CN107058476B

CN107058476B - Application of EXT1 in diagnosis and treatment of liver cancer

Info

Publication number: CN107058476B
Application number: CN201611077347.1A
Authority: CN
Inventors: 陈倩; 陈孝平; 龙新; 梁慧芳
Original assignee: Individual
Current assignee: Individual
Priority date: 2016-11-30
Filing date: 2016-11-30
Publication date: 2020-06-30
Anticipated expiration: 2036-11-30
Also published as: CN107058476A

Abstract

The invention discloses an application of EXT1 in diagnosis and treatment of liver cancer. The invention also discloses application of the shRNA in preparation of a medicine for treating liver cancer, wherein the shRNA can stably inhibit the expression of liver cancer cell EXT1 gene. The invention proves that EXT1 can be used as a diagnosis marker and a treatment target of liver cancer, can monitor the high risk group developing into cirrhosis and liver cancer after being infected with hepatitis B virus by detecting the expression level of EXT1, can diagnose the liver cancer at an early stage, can assist clinical operation treatment by inhibiting the expression of EXT1 to improve the cure rate of liver cancer patients and improve the life quality of the patients.

Description

Application of EXT1 in diagnosis and treatment of liver cancer

Technical Field

The invention relates to the field of biological pharmacy, in particular to application of EXT1 in diagnosis and treatment of liver cancer.

Background

Liver cancer is the third most common malignant tumor with the mortality rate second to stomach cancer and esophagus cancer, and China dies about 11 thousands of people with liver cancer each year, accounting for 45% of the death rate of liver cancer all over the world. Early liver cancer is mostly asymptomatic or has only mild symptoms, about 80 percent of liver cancer patients reach the late stage once being found, the life cycle of the patients is mostly within half a year, and the life and health of human beings are greatly threatened.

At present, the early diagnosis of liver cancer mainly depends on the monitoring of high risk group by serum alpha-fetoprotein (AFP) detection combined with ultrasonic imaging. In addition, the electronic Computer Tomography (CT) can display tumors with the diameter of more than 1.0cm, and is helpful for early diagnosis. The clinical treatment of liver cancer still takes surgical resection as the first choice, and early resection is the key for improving survival rate. However, since radical excision still has a high recurrence rate, regular follow-up observation is needed to monitor recurrence after operation. An effective method for diagnosing liver cancer early is found, and the prognosis condition of a patient is analyzed according to the expression level of the marker, so that the auxiliary treatment of the patient aiming at the target molecule on the basis of a surgical operation is particularly important.

So far, many biomarkers cannot be used as clinical diagnosis markers well, and are only helpful for auxiliary diagnosis or judging the prognosis of tumors and the curative effect of chemotherapy. The currently clinically commonly used biological diagnostic marker is alpha-fetoprotein (AFP), which is secreted by fetal liver, yolk sac and the like, and the concentration in blood is generally checked by blood drawing, and the normal value is less than 20 ng/ml. The accuracy rate of AFP for diagnosing liver cancer is only 60-80%; there are cases of false positives and false negatives. In many instances, or disease, increases the value of AFP, for example: pregnancy, non-malignant diseases-neural tube defect, teratoma, acute hepatitis, chronic active hepatitis, hepatitis healing, and other malignant diseases such as germ cell tumor. In contrast, in very small liver tumors, AFP may be underexpressed or delayed; if the tumor is too large and the secreted AFP exceeds the maximum detection range, false negative phenomena may also occur.

In conclusion, the test value of AFP blood concentration can only be used as a reference for auxiliary diagnosis, tracking disease condition and evaluating chemotherapy effect, and cannot be used as an absolute tool for early diagnosis of liver cancer.

Hepatitis B Virus (HBV) belongs to the hepadnaviridae family. HBV is an important factor causing liver cancer. Liver cancer is mostly transformed from hepatitis to cirrhosis, and finally becomes cancerous, so there is a process of development and evolution of hepatitis-cirrhosis-liver cancer. There are data showing that 90% of liver cancer cases are infected with HBV. Another study suggests that about 5% -10% of patients with 20 years of HBV infection have canceration, and one of the canceration mechanisms is that partial gene segments of HBV are integrated on hepatocyte genes and mutated to cause activation of some oncogenes and inactivation of cancer suppressor genes (TSG). The search for HBV gene integrated into liver cell is the starting point for researching virus cancerization. Further researching how the integration of the virus leads to the activation of oncogene and the inactivation of cancer suppressor gene, and then determining how the gene with abnormal function induces the abnormality of downstream signal transduction pathway, is an important means for researching the mechanism of hepatocellular carcinoma. On the other hand, the research on the overexpression of host hepatocyte genes or the silence and expression defect of genes caused by viruses can be used as an auxiliary tool for early diagnosis of tumors; meanwhile, specific blocking/activating antibodies (medicines) can be developed in a combined manner, the target gene activity of tumor tissues and related signal transmission channels thereof can be directionally regulated, and the tumor can be effectively treated by combining clinical operation treatment.

We focused on cases in the early stages where the body cleared the virus through autoimmunity after the patient was infected with hepatitis b virus, but then progressed to liver cancer. We adopt the virus capture technology to analyze host liver cancer cells, and find that there is virus fragment integrated when HBV infects remained in liver cells of patients (see attached figure in abstract). And (3) capturing virus fragments by using DNA oligonucleotides of hepatitis B virus, and simultaneously carrying out whole genome sequencing on genes near a virus integration region in combination with single cell whole genome sequencing. We found that most liver cancer cells could detect the insertion of HBV S gene fragment into the gene spacer region of chromosome 8 MED30-EXT1 (as shown in FIG. 1). This viral integration event is not common in noncarcinoma cells. The gene interval region of virus integrated MED30-EXT1 directly leads EXT1 to be over-expressed in liver cancer tissues, thereby not only promoting the invasion of viruses, but also inducing the phenotypic abnormality of liver cells and the growth of tumor cells. The EXT1 gene encodes a protein with 746 amino acid residues, EXT1(Exostoses-1, heparan co-synthase). It is a type II transmembrane protein located on the golgi and endoplasmic reticulum. However, there are no reports on the role of EXT1 in virus integration into liver cells and liver cancer and its related applications.

Disclosure of Invention

The invention aims to provide a novel liver cancer treatment target which can monitor high risk population which develops into cirrhosis and liver cancer after being infected with hepatitis B virus, and can be used as a marker for early diagnosis and a novel liver cancer treatment target by detecting the expression level of the high risk population.

In order to achieve the purpose, the invention discloses application of EXT1 in preparation of a liver cancer diagnostic reagent.

The invention also discloses application of EXT1 in preparation of a medicine for treating liver cancer.

We found that HBV infected hepatocytes inserted the S gene fragment into the gene spacer region of chromosome 8 MED30-EXT1 of the host (see FIG. 1). This viral integration event is not common in noncarcinoma cells. The gene interval region of virus-integrated MED30-EXT1 directly causes EXT1 to be over-expressed in liver cancer tissues, and the expression level of EXT1 in liver cancer tissues is obviously higher than that in matched non-liver cancer tissues. Meanwhile, the expression level in the hepatoma cell line was significantly increased compared to the primary hepatoma cell line. Therefore, the expression of EXT1 in the liver cells of the patient infected by hepatitis B can be detected, and the real-time monitoring can be carried out on the high risk group developing to the cirrhosis and the liver cancer after the hepatitis B virus infection. The targeting intervention on EXT1 may have the effects of resisting liver fibrosis and resisting liver cancer cell evolution.

The invention uses cDNA library as template, amplifies the coding sequence of EXT1 gene by PCR, constructs pBABE-puro-EXT1 eukaryotic expression vector, infects HLF, Bel-7402 and MHCC-LM3 cell strain, screens and establishes liver cancer cell strain of stable over-expression EXT1 gene. The over-expression of EXT1 is found to directly promote the growth and differentiation of liver cancer cells. The invention utilizes the Tet-pLKO-puro carrier RNAi technology to stably inhibit EXT1, constructs liver cancer Hep3B and Huh7 cell strains for stably expressing EXT1shRNA, discovers that EXT1 protein is expressed, inhibits the proliferation of liver cancer cells, reverses the malignant phenotype of the liver cancer cells, and opens up a new idea for the clinical application of liver cancer gene therapy.

High expression levels of EXT1 can induce the development of liver cancer. The integration of the viral fragment inserted into the gene interval region of human MED30-EXT1 after hepatitis B infection causes the high expression level of host hepatocyte EXT1, which is a high risk factor for the development of diseases to cirrhosis and liver cancer. Therefore, EXT1 can be used as one of the criteria for clinical follow-up of the evolution of hepatitis B patients, diagnosis of liver cancer and evaluation of the curative effect of clinical surgery.

Compared with the prior art, the invention has the following beneficial effects:

the invention discovers for the first time that the integration of HBV fragments after hepatitis B infection into the gene interval region of human MED30-EXT1 causes the high expression of host hepatocyte EXT1, which is a high risk factor for the development of diseases to cirrhosis and liver cancer. The occurrence and the development of liver cancer can be detected early by detecting whether a virus integration fragment exists in a gene interval region of human MED30-EXT1 and detecting the expression level of EXT 1. And the stable interference of the expression of EXT1 by shRNA as a drug action mechanism can inhibit the proliferation of liver cancer cells and prevent the generation of tumor vessels and the metastasis of the liver cancer cells, thereby assisting the clinical operation treatment, improving the cure rate of liver cancer patients and improving the life quality of the patients.

The conception and the resulting technical effects of the present invention will be further described with reference to the accompanying drawings to fully understand the objects, features and effects of the present invention.

Drawings

FIG. 1 is a diagram showing the analysis of host hepatoma cells infected with hepatitis B virus, the capture of viral fragments by DNA oligonucleotides of hepatitis B virus, and the whole genome sequencing of genes in the vicinity of the virus integration region in combination with single-cell whole genome sequencing;

FIG. 2A is a graph showing that EXT1 is expressed in a higher level in a cancerous tissue than in a paraneoplastic tissue, as compared with a cancerous tissue in a patient who has been infected with hepatitis B and then has progressed to liver cancer, by immunohistochemical detection;

FIG. 2B is a graph showing the results of analysis of EXT1 expression in cancer tissues higher than in paracarcinoma tissues by comparing 50 paired specimens (cancer tissues in paracarcinoma tissues) of a patient who had been infected with hepatitis B and developed into liver cancer, and analyzing the quantification of signal intensity in the unit area of EXT1 staining by Image pro plus software after detecting the expression thereof by immunohistochemistry;

FIG. 3 is a graph showing the expression amount of EXT1 at the protein level in Western Blot detection of EXT1 overexpressing hepatoma cell lines HLF, Bel-7402, MHCC-LM3, and their corresponding controls;

FIG. 4 is a graph showing the expression amount of EXT1 at the protein level in a liver cancer cell line after lentiviral transfection and a corresponding control group thereof by a Western Blot method after the construction of liver cancer cell lines Hep3-B and Huh-7 interfering with the expression of EXT 1;

FIG. 5A is a graph showing the results of a crystal violet in vitro cell clonogenic assay;

FIG. 5B is a graph showing the results of an in vitro crystal violet cell clonogenic assay;

FIG. 6A is a graph showing the results of an in vitro CCK-8 cell proliferation assay;

FIG. 6B is a graph showing the results of an in vitro CCK-8 cell proliferation assay;

FIG. 7A is an analysis chart of the results of an in vivo neoplasia experiment;

FIG. 7B is a graph showing the results of an in vitro CCK-8 cell proliferation assay.

Detailed Description

Example 1: analysis of finding HBV integration sites in single cells based on HBV viral capture data

1. Single cells were extracted from liver cancer tissues by aspiration.

2. The quality control is carried out on 264 single-cell HBV captured data in liver cancer tissues, and a read sequence containing a linker sequence and a redundant sequence amplified by PCR are removed by using SOAP nuke. Upon analysis, higher PCR amplification sequences were present in the raw data. For the filtered data, it was aligned to HBV (NC _003977.1) and human genome sequence (hg19) using SOAP software, respectively.

Among them, 218 samples all had a paired-end read sequence that could align to HBV genome. A single read sequence from each of the 232 samples aligned to the HBV genome. For each single cell sample, reads that did not align completely to HBV and human genome sequences were paired-end spliced using peak software (http:// sco. h-its. org/exelixis/web/software/peak/doc. html) and blat-aligned locally to HBV and human genomes, respectively. And finding out the reading sequences aligned to HBV and human genome simultaneously by combining the blat alignment result, and searching HBV integration sites. Sites of HBV integration into the genome were found in all 117 samples. Among them, HBV integration sites located in the intergenic region of chromosome 8 MED30-EXT1 were found in all 106 samples (as shown in FIG. 1).

Example 2: immunohistochemistry

1. Experimental materials: 50 cases of the frozen tissue samples (paired liver cancer tissues and tissues adjacent to the liver cancer) developed into liver cancer after the previous infection with hepatitis B, the primary antibody was rabbit anti-human EXT1 antibody (Abcam, cat # ab126305), and the subsequent staining was performed by using GTVision III immunohistochemical kit (Shanghai GeneTech Co., Ltd.).

2. The experimental method comprises the following steps:

1) taking out the slices, sucking the water around the slices by using filter paper, drawing a circle around the tissues by using a histochemical pen, dripping 5% sheep serum (consistent with the source of the secondary antibody) into the circle, and then putting the circle into a wet box for 1 hour at room temperature;

2) primary antibody incubation: preparing 1% goat serum by using PBS (phosphate buffer solution), and preparing 1% goat serum by using the PBS buffer solution according to the proportion of 1: the rabbit anti-human EXT1 antibody was diluted 400, 10% goat serum blocking solution was spun off the tissue chip, the tissue was wiped dry around with a dust-free paper, and the diluted rabbit anti-human EXT1 antibody (about 100. mu.l, abcam, ab126305) was added directly and placed in a wet box overnight at 4 ℃. Taking out the refrigerator from the next day and re-warming at 37 ℃ for 1 hour;

3) incubating the secondary antibody, namely pouring off the primary antibody, washing the primary antibody for 5min × 5 times by PBS, absorbing water around the circle by filter paper, adding the diluted secondary antibody, putting the secondary antibody into a constant-temperature oven at 37 ℃ for 30min (recovery), dropwise adding 80 mu l of prepared DAB working solution serving as a color developing agent, incubating the secondary antibody at room temperature for 10min, and washing the secondary antibody by tap water to stop color development;

4) counterstaining the nuclei with hematoxylin at room temperature for 30 seconds, and flushing with tap water for 1 hour for counterstaining;

5) sealing: dehydrating each stage of alcohol (70% -100%), and each stage for 3 min. The tissue chip was taken out and placed in xylene three times, 5min each time. Neutral resin was dropped on the tissue chip with a dropper, followed by covering with a cover glass, gently squeezing with forceps, removing bubbles, standing in a fume hood for drying, and observing with a microscope, the expression level of EXT1 was compared between the paired tumor tissues and the adjacent paraneoplastic tissues, and the results are shown in FIG. 2A (tumor tissue on top, and paraneoplastic tissue on bottom). Quantitative analysis of signal intensity in EXT1 staining unit area was analyzed by Image proplus software, and the results are shown in FIG. 2B with p <0.0001 by t-test. As can be seen from FIGS. 2A and 2B, EXT1 was expressed in the liver cancer tissue at a higher level than in the matched paracancerous tissues.

Example 3: construction and identification of pBABE-puro-EXT1 overexpression vector

1. The coding sequence of EXT1 gene (NCBI accession No. NM-000127) was amplified by PCR using human cDNA library as template.

The EXT1 gene coding sequence is 3376bp in length, and PCR primers are designed as follows:

EXT1-F,

5’-GCGGATCCATTATTATTCGCCACCATGCAGGCCAAAAAACGCTATTT-3’；

EXT1-R,

5’-GGAATTCTCACTTATCGTCGTCATCCTTGTAATCAAGTCGCTCAATGTCTCGGTATT-3’。

and (3) PCR reaction conditions: denaturation at 95 ℃ for 5min, followed by 30 cycles of amplification (98 ℃ for 10s, 58 ℃ for 10s, 72 ℃ for 30s), and finally extension at 72 ℃ for 5 min. The purified PCR product of EXT1 gene and pBABE-puro vector (Addgene vector 1764) are respectively cut by EcoRI and BamHI, then are connected by T4DNA ligase to transform Escherichia coli DH5a, and correct positive clone is screened out by colony PCR and enzyme cutting, and then DNA sequence identification is carried out. A successful recombinant vector was constructed as pBABE-puro-EXT 1.

2. Preparation of retrovirus by calcium phosphate coprecipitation method: and inoculating the retrovirus packaging cell 293FT into a cell culture dish with the diameter of 10cm, culturing for 24h, and performing transfection when the cell wall rate reaches 60%. The specific operation is as follows: 20ug of pBABE-puro-EXT1 recombinant vector was mixed with 20ug of PIK packaging plasmid, and 50uLCaCl was added₂Uniformly mixing the solution (2mmol/L) and 110uLH2O, dropwise adding 200uLHBS solution into the mixed solution, and standing at room temperature for 30 min; taking out the 293FT cells from a 37 ℃ incubator, and gently and uniformly dropwise adding the mixed to-be-transfected solution into a 293FT cell culture solution; culturing at 37 ℃ for 5h, discarding the culture solution, rinsing the cells twice by using the incubated PBS solution, adding 10mL of culture solution, and placing at 37 ℃ for continuous culture; after 24h, the culture medium containing the virus supernatant was collected, and the virus supernatant was filtered through a 0.45 μm filter and stored in a refrigerator at-80 ℃.

3. Measurement of Virus titer preparation of cell density 5 × 10⁶Hep3B single cell suspension of individual cells/L, inoculating to 6-well culture plate 1d before infection, sucking out original culture solution when cell reaches 40% -50% confluency after 24h, adding virus supernatant of different dilutions (from 10)^-1Initial dilution to 10^-6)8mg/L polybrene (polybrene) per well was allowed to act for 3h to reduce the membrane surface charge and promote retroviral infection of the cells, then 3mL of culture broth was added to a final polybrene mass concentration of 2mg/L, culture was continued for 48h, monolayers were digested with 2.5g/L trypsin, passaged 1:5 to 6 well plates, selective culture broth containing 10mg/L puromycin (puromycin) was added after 24h, puromycin concentration was reduced (5mg/L) after 1.5-6 d change every 2-3d, and culture was continued until positive clones were formed (about 2-3 weeks), and the count was performed under Nikon inverted phase contrast microscopy, virus titer (CFU/mL) was equal to mean resistant cell clone X fold dilution × 1000.

4. Infecting cell strain with virus supernatant, and treating primary liver cancer cell with the virus supernatant of 2.5 × 10⁶The cells were plated at a density of individual cells/L into T25 flasks and infection with virus started 24h after culturing the cells. Polybrene (final concentration of 4. mu.g/L) was added to the virus supernatant. The culture medium of the cells to be infected was discarded, 5mL of the above virus solution was added, and the mixture was cultured in an incubator at 37 ℃. After thatRepeating for 1 time every 3h, infecting for 3 times, and changing the normal culture solution after each infection. And adding puromycin concentration (0.5 mu g/L) 48h after infection is finished, screening positive clones, carrying out amplification culture, and establishing liver cancer cell strains (HLF-EXT1, Bel-7402-EXT1 and MHCC-LM3-EXT 1) for over-expressing EXT1 genes. Meanwhile, an empty vector (pBABE-puro) infected liver cancer cell line is set as a control group, and named as HLF-vector, Bel-7402-vector and MHCC-LM3-vector cells.

5. Detection of EXT1 protein expression level in over-expressed liver cancer cell line: total cellular Protein was extracted with RIPA lysate and quantified using Bio-Rad Protein Assay Dye Reagent kit. Equal amounts of total protein were run on 10% SDS-PAGE reagents from each group and transferred to PVDF membrane and blocked with 5% skim milk in TBST for 1h at room temperature. EXT1 antibody (1:1000) (Santa Cruz Biotechnology, sc-11039) and GAPDH antibody (1:50, 000) (Santa Cruz Biotechnology, sc-25778) were added separately and incubated overnight at 4 ℃. Washing the membrane for 4 times by TBST, adding a secondary antibody, incubating for 1h at room temperature, and detecting the expression of the target protein by using an ECL reagent after washing the membrane. As can be seen from FIG. 3, the EXT1 protein was successfully overexpressed in HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 hepatoma cell lines.

Example 4: construction and identification of liver cancer cell line interfering EXT1 expression

EXT1-shRNA sequence (1-5; 2-1; 3-1)

Sequence 1-5:

CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG；

Sequence 2-1:

CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG；

Sequence 3-1:

CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG

EXT1 construction of interfering lentiviral expression vectors: EXT1-shRNA sequences 1-5, 2-1 and 3-1 and scramble control sequences are cloned and constructed on a lentiviral expression vector Tet-pLKO-puro (Addge plasmid 21915). Firstly, carrying out double enzyme digestion, electrophoresis and gel cutting recovery On pLKO-Tet-On plasmid by using restriction enzymes AgeI and EcoRI, and then connecting an EXT1-shRNA sequence to an AgeI/EcoRI site in a Tet-pLKO-puro vector by using a solutionI in a DNA connection kit. Constructing a recombinant vector pLKO-EXT1-Tet-on-EXT1 capable of inducing expression of EXT 1-shRNA. The ligation product was transformed into E.coli competent cells Stbl 3. The transformed product was applied uniformly to LB plates containing 100. mu.g/mL of polybrene and cultured at 37 ℃.

3. Packaging of lentivirus: after the recombinant vector is subjected to amplification culture, the extracted plasmid is sent to Addgene company in Shanghai for sequencing, and the positive recombinant pLKO-shEXT1-Tet-on with a correct sequencing result is stored. By using

Plasmid MidiKit extracted pLKO-shEXT1-Tet-on, psPAX2 and pMD2.G Plasmid DNA. Recombinant pLKO-shEXT1-Tet-on and virus packaging plasmids psPAX2, pMD2.G were co-transfected into HEK293T cells with X-tremeneGene HP DNATransfectant. Viral supernatants were collected at 24h and 48h post-transfection. Filtering with 0.45 μm needle filter, packaging, and storing at-80 deg.C.

4. Hep3-B, Huh-7 hepatoma cell line infected by lentivirus and identification of the interfering EXT1 expression thereof: hep3-B, Huh-7 was seeded in 6-well plates and cells were infected the next day when the cell confluence was 50%. The stock culture was discarded and fresh RPMI-1640 medium containing 8. mu.g/ml polybrene was added to the wells, the amount of virus supernatant added per well being 1/3 of the total amount of culture per well. Fluid changes and passages were performed 24h after infection. After further culturing for 24 hours, 2. mu.g/ml puromycin was added to select resistant cells. Screening for 72h to obtain clones of cells stably transfected with EXT 1-shRNA. The Hep3-B, Huh-7-pLKO-shEXT 1-Tet-on hepatoma cell line is inoculated in a 6-well plate, Doxycycline (Doxycycline) with different concentrations is added to induce the expression of EXT1-shRNA, and cells are collected for relevant detection after 24 induction. The transfected Hep3-B, Huh-7 hepatoma cell lines were written as: hep3-B-sh-EXT 11-5, Hep3-B-sh-EXT 12-1, Hep3-B-sh-EXT 13-1; Huh-7-sh-EXT11-5, Huh-7-sh-EXT 12-1, Huh-7-sh-EXT 13-1, and scramble controls Hep3-B-vector and Huh-7-vector.

5. Detection of the expression level of EXT1 protein in lentivirus-infected cells: total cellular Protein was extracted with RIPA lysate and quantified using Bio-Rad Protein Assay Dye Reagent kit. Equal amounts of total protein were run on 10% SDS-PAGE reagents from each group and transferred to PVDF membrane and blocked with 5% skim milk in TBST for 1h at room temperature. EXT1 antibody (1:1000) (Santa Cruz Biotechnology, sc-11039) and GAPDH antibody (1:50, 000) (Santa Cruz Biotechnology, sc-25778) were added separately and incubated overnight at 4 ℃. Washing the membrane for 4 times by TBST, adding a secondary antibody, incubating for 1h at room temperature, and detecting the expression of the target protein by using an ECL reagent after washing the membrane. As can be seen from FIG. 4, the expression of EXT1 in the Hep3-B, Huh-7 hepatoma cell line was successfully interfered.

Example 5: in vitro cell clonogenic assay

1. Preparing an agar plate, namely preparing a 1.2% low-melting-point agarose solution (Lonza, 50101) by using double distilled water, mixing 2 × 1640 culture medium in an equal volume ratio, cooling to about 60 ℃, filtering in a 6-well plate (1.5ml/well) through a 0.2 micron filter, and cooling and solidifying at room temperature to obtain the agar plate.

2. Taking the constructed EXT1 overexpression/interference cell line: HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 cell lines/Hep 3-B-sh-EXT 11-5, Hep3-B-sh-EXT 12-1, Hep3-B-sh-EXT13-1 cell lines; and a corresponding control cell line.

3. The cell clone is formed by preparing 0.6% low melting point agarose solution with double distilled water, mixing 2XRMPI1640 culture medium in an equal volume ratio, filtering and sterilizing by a 0.2 micron filter, and mixing cells to make the cell concentration be 1500 or 2000/ml. And (3) adding the uniformly mixed cells in the step (3) to the agar plate prepared in the step (1) at 37 ℃, standing for 1 hour at room temperature, then placing in a refrigerator at 4 ℃ for half an hour, and waiting for the agar to solidify. After the agar plates were solidified, the six-well plates were transferred to a cell incubator. One day later, each well was supplemented with 1ml of complete medium of 10% fetal bovine serum (Gibco, C11875500CP and 10% streptomycin (hyclone)). After 14 days until cell colonies grew to a certain size, the plates were removed, fixed with 4% paraformaldehyde, soaked in PBS buffer (pH 7.4) for half an hour, removed, stained with 0.05% crystal violet for 2 hours, rinsed with 1xPBS after staining, and the time of washing was judged by observing the depth of staining under a mirror. Observed under a microscope and photographed. The results are shown in FIGS. 5A and 5B. The number of the liver cancer cell clones can be visually reflected after crystal violet staining. As shown in FIG. 5A, HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 liver cancer cell lines overexpressing EXT1 showed increased in vitro clonogenic formation of liver cancer cells compared to their control groups. As shown in FIG. 5B, the hepatoma cell lines Hep3-B-sh-EXT 11-5, Hep3-B-sh-EXT 12-1 and Hep3-B-sh-EXT13-1, which interfere with the expression of EXT1, had reduced in vitro clonogenic potential of hepatoma cells as compared to their control group.

Example 6: experiment for measuring cell proliferation by in vitro CCK-8 method

1. Taking the constructed EXT1 overexpression/interference cell line: HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 cell lines/Hep 3-B-sh-EXT 11-5, Hep3-B-sh-EXT 12-1, Hep3-B-sh-EXT13-1 cell lines; Huh-7-sh-EXT11-5, Huh-7-sh-EXT 12-1, Huh-7-sh-EXT 13-1 cell lines; and a corresponding control cell line.

2. The experimental steps are as follows: the cell suspension was prepared using complete medium (Gibico, RPMI1640), and the cell lines were added to each of 96-well plates in a volume of 100. mu.l, 3,000 cells per well, 10 wells per cell line were made in parallel, and the average value was obtained. After incubation in a cell incubator for 24 hours, the cells were removed and 20. mu.l of CCK-8 reagent (QIHAI Biotech Co., Ltd.) was added to each well. This was used as the initial time 0hr, after which time points of 1, 2, 3, 4, 5 days were selected. Only 200. mu.l of fresh medium and 20. mu.l of CCK-8 reagent were added to the wells without cells. After incubation at 37 ℃ for 3 hours, absorbance at 490nm was measured on a microplate reader (BioTek), and the results are shown in FIGS. 5A and 5B. Since the absorbance is proportional to the number and the activity of the cells, the proliferation of the cells can be linearly and visually reflected. As shown in FIG. 6A, HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 liver cancer cell lines overexpressing EXT1 showed increased proliferation rates of liver cancer cells compared to their control groups. As shown in fig. 6B, Hep3-B-sh-EXT 11-5, Hep3-B-sh-EXT 12-1, Hep3-B-sh-EXT13-1 liver cancer cell lines that interfere with the expression of EXT 1; and the cell lines Huh-7-sh-EXT11-5, Huh-7-sh-EXT 12-1 and Huh-7-sh-EXT 13-1; compared with the control group, the proliferation rate of the liver cancer cells is obviously slowed down.

Example 7: in vivo tumor formation experiment:

1. taking the constructed EXT1 overexpression/interference cell line: HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 cell lines/Hep 3-B-sh-EXT 11-5, Hep3-B-sh-EXT 12-1, Hep3-B-sh-EXT13-1 cell lines, Huh-7-sh-EXT11-5, Huh-7-sh-EXT 12-1, Huh-7-sh-EXT 13-1 cell lines; and a corresponding control cell line.

2. The experimental steps are as follows: the cell line cells constructed above were suspended in a serum-free minimal medium (Gibico, RPMI1640), and 50. mu.l of a suspension containing 1,000,000 tumor cells in the minimal medium was mixed with an equal volume of matrigel (BD, cat. 356234), and then injected subcutaneously into nude mice in an amount of 100. mu.l/mouse to form subcutaneous transplants. 6 mice per cell line were grouped together. After 4 weeks, mice were transplanted with tumor organs, and the size of the tumor was measured. As shown in FIG. 7A, the size of transplanted tumors was significantly increased after subcutaneous injection of HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 liver cancer cell lines overexpressing EXT1 into mice as compared to their control group. As shown in FIG. 7B, mice were subcutaneously injected with Hep3-B-sh-EXT 11-5, Hep3-B-sh-EXT 12-1, Hep3-B-sh-EXT13-1 liver cancer cell lines that interfere with the expression of EXT 1; and the size of the transplanted tumor is obviously reduced compared with the control group after the cell lines of Huh-7-sh-EXT11-5, Huh-7-sh-EXT 12-1 and Huh-7-sh-EXT 13-1 are used.

In conclusion, through the capture of the hepatitis B virus fragment in the hepatoma cell and the combined single-cell whole genome sequencing, the integration of the DNA fragment of the hepatitis B virus into the gene spacer region of the host MED30-EXT1 is found to cause the high expression level of the host hepatocyte EXT 1. Further, by comparing the cancer tissues of 50 patients who had been infected with hepatitis B and developed liver cancer to the tissues beside the cancer, we confirmed that EXT1 was expressed in the cancer tissues higher than in the tissues beside the cancer. Through over-expressing EXT1 in liver cancer cell lines HLF, Bel-7402 and MHCC-LM3, the proliferation capacity and the in vivo tumor forming capacity of the liver cancer cells highly expressing EXT1 are greatly enhanced. Correspondingly, the hepatoma cell lines interfering with EXT1 expression are established by infecting Hep3-B, Huh-7 hepatoma cell lines with lentivirus, and the proliferation capacity in vitro and the tumor forming capacity in vivo of the hepatoma cell with low EXT1 expression are obviously reduced.

Thus, high expression of EXT1 in hepatocytes of patients infected with hepatitis B may be a high risk factor for progression of the disease to cirrhosis and liver cancer. EXT1 can be used as one of the criteria for clinical follow-up of the evolution of hepatitis B patients, diagnosis of liver cancer and evaluation of the curative effect of clinical surgery. The targeting intervention on EXT1 may have the effects of resisting liver fibrosis and resisting liver cancer cell evolution. Therefore, EXT1 can be applied to the preparation of diagnostic reagents for liver cirrhosis and liver cancer caused by hepatitis B virus infection and the preparation of drugs for treating liver cancer.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Claims

Use of the antibody of EXT1 in the preparation of diagnostic reagents for liver cirrhosis and liver cancer caused by hepatitis B virus infection.
Application of an antibody of EXT1 and a reagent for detecting the existence of an S gene fragment of HBV in a intergenic region of human chromosome 8 MED30-EXT1 in preparing a diagnostic reagent for cirrhosis and liver cancer caused by hepatitis B virus infection.
Application of an interference agent EXT1shRNA of EXT1 in preparation of medicines for treating liver cancer.