GA0031439 ACTCCACAGTGATTATCTCTTTGTGAGTCTCTTGGTGAAGGGACTGGGGGCTCCAGGAAA[A/G]YAAGGACTAAAAATTGGCCCTTGAACTTGGAAACACTGAGGCCACTGAGACTTTGATGAA 44 H3GA0046698 TCACCCGCACGGCTAGGATACCTGCAGGGAGCCTGGGTCTGGAGGTGGCAATTGGTTTYC[A/G]GAAACAAAATTTCATTTTCTAGGGGCCAGGTAAGGGCGAGCCTAGTCTGGGTGCAGGGCA 45 H3GA0048952 TCCGCAGTGCAACTATACTTAACTTTGTCAGTTATAACTCTACCTTTAAGTACTTCTTGG[A/C]GCCTGGCCTTCCCCTGTGCTTGTTACCTCAAACTGATGAAAATAGGAAAATAGTAAAACA 46 M1GA0008026 CAAGTTTTGCTTTTTGGAACTGTATGGAAATATTGGGGGGAGGTAATACTTTTGTTCCAC[A/G]TCGGTTGAGTTTCCGGATGTGGAATCTGCAGATACAGAGACTGACTGTGTAACACAATCA 47 M1GA0011894 CAGATTCCAGTTGGAACAGAAGATGCTAAGTGAATAGCTTCCACCTTTGAGCCAAATCCA[A/G]TGTTGTAACAACCCGGCTACGTATATGCTCAAGATGCTAAGCTCCTACAGAGAGAGATCT 48 MARC0004720 AAAATTGCACAAAGGACCATAGGGGAAACCCAAAGGCTGGTTAGATAGGGTCTATTTTCT[T/C]CTTAGCCTATGAGTCATTTGGGGAAAAATTACAGAGGGCATAGTGATCTTTGATTTACCA 49 MARC0008528 TAATTTATACTGCATGTACTCTTGGGGTCATGAGACCGTCTGGACCTCTGCTTACAGCCC[A/G]GGGAACTTTAGTCACTTGTGATGGAGCACGATGGCAGACAATGTGAGAAGAAGAATGTGT 50 MARC0055696 TACAGATTTCAGCCAAAGCCACAATTGCCACGTCTCATCACCTGGAATTAAACAGCAAAC[A/G]GGGCTGACTGGTACCGCTGAGGAAACACAAAGATGTGTTGGCAACTCCCGGGAGCGGAGT 51 MARC0065987 CCGTTCCAATGGTTTGATCTTCTCGTTTTCTTCTGTTAGCAACTGTC[A/G]AGTGGGCAGCATTGTCACAATGTTAAATGGACCTTTCTCGGCTGATTCGCAACGGGGTCT 52 MARC0076283 CCTAAGCCTGGCTGCCATGGGGGAAGTACCTAAGAGCTTGCTTGAGGAGACCAAACTACG[A/G]TTCTTAAATCATCAGACCTGGGTTCAGTCAACCTAGCATAGCCTGGCGCATAATGAAAAG 53 gn-SNP01 CCGTGTAAGTGGGGGGGGGGTGGACCTGGGCAGCTCTAAGCACCCCTCCCCGCAAACCTG[A/G]CATCAGGGATTGCAGATCTGGGGTGGCAGGGAGAGTGCCCAGTTTAATAACTGATGAATT 54 gn-SNP02 ACCAGATACAGACATGGTGAGTATATTCATGGCTTGGCTGAAAGGGGTTTTTTTTAAACC[A/G]AAGTATTGTTGATTTACAATACTGTCAATATTGTACCAGTTTCTGCTGTACAGTAGAGTC 55 gn-SNP04 TTGAACCCGCAACCTCACGGTTCCTGGTCGGATTCGTTAACCACTGAGCCACAACAGTAA[T/C]TCCTCAATATTAGACTTTTCATCCTCTGTATAGCTTGTAAAAACTAATAATCAGTTAATG 56 gn-SNP06 TCTTATGCTAAATGACAAGAGCTATGCTTTTACTTCTTTTTTTCTTAGAGCTCAGGACAA[C/T]AGAAGTTGAAACAGCCCAAGAAATAAAGAAATGTTGAAAGATGATACATTTTGAAACCTG 57 gn-SNP14 ACAATTTTAGTATAGGTCTACCTGCTTCAAACACTGTATAAAGCATTACACTAACAAATC[C/T]GACTGCACCCTTATCTACTAGTGCAGCTGAGGAATGAACAGGTATTTCTGTGAAGTTTCA 58 gn-SNP19 TTGAATTTTCTGCTTAGGGTTGGAACCAGTTTCTTTTGTTCTGAGGATTTATATTTTTCT[T/G]TTAAATTTAGAAAACAGCTGGTCCTTATTTCTTCAAAAAATCTTCCCCCAATTTCTCTCT 59 gn-SNP22 GCGCCCATTTTCCAAATCTTTCTCAAGTTCTTCATTTAAACTCTAACCCGGAGCTACTTA[A/G]GAAATGAGATTCAGGGACGTGCAGTTCACAGCCTTAGCCAAGTCGAAACAGCACTGTCTG 60 gn-SNP25 CTTACGGACTTTTCAGACGTACATATTGCCCGCCCCCCTTTTTTTTAAATCATCAAGCTT[A/G]GGTTAAATTACTGTTTCCTATGCTAAAAACATGTCAGTTTTGTAACATCGCATGTACAAA 61 gn-SNP30 TGTGCCGCCCACGGTCCTCCCGACCATGATGCCCATGGATGCTACCGGCAGGGATGGGAG[G/T]CTGCGTGGACTCAGTGTGGGACACGGAGAAAAGCAAAGGGCCGTTTCAGGGACAGAGGAG 62 gn-SNP31 GAACATATTAACTATTGACTAGAGAATGTTTCGCTATCTGAAAGGAGCCAGAAAAGTCAC[A/G]AGATATGCCCTAAATTTCATCCATTGACAAGGGAGAAGTGGTCTCAAAGGACACATTTAA 63 gn-SNP32 AAAAGACCATAAAAGAGAAGAAGATAGCAAGTCTGGAAGTCCTGGTGGGAAGCCCCGGCT[A/G]AAGCAGACTCCACAAGGAGAGGGCAGGGTGGGGGCCTGGCATCTTGTTCGGGCTTGTGTG 64 gn-SNP34 TACATTTCTCAGAAACCATAATCAACAGCTATCAATATAAGCAAGTGATGTCTTATTCAA[A/G]TTATTTGTTTGGTGGCACCTTAGGGATTGTTTCTTTCATAGGGCAATGCAGAAACTACAA 65 gn-SNP35 CACTAATGGAAGTAGTTGACAATAACTGACAAAAAAGCAGGGTTTAATGCAGAATATAAA[T/C]GGTAAATATAAAGTCTGCATAGAAATATCAGACGTTTACAGCAAACAAACAAAAAGCCCT 66 gn-SNP40 TATGTTATGATTTTGAATATTAACTCTATTGCATATCCTTGTGCCCCAAATCTACACAGT[T/C]GCATGTGCCATAATAACTGTAAGTTTATTCTTATATAATAATAGTTTACAGAGTATACTCTAT 67 gn-SNP41 AAATCTATCTACATCCTCTTTAGATTCCACGAGTTGCTCCTCTCCGAGGATTTCTCCTTC[A/G]GCACGTGTCGAGCTCTCAGTGTCACGGTCATTTTTTTATCCTTTTCCCTTCCATTGATTC 68 gn-SNP50 GTGTGTGTGTGTGTGTGCGCGCGCGTGTGTGTGCCTTGTCCCTTCCTGGGGTCCGGGTGC[C/T]AGTGTGGTCTGTGGATCTGTGGGTCACTGCGTAGCTTCCCAAGTCTGTGCATGCTGAATG 69 gn-SNP51 AAGACAGATTTCAGGACTGTGCTGACAATGAATTTCTATAGTTATCAATTATGCCCTCAT[T/C]AAAATGTTCCAACTTGGCAAAAATTTAAACAATGTAACTTATAAACATAACATCCTTTTT 70 gn-SNP55 CCAAAATGGAGTTACTTAGGCTAAGCCCCACATCACCAAATTCACCTCGATTTGACTTAA[T/C]TTATTTACAGTTTTGGCTCTCCTAGAAATGGNGTCTTNAAGCCNGTCNANNNRGNANTNN 71 gn-SNP61 CACCAACTGATTCAATTAAAGATCTCCTAACCATGATCTTGTGTTTTCTTTTTAAGTTAC[T/C]GCCTCCAAAATGTTGTTTGGAATTATTTTTTTCCCCAAATGTTACAAAAATGCAAACATT 72 gn-SNP64 GACTATTCCATAACATGTAAGAATTCCACGAAATTTGAGTTTTACCGCCCATAACGGTTT[C/T]ACTGGCGCTCAGCACCCACTCCTTTAGGCCTGGCCCGCAGCTGCTTCTGCGCTCCTCCGG 73 gn-SNP67 AGGAGGGTCACTGGCTTTGGTTTTCTAGGCCCTGGAAGGGCAGCCAGAACCCACAAGCTG[A/G]AGAAACTGGGGCAAAGACCAAACGCTCACTGCACTGGATCATAAGCTTCCTTGGTCCCCC 74 gn-SNP72 ACTAGCAAAACAAAATACCAGAATGATGTAAAGCTTAAAAAAAGAAGTCTCTATTGGAAG[A/C]AATTCTGTAGTTCAAANATCCAGTATTTTGTGACTCTCTTTGAAAACCCTTTTCTGCCAT 75 gn-SNP79 CACCAGGATGCCTTGTACTCTGACTCTGGACATCCATAGAGCTGTTAAGTACTGAACTCT[C/T]GGATTTTGCTAATACCTCTAAAAAATTAAAAAGTCCATGTGACTGCTTGCCAAGAAAAAT 76 gn-SNP81 AATAATACAGTTTTGCCTATCACTCATGGCTAAAACTCACTGGCATGGAATATAAAAGAT[A/G]CTGTTGGGGAGGAAAAGATTTTCCTCTGTCCTTTTAAGTTCTGGCTGGTCTAAGAATTAA 77 gn-SNP83 NNNNNNNNNNNNNNNNNNNNNNCTGTTCCAGTGATTGGGAAAGGCAAAGCTTGTACATTC[A/G]TTTTATAAGGCTGATCTTGCCTCAAAACAAAACAGGGAAAATAGGAGAAATAAAAAATTA 78 gn-SNP87 ACTGCAGTGAACAAAACAGGAAAAAATTTGTCTCTGCATCATAAAGCTCACATTCCATCA[A/G]AAGACACGGTAGAAAGTGTGTTTGCATTGTGTGTGTGTGTGTGTGTGTGTGTGTGATCTC 79 gn-SNP90 AAACACAAAAAACCCTTCCGTGGACGAGACAAAGCTGAGAAAATATTTTTGAATGATCTG[A/C]TAAAAATGTTGGCCTTGGAAGTTCCTGTTGTGGCTCAGTGGTAACGAACCCAACTAGTAT 80 gn-SNP91 GGATGGGATTAGTGCCCTTATAAAAGAGACCCCAGAGCAATCTCTCACCCCCTTCCGTCA[C/T]GTGGGGACACAGAGAGAAGCTGGCCCTCTCTGAACAGGAAGAGGGTGCTCCCCAGACACC 81 gn-SNP96 TAGTGTAAAGAAGAAGGGAAGTTACTGGGTGGATTAAGATGCAGAGGAGGAACACGATCT[G/T]ATTTCATATTTCAAAGATAGCTCTTGTACATACAGTGGATTGTTATTCTCCCATAAAAAG 82 rs55618764 ACTGAGTTATTTGTAATGAATTATTTAGACAGTTCTCAGCCCTGCCTTCTGAGCGTTAGC[A/G]ATTTTAAAAGAGAACTTTTGTGCAATTCAAAATGAAGTTTTTATAAGTAATTGAAAGTGA 83 rs80867926 TAGGGGGAATTGAGGTCAGGTAGGCTGATCAGTTACCAGGGAAACTAGCACCTCCCCCTT[A/G]ATAAGCTATCATAGTGAAGATGTTCTGATCTAAAGATTAGAACAGTCACTAGCTGAGTCC 84 rs80914418 CTGGGCTCAGTCCCTGGCCTGGGAACTTCCACAGGCCCCAGCTGCAGCCAGAAAAATAAT[A/G]ATAATGTCAAGTACTAGATTTTATTTTATTCTCTTGGCCCCAGAAAAGACCCCAGTTGCT 85 rs80931369 GATCTATAATTATTTCAGATAAAAAGTAAAGTTTAGGGGGGAAAAAGGTCATGGAGGGCA[T/G]AGCAGCCAGAAAACTAGCTTCGTCTCAATATTTGTGATTCTCCTAGACCATGAATACAAA 86 rs80955728 CACCATTTATCTGACCAGGTAAATGTAGAGAGAGAGGTGACCTGTGAATGTATCCAGGGG[A/C]GGAGCTGGATAAGACTGTTTCCATTTCAGTTGGGTAGGTAGGAGCTTAGACATTTGTTCA 87 rs80964179 CATAATTTTTCTTTTATTCCTCTTGGCATACATGAAGAGCCCAAAGCTGACAAGGATCAC[A/G]ACCAGGTAAACGTTGGTGGCTTCATTCCAGGCCTCGTGAACACTGTAATCCATGGAACCA 88 rs81263429 TATTTATAACCCATATTCCCTCTGACTTACCTTCCACCACAGGCAGAACACAGACCTCTC[A/G]GTATCACCCACATGCTTTTGCCAAAAGCTTTTGYTATATGTTCAGGGATGTGATCCTAGG 89 rs81288768 TCCATTCAAAATCAAGAATACAGGAGGAAATAGGTATGTTTAGTTTATATAAAATGAGAC[A/G]TACGATCATAAGCAGCTTTAGTAATTGCTCTTGCTGCATTCTTCTGAATATCAGGAATTG 90 rs81289903 GGCTAAATAAGAGTACTGCTAGCATGAAATTAATTTAACAGTGGAACTTTCTGGAGTCCA[G/A]TTGTAGGGGGAAAAGCTGGGGGAAAAAGAGTAGAGTTATTTCATGGAAGGGGAGAGAGGG 91 rs81360129 GTATAATGTCACCTTTCTTCTAGTTTCTTTCACCTTTCCCCCAAATTCCTGTGTAAGCTA[T/C]GCATAAAAATGCAATTTTTCAAGGTCCAATATCTTATTGACCCACAAGGCCAAAACAGGT 92 rs81360419 GTGACTGGTGACAGTCACTAAATGCACCAGTAGATACGTAACTGGCTTTGGAACTGGACT[A/G]ATGCCTCATTTTTCTGTGCAGCTAAGATGAAAGTTCACCCATCAGGAAGCAAAACTACAT 93 rs81425559 GCGGGAGGTAAAAGCAGGACCTCTGGCTGGGCAGTTTGAGTCCTAGGGTTTGCCCCAGCT[T/C]TCCCCAAAGGCCCTTGAGTCTCAGTCTCTTCATTTATAAAGTGAGGAGGTTAGAGAAATG 94 rs81467772 TTACCATGCTATTAAGTTTAGATTTGATGTTGGTGGCCTATAGAGAGGTATTTGAGGATG[T/C]TGTAGAAGCAAGTGACAAGGTCAGATTTTTGCAATTAGGAAAGTTGCACTTCAGTTCAAT 95 rs336655803 TACTGTCGCGAACAGAGGGCCTATTCATCTCAGTTTTACTGTTATTTCACCTGTGACTTA[A/G]TTTCAGATTAAGGCAGATTAACATGTTTGACCTATAAAGAATTAGGGCATGCCAATATGA 96 rs81219818 TGGACGGGTTCCTAAAACTAAAGCCTTGGCACAGCCCTGGTTGATTTCCCTGTGCTTCTT[C/T]CTCTTTGCCTGCAGGCAATCCCAGGGTCCACCAACGCCACCCACCACCCCCAAAACCGAC

<110> sunchon natinal university industry academic cooperation foundation <120> Pig production and traceability systems selected as a single nucleotide polymorphism markers for the introduction of the method <130> p-10-0504 <140> 10-2014-0143905 <141> 2014-10-23 <160> 96 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 1 <400> 1 gctgctttta gaatccttgc tttaactttt gccattttta ttgtaatatg tcttggtgtg 60 agtctgtttg gcctcacctt gattggagct ctctgtgctt gctgtatctt gatgtctgtt 120 t 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 2 <400> 2 actagttaag caagcctgcc ttgttctgag ggctttcctg aacttccagt ggcctctcag 60 tatcccccag ctttccctct ttatccgtga tcccctattg gtgcttctac aaccacctgt 120 g 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 3 <400> 3 ggtctgtgga ccccgggaac gcgacaggat taatgacaca gaccatgacc tgaatttcac 60 agcagctcca ccaaactcct agctggggac cttggacttg ggacttctgg gtgatttcca 120 g 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 4 <400> 4 ttctgtgcca accccctggg gcctgcctga tgctctaaga atcacagact cgcccagcag 60 agagggatta gcaagctgct aaaaagccta accccttcag gacagagatg aggagcccca 120 g 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 5 <400> 5 agaaaagcaa caaaaaatta ctcaaaatta tttcagactt ttaaaaaggc ccctgaagct 60 agccatgttc tgtgctcctc cttgttcctt taagtgtaca cagacaggga gttcccatca 120 t 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 6 <400> 6 cctcagaaaa caggatgtaa gttggttggt gtcacatctt ggttaggata agcagctgct 60 attgatagca actgattagt tctaaggact ggttatatac cacacgtgaa cttcaaaagt 120 g 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 7 <400> 7 gctatagact ccgtaagata ctgaataaaa ctgaactcat agctcccccc tatccactcc 60 actttttagg gctgcacttg tggcatatgg aagtgcccag gctagcgatc aatatcagag 120 c 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 8 <400> 8 aatagagttc ccctttgtta aggatgaatc aacaaagcct aggaagttgg tggtgattcg 60 acttcctagg actcttgggg atgacagctc agtcatcttt gccccttggg ttttactgtt 120 t 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 9 <400> 9 ttagccacag ggtaggaaaa gaatctatct ctcagtcttt tccaataaac cataagctgc 60 ttgaagcsag ggatatcctc attcattctt ttggtctcaa ttgcccagca taatgccagg 120 t 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 10 <400> 10 ctgggctgct tatctggaaa gcggcgagga tgatagtagt caatggaata cctaacagct 60 agcgactgcc tctgtgggca gcacttgggc aaatatttta catcaatgat cgccaagtaa 120 a 121 <210> 11 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 11 <400> 11 ggcactgcct gttgtcccag cacccccaga gtgtgggcca gctcccatca catgyactga 60 agaaagagcc tctgccaatc caggccccat gtcccatctg actgcccaca aaggctgtgg 120 t 121 <210> 12 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 12 <400> 12 gctgcaacca gagtcacaga agtgacaaca ctggttcctt atcccgctga gccatgagaa 60 tctgtacttt tagaagagct gagtcgtctc ttagctgcct taaacctagt cctggtccca 120 a 121 <210> 13 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 13 <400> 13 atgttttctg aaccaaagta agaacatggg atctgacaaa tgtacttatg ggggacctgg 60 agtgtgctgt ccttgagact ggaattggga ctcttagcca aaatcacaca aaaattaagt 120 a 121 <210> 14 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 14 <400> 14 agcttccctc ctaaaattat tatctattaa tagtaataat gataatagct aacacatgta 60 atgcttacta tatgataggc actatcctaa gaactcatga aatgattcaa tattcttagt 120 t 121 <210> 15 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 15 <400> 15 ttgggttgct actgtgatgc tgtttgagcc ctatctccag aacttccaca tgctatgagt 60 acagctaaat ttttaaaaag cccccccccc cccacatctt tctttgtgta aatttggcca 120 a 121 <210> 16 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 16 <400> 16 ctcctctttt gaactgtgag aaataaactt gtcttttcag ttaagatcat ctcctgatct 60 atcagctttc ctctacctca aaatttttat tagtactctg tattttaaga caagatgttg 120 t 121 <210> 17 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 17 <400> 17 tacggtttac ttatcagtga gatgtccccc cttagtttag agagtttcct tacatatctg 60 ttataatatc tggccccaga agctatgtct tggggataat atatatatat gatcctctga 120 t 121 <210> 18 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 18 <400> 18 caccattaga ggggatgctc tctaaggctg cttcgttcaa acttcctgat tccagctgca 60 tgcaggtagg gaacagagct gaccatgacc gaaggacact tggaaatcca catattagca 120 c 121 <210> 19 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 19 <400> 19 agatgcctgg ttctccaggc atggagacaa acccacaaga gccagggtct ctgagaagct 60 attctggagg acacacacta gggttgagta ttggaaagaa agtgggagac aaaggagaag 120 c 121 <210> 20 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 20 <400> 20 tggatggctg accaccaccc atgctccctg ccctctggct tctagctgag tttgaccaat 60 agaagaacca gtgggaaagt caaggggaaa ggagagtaag gttctcttgc ctgtcttcct 120 a 121 <210> 21 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 21 <400> 21 gggttggcga aaatcaaggg tatcctcaga gaagagactc agacacagcc ctcaaagtgc 60 acactcaggc acttgacgta gctttagtgc tacctcttca atatcttcga gagtgaggaa 120 a 121 <210> 22 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 22 <400> 22 tggggcttca ccacccaaat ggtggtaggt tgatgaggcc agagatggtg aacccatgtc 60 aggaataggt aactggtaag ccgattgctt gagnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 n 121 <210> 23 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 23 <400> 23 ctgttgagtc tggggatgct caggcctcag agaggtgttc agggatgctc ctgaaaatcc 60 aagaatcagg tctctctgac ctgggaacac ccagnnnnnn nnnnnnnnnn nnnnnnnnnn 120 n 121 <210> 24 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 24 <400> 24 gtttctatgg ggcatctcag gaagcagtgg tgggcagtga gggaggtgat acaggtacag 60 actgtgtcac ttcgaagttg tcccgtgggc agnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 n 121 <210> 25 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 25 <400> 25 cttttccaat tctcactggc acctggatct tagacctcat ccagatgcct agaatcaagg 60 attggcattg agggtgagcc aagtgagaag tgagctaatt gcaagcccaa gaatgacttg 120 g 121 <210> 26 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 26 <400> 26 ttgaagtcag gtaattctaa atgtgactta caagttcctt ttccaggaat aacaagaagc 60 agcaagcrca ttatggatta agctcttgtg gagtgccaga tttggttcta ggtgttgtgt 120 t 121 <210> 27 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 27 <400> 27 aaagcttgac aagccaatgg gtgaactagg gaatacgcca tggggctatc aaacacttgt 60 acgagcagct catcagtaag cagccaagtg gcaaattggg attgactggg aatgctgagc 120 a 121 <210> 28 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 28 <400> 28 taaacaaaac caaatgtgca tattaaacac gaaacttggt gatcaataaa ttccaaaggc 60 agagcaggtt aagttgcaag aggcgatcca gctcagctgg gttccctcac agctggaaca 120 c 121 <210> 29 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 29 <400> 29 aatgacttac acaaagccat tcaccagtca acaggagagt tcaagatgca cagttctccc 60 atgttccacc attctgtctc ttgagctgta tgtttccctt gagagctgat gcaggtctca 120 a 121 <210> 30 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 30 <400> 30 aagtggacca gagaagtggc acatcgcctc cctttaagca gacttcccag aagtcattca 60 aatatttcag cttacagctc aagtcaaagc ttgatagtgg ggccacacct attctcagag 120 g 121 <210> 31 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 31 <400> 31 tcaggcttca agccacttcc ccaaagagct tcactctcct cctcaaaaga taaaatgaga 60 atgatgatgc ccacctcaga tgcaaagtgg gctaaggtac cctgggttag ggctaactgc 120 c 121 <210> 32 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 32 <400> 32 ccaggaggga gacgttcaaa taggttcctc cagctacttg caagtgaact tgaaaaatga 60 tgggccaccc gcaggactcc tttctaacgt gacagagcgg atgcatttgc gcatcagcga 120 g 121 <210> 33 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 33 <400> 33 agtatgtctg aaacattcat gcgacccaga ggagcaaatt ctgcatgtgg attctaatgg 60 atttgtcttt ctccctgact agctcaaggt tcccccaaat ccaactccca cttcactctg 120 t 121 <210> 34 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 34 <400> 34 attcataaca ctcaacctga tccccttggc ctttttcagt attgaacatg gaataaccta 60 cagcttagtc tgttggtcca ttcatgaatg tcatgtggtg tgagtcatct atgcacatga 120 c 121 <210> 35 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 35 <400> 35 gagagaaccc cgccccgcct ttgggataga aaagctccgc cgtgtcccaa gaacaagtay 60 atggtttggc ccttgagatg atgtgcagac acagggaccc agggattcac aatccactgg 120 a 121 <210> 36 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 36 <400> 36 agactacgct ttatcttccc actggagcca agtagggaac gtgaaatggg gcaaaggagg 60 aagacaaagc agaggacaga gcccaggagc tggatcgaga acctgccagc ctctggggcc 120 t 121 <210> 37 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 37 <400> 37 gtgatattat gttgcttcca agacaaggtc aagtgtaatt tctgcctctt gctgtctctc 60 agatggcttg ctctgggtga agcaagnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 n 121 <210> 38 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 38 <400> 38 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ctgggagtga caggacatcc 60 tgtctctctc ctgattctaa tctgagagag tcctacctcc aaggcccttg gtacctgctg 120 c 121 <210> 39 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 39 <400> 39 ggtcctcatg agaaccctag gagtagatcg tttaaaagac tgtccttcat tctgcagaag 60 aggcggccga gccctgagag gttacgtgag tttccccagc tgcacagtgg gcccctgaca 120 g 121 <210> 40 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 40 <400> 40 tcgacctgtc ctgcacgttg tgataaatgg tccaaaggaa aggagaagag gccacaggaa 60 atggaggagg aggattcaga ggtgaaggga actccctctg gggaggtgac actgaggctg 120 a 121 <210> 41 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 41 <400> 41 gtggaagtga atgaggtcag agcattggga ggagaagagc taagacagga aagtccagat 60 agaattttga tgctggccga aatccatcat atggctaaag cgcatcttcc tacattctac 120 t 121 <210> 42 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 42 <400> 42 tctcagctaa gaaggaaaac aagaaatgtc acttgctact ttctttttcc taaatcagga 60 aacaaccaat gagatggccc ctctgcaatg aaatgagcta gtaaagaatg tgtgacatca 120 c 121 <210> 43 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 43 <400> 43 actccacagt gattatctct ttgtgagtct cttggtgaag ggactggggg ctccaggaaa 60 ayaaggacta aaaattggcc cttgaacttg gaaacactga ggccactgag actttgatga 120 a 121 <210> 44 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 44 <400> 44 tcacccgcac ggctaggata cctgcaggga gcctgggtct ggaggtggca attggtttyc 60 agaaacaaaa tttcattttc taggggccag gtaagggcga gcctagtctg ggtgcagggc 120 a 121 <210> 45 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 45 <400> 45 tccgcagtgc aactatactt aactttgtca gttataactc tacctttaag tacttcttgg 60 agcctggcct tcccctgtgc ttgttacctc aaactgatga aaataggaaa atagtaaaac 120 a 121 <210> 46 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 46 <400> 46 caagttttgc tttttggaac tgtatggaaa tattgggggg aggtaatact tttgttccac 60 atcggttgag tttccggatg tggaatctgc agatacagag actgactgtg taacacaatc 120 a 121 <210> 47 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 47 <400> 47 cagattccag ttggaacaga agatgctaag tgaatagctt ccacctttga gccaaatcca 60 atgttgtaac aacccggcta cgtatatgct caagatgcta agctcctaca gagagagatc 120 t 121 <210> 48 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 48 <400> 48 aaaattgcac aaaggaccat aggggaaacc caaaggctgg ttagataggg tctattttct 60 tcttagccta tgagtcattt ggggaaaaat tacagagggc atagtgatct ttgatttacc 120 a 121 <210> 49 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 49 <400> 49 taatttatac tgcatgtact cttggggtca tgagaccgtc tggacctctg cttacagccc 60 agggaacttt agtcacttgt gatggagcac gatggcagac aatgtgagaa gaagaatgtg 120 t 121 <210> 50 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 50 <400> 50 tacagatttc agccaaagcc acaattgcca cgtctcatca cctggaatta aacagcaaac 60 agggctgact ggtaccgctg aggaaacaca aagatgtgtt ggcaactccc gggagcggag 120 t 121 <210> 51 <211> 108 <212> DNA <213> Artificial Sequence <220> <223> 51 <400> 51 ccgttccaat ggtttgatct tctcgttttc ttctgttagc aactgtcaag tgggcagcat 60 tgtcacaatg ttaaatggac ctttctcggc tgattcgcaa cggggtct 108 <210> 52 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 52 <400> 52 cctaagcctg gctgccatgg gggaagtacc taagagcttg cttgaggaga ccaaactacg 60 attcttaaat catcagacct gggttcagtc aacctagcat agcctggcgc ataatgaaaa 120 g 121 <210> 53 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 53 <400> 53 ccgtgtaagt gggggggggg tggacctggg cagctctaag cacccctccc cgcaaacctg 60 acatcaggga ttgcagatct ggggtggcag ggagagtgcc cagtttaata actgatgaat 120 t 121 <210> 54 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 54 <400> 54 accagataca gacatggtga gtatattcat ggcttggctg aaaggggttt tttttaaacc 60 aaagtattgt tgatttacaa tactgtcaat attgtaccag tttctgctgt acagtagagt 120 c 121 <210> 55 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 55 <400> 55 ttgaacccgc aacctcacgg ttcctggtcg gattcgttaa ccactgagcc acaacagtaa 60 ttcctcaata ttagactttt catcctctgt atagcttgta aaaactaata atcagttaat 120 g 121 <210> 56 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 56 <400> 56 tcttatgcta aatgacaaga gctatgcttt tacttctttt tttcttagag ctcaggacaa 60 cagaagttga aacagcccaa gaaataaaga aatgttgaaa gatgatacat tttgaaacct 120 g 121 <210> 57 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 57 <400> 57 acaattttag tataggtcta cctgcttcaa acactgtata aagcattaca ctaacaaatc 60 cgactgcacc cttatctact agtgcagctg aggaatgaac aggtatttct gtgaagtttc 120 a 121 <210> 58 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 58 <400> 58 ttgaattttc tgcttagggt tggaaccagt ttcttttgtt ctgaggattt atatttttct 60 tttaaattta gaaaacagct ggtccttatt tcttcaaaaa atcttccccc aatttctctc 120 t 121 <210> 59 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 59 <400> 59 gcgcccattt tccaaatctt tctcaagttc ttcatttaaa ctctaacccg gagctactta 60 agaaatgaga ttcagggacg tgcagttcac agccttagcc aagtcgaaac agcactgtct 120 g 121 <210> 60 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 60 <400> 60 cttacggact tttcagacgt acatattgcc cgcccccctt ttttttaaat catcaagctt 60 aggttaaatt actgtttcct atgctaaaaa catgtcagtt ttgtaacatc gcatgtacaa 120 a 121 <210> 61 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 61 <400> 61 tgtgccgccc acggtcctcc cgaccatgat gcccatggat gctaccggca gggatgggag 60 gctgcgtgga ctcagtgtgg gacacggaga aaagcaaagg gccgtttcag ggacagagga 120 g 121 <210> 62 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 62 <400> 62 gaacatatta actattgact agagaatgtt tcgctatctg aaaggagcca gaaaagtcac 60 aagatatgcc ctaaatttca tccattgaca agggagaagt ggtctcaaag gacacattta 120 a 121 <210> 63 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 63 <400> 63 aaaagaccat aaaagagaag aagatagcaa gtctggaagt cctggtggga agccccggct 60 aaagcagact ccacaaggag agggcagggt gggggcctgg catcttgttc gggcttgtgt 120 g 121 <210> 64 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 64 <400> 64 tacatttctc agaaaccata atcaacagct atcaatataa gcaagtgatg tcttattcaa 60 attatttgtt tggtggcacc ttagggattg tttctttcat agggcaatgc agaaactaca 120 a 121 <210> 65 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 65 <400> 65 cactaatgga agtagttgac aataactgac aaaaaagcag ggtttaatgc agaatataaa 60 tggtaaatat aaagtctgca tagaaatatc agacgtttac agcaaacaaa caaaaagccc 120 t 121 <210> 66 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 66 <400> 66 tatgttatga ttttgaatat taactctatt gcatatcctt gtgccccaaa tctacacagt 60 tgcatgtgcc ataataactg taagtttatt cttatataat agtttacaga gtatactcta 120 t 121 <210> 67 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 67 <400> 67 aaatctatct acatcctctt tagattccac gagttgctcc tctccgagga tttctccttc 60 agcacgtgtc gagctctcag tgtcacggtc atttttttat ccttttccct tccattgatt 120 c 121 <210> 68 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 68 <400> 68 gtgtgtgtgt gtgtgtgcgc gcgcgtgtgt gtgccttgtc ccttcctggg gtccgggtgc 60 cagtgtggtc tgtggatctg tgggtcactg cgtagcttcc caagtctgtg catgctgaat 120 g 121 <210> 69 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 69 <400> 69 aagacagatt tcaggactgt gctgacaatg aatttctata gttatcaatt atgccctcat 60 taaaatgttc caacttggca aaaatttaaa caatgtaact tataaacata acatcctttt 120 t 121 <210> 70 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 70 <400> 70 ccaaaatgga gttacttagg ctaagcccca catcaccaaa ttcacctcga tttgacttaa 60 tttatttaca gttttggctc tcctagaaat ggngtcttna agccngtcna nnnrgnantn 120 n 121 <210> 71 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 71 <400> 71 caccaactga ttcaattaaa gatctcctaa ccatgatctt gtgttttctt tttaagttac 60 tgcctccaaa atgttgtttg gaattatttt tttccccaaa tgttacaaaa atgcaaacat 120 t 121 <210> 72 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 72 <400> 72 gactattcca taacatgtaa gaattccacg aaatttgagt tttaccgccc ataacggttt 60 cactggcgct cagcacccac tcctttaggc ctggcccgca gctgcttctg cgctcctccg 120 g 121 <210> 73 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 73 <400> 73 aggagggtca ctggctttgg ttttctaggc cctggaaggg cagccagaac ccacaagctg 60 aagaaactgg ggcaaagacc aaacgctcac tgcactggat cataagcttc cttggtcccc 120 c 121 <210> 74 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 74 <400> 74 actagcaaaa caaaatacca gaatgatgta aagcttaaaa aaagaagtct ctattggaag 60 aaattctgta gttcaaanat ccagtatttt gtgactctct ttgaaaaccc ttttctgcca 120 t 121 <210> 75 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 75 <400> 75 caccaggatg ccttgtactc tgactctgga catccataga gctgttaagt actgaactct 60 cggattttgc taatacctct aaaaaattaa aaagtccatg tgactgcttg ccaagaaaaa 120 t 121 <210> 76 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 76 <400> 76 aataatacag ttttgcctat cactcatggc taaaactcac tggcatggaa tataaaagat 60 actgttgggg aggaaaagat tttcctctgt ccttttaagt tctggctggt ctaagaatta 120 a 121 <210> 77 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 77 <400> 77 nnnnnnnnnn nnnnnnnnnn nnctgttcca gtgattggga aaggcaaagc ttgtacattc 60 attttataag gctgatcttg cctcaaaaca aaacagggaa aataggagaa ataaaaaatt 120 a 121 <210> 78 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 78 <400> 78 actgcagtga acaaaacagg aaaaaatttg tctctgcatc ataaagctca cattccatca 60 aaagacacgg tagaaagtgt gtttgcattg tgtgtgtgtg tgtgtgtgtg tgtgtgatct 120 c 121 <210> 79 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 79 <400> 79 aaacacaaaa aacccttccg tggacgagac aaagctgaga aaatattttt gaatgatctg 60 ataaaaatgt tggccttgga agttcctgtt gtggctcagt ggtaacgaac ccaactagta 120 t 121 <210> 80 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 80 <400> 80 ggatgggatt agtgccctta taaaagagac cccagagcaa tctctcaccc ccttccgtca 60 cgtggggaca cagagagaag ctggccctct ctgaacagga agagggtgct ccccagacac 120 c 121 <210> 81 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 81 <400> 81 tagtgtaaag aagaagggaa gttactgggt ggattaagat gcagaggagg aacacgatct 60 gatttcatat ttcaaagata gctcttgtac atacagtgga ttgttattct cccataaaaa 120 g 121 <210> 82 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 82 <400> 82 actgagttat ttgtaatgaa ttatttagac agttctcagc cctgccttct gagcgttagc 60 aattttaaaa gagaactttt gtgcaattca aaatgaagtt tttataagta attgaaagtg 120 a 121 <210> 83 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 83 <400> 83 tagggggaat tgaggtcagg taggctgatc agttaccagg gaaactagca cctccccctt 60 aataagctat catagtgaag atgttctgat ctaaagatta gaacagtcac tagctgagtc 120 c 121 <210> 84 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 84 <400> 84 ctgggctcag tccctggcct gggaacttcc acaggcccca gctgcagcca gaaaaataat 60 aataatgtca agtactagat tttattttat tctcttggcc ccagaaaaga ccccagttgc 120 t 121 <210> 85 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 85 <400> 85 gatctataat tatttcagat aaaaagtaaa gtttaggggg gaaaaaggtc atggagggca 60 tagcagccag aaaactagct tcgtctcaat atttgtgatt ctcctagacc atgaatacaa 120 a 121 <210> 86 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 86 <400> 86 caccatttat ctgaccaggt aaatgtagag agagaggtga cctgtgaatg tatccagggg 60 aggagctgga taagactgtt tccatttcag ttgggtaggt aggagcttag acatttgttc 120 a 121 <210> 87 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 87 <400> 87 cataattttt cttttattcc tcttggcata catgaagagc ccaaagctga caaggatcac 60 aaccaggtaa acgttggtgg cttcattcca ggcctcgtga acactgtaat ccatggaacc 120 a 121 <210> 88 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 88 <400> 88 tatttataac ccatattccc tctgacttac cttccaccac aggcagaaca cagacctctc 60 agtatcaccc acatgctttt gccaaaagct tttgytatat gttcagggat gtgatcctag 120 g 121 <210> 89 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 89 <400> 89 tccattcaaa atcaagaata caggaggaaa taggtatgtt tagtttatat aaaatgagac 60 atacgatcat aagcagcttt agtaattgct cttgctgcat tcttctgaat atcaggaatt 120 g 121 <210> 90 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 90 <400> 90 ggctaaataa gagtactgct agcatgaaat taatttaaca gtggaacttt ctggagtcca 60 gttgtagggg gaaaagctgg gggaaaaaga gtagagttat ttcatggaag gggagagagg 120 g 121 <210> 91 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 91 <400> 91 gtataatgtc acctttcttc tagtttcttt cacctttccc ccaaattcct gtgtaagcta 60 tgcataaaaa tgcaattttt caaggtccaa tatcttattg acccacaagg ccaaaacagg 120 t 121 <210> 92 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 92 <400> 92 gtgactggtg acagtcacta aatgcaccag tagatacgta actggctttg gaactggact 60 aatgcctcat ttttctgtgc agctaagatg aaagttcacc catcaggaag caaaactaca 120 t 121 <210> 93 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 93 <400> 93 gcgggaggta aaagcaggac ctctggctgg gcagtttgag tcctagggtt tgccccagct 60 ttccccaaag gcccttgagt ctcagtctct tcatttataa agtgaggagg ttagagaaat 120 g 121 <210> 94 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 94 <400> 94 ttaccatgct attaagttta gatttgatgt tggtggccta tagagaggta tttgaggatg 60 ttgtagaagc aagtgacaag gtcagatttt tgcaattagg aaagttgcac ttcagttcaa 120 t 121 <210> 95 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 95 <400> 95 tactgtcgcg aacagagggc ctattcatct cagttttact gttatttcac ctgtgactta 60 atttcagatt aaggcagatt aacatgtttg acctataaag aattagggca tgccaatatg 120 a 121 <210> 96 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> 96 <400> 96 tggacgggtt cctaaaacta aagccttggc acagccctgg ttgatttccc tgtgcttctt 60 cctctttgcc tgcaggcaat cccagggtcc accaacgcca cccaccaccc ccaaaaccga 120 c 121

Claims (1)

A method for selecting a single nucleotide polymorphic marker for introduction of a pig production and tracing system,
To select the single nucleotide polymorphism (SNP), 19 Korean KNP, 17 Landrace, 168 Yorkshire, 84 Berkshire, and Duroc ) After hemolysis of red blood cells in each of 96 pigs blood, the collected white blood cells were extracted,
RNase (iNtRON, USA) was used to remove the RNA, and the alleles of the recovered DNA were analyzed using the ethanol precipitation method. The analysis was performed by amplifying the DNA, fre- quently injecting it into porcine SNP60 BeadChip After the X-stain procedure, the alleles of the single nucleotide polymorphism markers were classified into the scaled results,
The single nucleotide polymorphic marker allele genotype for the 5 varieties of purebreds was determined to be 5% for minor allele frequency (MAF), 10% for genotyping error, and 0.001 for Hardy-Weinberg equilibrium After removing the polymorphism marker, 39,785 Korean native pigs, 42,156 land races, 44,961 Yorkshire, 41,408 Berkshire, and 39,652 Duroc were selected first,
The minor allele frequency of the first selected single nucleotide polymorphism marker was calculated to select 40% single nucleotide polymorphism markers, and 312 single nucleotide polymorphic markers belonging to five cultivars were secondly selected,
The second selected single nucleotide polymorphism marker was analyzed by pairwise analysis of the chromosomal chain unbalance (LD) values, and a total of 133 single nucleotide polymorphic markers were selected for each chromosome , And a single base polymorphism markers belonging to the five kinds of pigs were collected from the tissues of Jeju native pig, land race, Yorkshire, Baccher and Duroc, and then single base polymorphism markers Selecting a marker for a single nucleotide polymorphic marker for introduction of a pig production and hysteresis tracking system.

Images