CN107058476A - Applications of the EXT1 in diagnosing cancer of liver treatment - Google Patents

Abstract

The invention discloses a kind of applications of EXT1 in diagnosing cancer of liver treatment.The invention also discloses application of the expression of shRNA stabilization checking liver cancer cells EXT1 genes in treatment liver cancer medicine is prepared.Present invention demonstrates that EXT1 can as liver cancer diagnosis marker and therapeutic targets, by detect EXT1 expression can to infection hepatitis B after develop into hepatic sclerosis, the people at highest risk of liver cancer is monitored, its liver cancer occurs to early diagnose, the cure rate of hepatocarcinoma patient can be improved with adjuvant clinical operative treatment by the expression for suppressing EXT1, improve the quality of life of patient.

Description

Applications of the EXT1 in diagnosing cancer of liver treatment

Technical field

The present invention relates to field of biological pharmacy, more particularly to a kind of applications of EXT1 in diagnosing cancer of liver treatment.

Background technology

Liver cancer is that the death rate is only second to stomach cancer, the third-largest common cancer of cancer of the esophagus, and China dies from liver cancer about every year 110000 people, account for the 45% of whole world PLC mortality number.How asymptomatic early liver cancer is or only light symptoms, about 80% liver Carninomatosis people is once it is found that just reach an advanced stage, and these patient survivals are mostly within half a year, and the existence health to the mankind is constituted Great threat.

At present, the early diagnosis of liver cancer relies primarily on serum alpha-fetoprotein (AFP) detection and combines ultrasonoscopy to high-risk people The monitoring of group.In addition, COMPUTED TOMOGRAPHY AND MAGNETIC RESONANCE IMAGING (CT) can show more than diameter 1.0cm tumour, have to early diagnosis It is certain to help.Clinically to the treatment of liver cancer still using surgery excision as first choice, early stage excision is the key for improving survival rate.But by Still there is at a relatively high recurrence rate in radical resection, therefore postoperative suitable regular follow-up is observed to supervise recurrence.Find diagnosing liver cancer early Effective ways, according to the expression of mark analyze patient prognosis situation, accordingly to patient on the basis of surgical operation The enterprising hand-manipulating of needle carries out auxiliary treatment to target molecules and is particularly important.

Up to the present, many biomarkers can not all be used as clinical diagnosis mark well, only help to auxiliary Diagnosis is helped, or differentiates prognosis and the chemotherapeutic efficacy of tumour.Clinical conventional biological diagnosis mark is alpha-fetoprotein at present (AFP), as secreted by liver, Luan Yellow capsules of fetus etc., typically by blood letting blood level, normal value should be less than 20ng/ ml.The accuracy rate of AFP diagnosing liver cancers only has 60%~80%；There is a situation where false positive and false negative.Xu Duo Qing Condition or disease Disease can raise AFP values, for example：Pregnancy, nonmalignant disease-NTD, teratoma, oxyhepatitis, chronic active liver When scorching, hepatitis heals, and other malignant diseases, such as germ cell knurl.On the contrary, minimum liver neoplasm, AFP can be expressed Low or delay；Tumour is too big, and the AFP of secretion exceedes detection maximum magnitude, also may occur in which false negative phenomenon.

In summary, AFP blood level test value, as auxiliary diagnosis or can only follow the trail of the state of an illness, assessment chemotherapy effect Reference, it is impossible to this come as early diagnosis liver cancer absolute instrument.

Hepatitis type B virus (HBV) belongs to Hepadnaviridae.HBV is the important factor for causing liver cancer.Liver cancer is mostly by hepatitis Hepatic sclerosis is converted into, canceration is finally just formed, therefore have the process of " hepatitis-hepatic sclerosis-liver cancer " trilogy development evolvement.Have Data display liver cancer case 90% infected HBV.It is another to have research 20 years HBV infection history persons of prompting, it there are about 5%-10% generation Canceration, one of carcinogenesis mechanism is that HBV partial gene fragments are incorporated on hepatocytic genes, is mutated, causes some causes Oncogene activation, tumor suppressor gene (TSG) inactivation etc..The gene that HBV is incorporated into liver cell is found, is to study going out for Viral Carcinogenesis change Hair point.Further research viral integrase how to cause oncogene activation, tumor suppressor gene inactivation, then clear and definite dysfunction gene Signal transduction path exception downstream how is induced, is the important means for studying hepatocellular carcinoma variable mechanism.On the other hand, disease is studied Host hepatocytes gene overexpression caused by malicious, or gene is quiet, expression defect, this can not only be used as early diagnosis The aid of tumour；It can combine simultaneously and develop specific closing/activation antibody (medicine), the regulation tumor tissues of orientation Target gene activity and its coherent signal transmission path, more effectively treatment tumour is reached with reference to clinical operation treatment.

Our early stages focus on to have studied patient infected after hepatitis B body by autoimmunity remove virus but Then it is developed to the case of liver cancer.We employ viral capture technique and host's liver cancer cells are analyzed, and find patient liver It is intracellular to remain the viral fragment integrated during HBV infection (see Figure of abstract).With the DNA oligonucleotides of hepatitis B to virus Fragment is captured, while combining unicellular genome sequencing, the gene of viral integrase areas adjacent is carried out into full-length genome Sequencing.We have found that most liver cancer cells can detect HBV No. 8 chromosome MED30-EXT1 of S genetic fragments insertion host Intergenic region (as shown in Figure 1).And be rare in non-liver cancer cell of this viral integrase event by cancer.Disease Poison integration MED30-EXT1 intergenic region directly results in EXT1 and is overexpressed in liver cancer tissue, not only promotes invading for virus Attack, while inducing hepatocyte phenotype is abnormal, the growth of tumour cell.EXT1 gene codes have the egg of 746 amino acid residues In vain, EXT1 (Exostoses-1, heparan copolymerase).It is the II type cross-film eggs being located on golgiosome and endoplasmic reticulum In vain.And on effects of the EXT1 in the generation of viral integrase to liver cell and liver cancer and its related application there is not yet related report Road.

The content of the invention

It is an object of the present invention to provide it is a kind of it is new can to developed into after infection hepatitis B hepatic sclerosis, liver cancer it is high-risk Crowd is monitored, by detecting its expression and as the mark and new liver cancer treatment target of early diagnosis.

To achieve the above object, the application the invention discloses EXT1 in diagnosing cancer of liver reagent is prepared.

The invention also discloses applications of the EXT1 in treatment liver cancer medicine is prepared.

We have found that HBV infection crosses after liver cell the base that its S genetic fragment is inserted to No. 8 chromosome MED30-EXT1 of host Because of interval region (see Fig. 1).And be rare in non-liver cancer cell of this viral integrase event by cancer.Viral integrase MED30-EXT1 intergenic region directly results in EXT1 and is overexpressed in liver cancer tissue, and EXT1 is in liver cancer tissue than pairing Non-liver cancer tissue in expression it is significantly raised.Meanwhile, in liver cancer cell lines relative to the expression in primary hepatocyte system Level is significantly raised.Therefore EXT1 expression in hepatitis B infected Patients ' Hepatocytes later is detected, can be backward to infection hepatitis B Hepatic sclerosis, the people at highest risk of liver cancer development are monitored in real time.And targeting intervention is carried out to EXT1, there may be anti-hepatic fibrosis Change and the effect of anti-liver cancer and anti-cell evolution.

The present invention is template by cDNA library, and the coded sequence of EXT1 genes is amplified by PCR, builds pBABE- Puro-EXT1 carrier for expression of eukaryon, infects HLF, Bel-7402, and MHCC-LM3 cell line, and stable be overexpressed is set up in screening The hepatoma cell strain of EXT1 genes.It was found that being overexpressed EXT1 directly facilitates the growth of liver cancer cells, differentiation.The present invention utilizes Tet- PLKO-puro vector rna i technologies carry out stabilization checking to EXT1, construct stable expression EXT1shRNA liver cancer Hep3B and Huh7 cell lines, find EXT1 protein expressions, suppress hepatoma cell proliferation, reverse the malignant phenotype of liver cancer cells, are liver cancer base Because the clinical practice for the treatment of opens new thinking.

EXT1 high level expression can induce liver cancer genesis and development.Hepatitis B infected restrovirus fragment integrates insertion people MED30-EXT1 intergenic region causes host hepatocytes EXT1 high expression levels to be that disease develops to hepatic sclerosis, liver cancer High risk factor.Therefore EXT1 can be used as differentiation, diagnosing liver cancer and the clinical operation of Clinical Follow-up hepatitis B patient disease and control Treat one of standard of curative effect evaluation.

Compared with prior art, the invention has the advantages that：

Present invention firstly discovers that, the intergenic region that hepatitis B infected rear HBV fragments integrate insertion people MED30-EXT1 is drawn It is the high risk factor that disease develops to hepatic sclerosis, liver cancer to play host hepatocytes EXT1 height expression expression.By detecting people MED30- Whether EXT1 intergenic region has viral integral piece section, and liver cancer can occur for detection EXT1 expression, hair Exhibition carries out early detection.Liver cancer cells can be suppressed by being used as drug mechanism by the stable interference EXT1 of shRNA expression again Propagation, obstruction Tumor Angiongesis and liver cancer cells transfer, so that adjuvant clinical operative treatment, improves the healing of hepatocarcinoma patient Rate, improves the quality of life of patient.

The technique effect of design, the generation of the present invention is described further below with reference to accompanying drawing, to be fully understood from The purpose of the present invention, feature and effect.

Brief description of the drawings

Fig. 1 is that the host's liver cancer cells for infecting hepatitis B are analyzed, with the DNA oligonucleotides pair of hepatitis B Viral fragment is captured, while combining unicellular genome sequencing, the gene of viral integrase areas adjacent is carried out into full base Because of a group sequencing；

Fig. 2A is to detect that previous infection is crossed after hepatitis B by SABC to develop into the patient of liver cancer its cancerous tissue by cancer Tissue compares, and EXT1 expression is higher than the situation map of cancer beside organism in cancerous tissue；

Fig. 2 B are to compared for 50 pairs of previous infections to cross after hepatitis B the paired sample of the patient for developing into liver cancer (cancerous tissue is in cancer Side tissue), dyed after detecting its expression by SABC by Image pro plus software analysis EXT1 in unit area Signal intensity quantify, it was confirmed that EXT1 expression cancerous tissue be higher than cancer beside organism analysis result figure；

Fig. 3 is that Western Blot detections EXT1 is overexpressed liver cancer cell lines HLF, Bel-7402, MHCC-LM3, and its phase Answer expression spirograms of the EXT1 on protein level in control group；

Fig. 4 be disturb EXT1 expression liver cancer cell lines Hep3-B and Huh-7 structure after by Western Blot sides Expression spirograms of the EXT1 on protein level in liver cancer cell lines and its corresponding control group after method detection slow-virus transfection；

Fig. 5 A are crystal violet cell in vitro colony formation result figures；

Fig. 5 B are crystal violet cell in vitro colony formation result figures；

Fig. 6 A are in vitro CCK-8 cell proliferation experiment result figures；

Fig. 6 B are in vitro CCK-8 cell proliferation experiment result figures；

Fig. 7 A are in vivo into knurl analysis of experimental results figure；

Fig. 7 B are in vitro CCK-8 cell proliferation experiment result figures.

Embodiment

Embodiment 1：Based on HBV virus capture data, it is unicellular in look for the analyses of HBV integration sites

1. individual cells are extracted in liver cancer tissue by mouth to mouth method.

2. having carried out quality control for 264 single celled HBV captured data in liver cancer tissue, utilize SOAP nuke eliminate the redundant sequence of the read sequence containing joint sequence and PCR amplifications.Through analysis, deposited in initial data In higher PCR extension increasing sequences.For the data after filtering, HBV (NC_ are compared respectively using SOAP softwares 003977.1) with human genome sequence (hg19).

Wherein, paired-end reads sequence compares HBV gene group in 218 samples.In 232 samples There is single read sequence to compare HBV gene group.For each unicellular sample, HBV will be arrived without comparing completely With the read sequence pear softwares (http of human genome sequence://sco.h-its.org/exelixis/web/ Software/pear/doc.html paired-end splicings) have been carried out, and the genome with HBV and people has carried out blat respectively Local Alignment.With reference to blat comparison results, it have found while comparing the read sequence to HBV and human genome, the HBV that gone forward side by side is whole Site is closed to search.The site that HBV is incorporated into genome is all have found in 117 samples.Wherein, all it have found in 106 samples Positioned at the HBV integration sites (as shown in Figure 1) of No. 8 chromosome MED30-EXT1 intergenic regions.

Embodiment 2：SABC

1. experiment material：50 previous infections cross after hepatitis B the operation frozen tissue sample (paired liver cancer for developing into liver cancer Tissue, its cancer beside organism), primary antibody is rabbit-anti people EXT1 antibody (Abcam, article No. ab126305), and follow-up dyeing is used GTVision III immunohistochemical kits (Shanghai Gene Tech. Company Limited).

2. experimental method：

1) section is taken out, surrounding moisture is blotted with filter paper, circle is drawn around tissue with group change pen, in circle inner tissue It is put into after instilling 5% sheep blood serum (consistent with secondary antibody source) in wet box, room temperature 1 hour；

2) primary antibody is incubated：1% lowlenthal serum is prepared with PBS, 1% lowlenthal serum prepared with PBS is pressed According to ratio 1：400 dilution rabbit-anti people's EXT1 antibody, get rid of 10% lowlenthal serum confining liquid on organization chip, are dried with dust-free paper Around tissue, the EXT1 antibody (about 100 μ l, abcam, ab126305) of the rabbit-anti people diluted is directly added into, is placed in 4 in wet box DEG C overnight.37 DEG C of need rewarming 1 hour is taken out from refrigerator within second day；

3) secondary antibody is incubated：Primary antibody is outwelled and 5min × 5 time are washed with PBS；The water around circle is sucked with filter paper, added 30min (recovery) in 37 DEG C of constant temperature roasters is put into after the secondary antibody diluted.The ready μ l of developer DAB working solutions 80 are added dropwise, 10min is incubated at room temperature, running water rinses color development stopping；

4) haematoxylin redyeing nucleus is used, room temperature 30 seconds is rinsed with running water and redyed for 1 hour；

5) mounting：Alcohol (70%-100%) dehydrations at different levels, every grade of 3min.Organization chip is taken out to insert three in dimethylbenzene It is secondary, each 5min.Resinene is added dropwise with dropper on organization chip, then covered, is gently extruded, and catch up with tweezers Walk and drying is stood in bubble, fume hood, micro- sem observation, relatively paired tumor tissues and EXT1 in adjacent cancer beside organism Expression, as a result as shown in Figure 2 A, (being tumor tissues above, here is cancer beside organism).Pass through Image proplus softwares The signal intensity quantitative analysis in EXT1 dyeing unit areas is analyzed, passes through t assays p<0.0001, as a result such as Fig. 2 B institutes Show.From Fig. 2A and Fig. 2 B can be seen that liver cancer tissue in EXT1 expression quantity higher than pairing cancer beside organism.

Embodiment 3：The structure of pBABE-puro-EXT1 over-express vectors and identification

1. using human cDNA library as template, the volume of EXT1 genes (the NCBI numbers of logging in are NM_000127) is amplified by PCR Code sequence.

The long 3376bp of EXT1 gene coded sequences, PCR primer design is as follows：

EXT1-F,

5’-GCGGATCCATTATTATTCGCCACCATGCAGGCCAAAAAACGCTATTT-3’；

EXT1-R,

5’-GGAATTCTCACTTATCGTCGTCATCCTTGTAATCAAGTCGCTCAATGTCTCGGTATT-3’。

PCR reaction conditions：95 DEG C of denaturation 5min, then carry out 30 circulations amplifications (98 DEG C of 10s, 58 DEG C of 10s, 72 DEG C 30s), last 72 DEG C are continued to extend 5min.By the PCR primer after purification of EXT1 genes and pBABE-puro carriers, (Addgene is carried Body 1764) carried out respectively with EcoRI and BamHI after digestion, it is attached with T4DNA ligases, converts EHEC DH5a, Correct positive colony is filtered out by bacterium colony PCR and digestion, then carries out DNA sequence dna identification.The recombinant vector successfully constructed is pBABE-puro-EXT1。

2. calcium phosphate precipitation prepares retroviruse：Retroviruse incasing cells 293FT is inoculated with to a diameter of In 10cm Tissue Culture Dish, 24h is cultivated, is transfected when cell membrane rate is up to 60%.Concrete operations are as follows：By 20ug PBABE-puro-EXT1 recombinant vectors are mixed with 20ugPIK packaging plasmids, add 50uLCaCl₂Solution (2mmol/L) and 110uLH2O is mixed, and 200uLHBS solution is added dropwise into mixed liquor, 30min is stored at room temperature；293FT is taken out from 37 DEG C of incubators thin Born of the same parents, are lightly uniformly added dropwise to the liquid to be transfected mixed in the nutrient solution of 293FT cells；After 37 DEG C of culture 5h, training is discarded Nutrient solution, rinses cell twice with the PBS solution of incubation, adds 10mL nutrient solutions, is placed in 37 DEG C and continues to cultivate；Collect and contain after 24h The nutrient solution of vial supernatant, with 0.45 μm of membrane filtration vial supernatant, is placed in -80 DEG C of refrigerators and preserves.

3. the measure of virus titer：It is 5 × 10 to prepare cell density⁶Individual cell/L Hep3B single cell suspensions, before infection 1d, which is inoculated in, sucks original fluid when cell reaches 40%-50% degrees of fusion after 6 well culture plates, 24h, add the disease of different dilution factors Malicious supernatant is (from 10^-1Start doubling dilution to 10^-6).Add polybrene (polybrene) 8mg/L to act on 3h per hole, reduce film table Surface charge, promotes retroviral infection cell, then add nutrient solution 3mL to the whole mass concentration of polybrene be 2mg/L.Continue 48h is cultivated, using 2.5g/L Trypsin Induced cell monolayers, with 1：5 are passaged to addition purine containing 10mg/L after 6 orifice plates, 24h The selective nutrient solution of mycin (puromycin), liquid is changed 1 time per 2-3d.After 5-6d, reduction puromycin concentration (5mg/L) after It is continuous to maintain culture, counted until under positive colony formation (about 2-3 weeks), Nikon inverted phase contrast microscopes.Virus titer (CFU/mL)=be averaged resistant cell colonies X extension rate × 1000.

4. the strain of vial supernatant infection cell：By primary liver cancer cells with 2.5 × 10⁶Individual cell/L density paving group is extremely In T25 blake bottles, cultivate and start infection virus after cell 24h.Polybrene is added in vial supernatant, and (whole mass concentration is 4 μ g/ L).The nutrient solution for treating infection cell is discarded, above-mentioned 5mL virus liquids are added, is placed in 37 DEG C of incubators and cultivates.Repeated later per 3h 1 time, coinfection 3 times changes normal nutrient solution after being finished per subinfection and stayed overnight.Infection terminates rear 48h and adds puromycin concentration (0.5 μ g/L), screening positive clone simultaneously expands culture, sets up hepatoma cell strain (HLF-EXT1, the Bel- for being overexpressed EXT1 genes 7402-EXT1, and MHCC-LM3-EXT1 cells).The hepatoma cell strain for setting up empty carrier (pBABE-puro) infection simultaneously is made For control group, HLF-vector, Bel-7402-vector, and MHCC-LM3-vector cell are named.

5. it is overexpressed the detection of EXT1 protein expression levels in hepatoma cell strain：Total protein of cell is extracted with RIPA lysates And with Bio-Rad Protein Assay Dye Reagent Concentrate reagent quantitatives.Every group takes equivalent total protein to enter Row 10%SDS-PAGE reagent electrophoresis, and transfer them on pvdf membrane, close 1h with the TBST room temperatures containing 5% defatted milk.Point Jia Ru not EXT1 antibody (1:1000) (Santa Cruz Biotechnology, sc-11039) and GAPDH antibody (1:50, 000) (Santa Cruz Biotechnology, sc-25778) 4 DEG C of overnight incubations.TBST washes film 4 times, adds secondary antibody room temperature and incubates 1h is educated, washes after film and uses the expression of ECL reagent testing goal albumen.From figure 3, it can be seen that HLF-EXT1, Bel-7402-EXT1, And successfully it has been overexpressed EXT1 albumen in MHCC-LM3-EXT1 hepatoma cell strains.

Embodiment 4：Disturb structure and the identification of the liver cancer cell lines of EXT1 expression

1.EXT1-shRNA sequences (1-5；2-1；3-1)

Sequence 1-5:

CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG；

Sequence 2-1:

CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG；

Sequence 3-1:

CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG

2.EXT1 disturb the structure of Lentiviral：By EXT1-shRNA sequence 1-5,2-1,3-1, and scramble Control sequence clone is building up on Lentiviral Tet-pLKO-puro (Addgene plasmid 21915).First will PLKO-Tet-On plasmids carry out double digestion, electrophoresis, gel extraction with restriction enzyme A geI and EcoRI, then are connected with DNA EXT1-shRNA sequences are connected to the AgeI/EcoRI sites in Tet-pLKO-puro carriers by the solutionI in kit. Building can induce the recombinant vector pLKO-EXT1-Tet-on-EXT1 of EXT1-shRNA expression.Connection product is converted into large intestine bar Bacterium competence cell Stbl3.Converted product is uniformly coated onto on the LB flat boards containing 100 μ g/mL polybrenes, cultivated at 37 DEG C.

3. the packaging of slow virus：Recombinant vector expands after culture, and the plasmid of extraction delivers to the sequencing of Shanghai Addgene companies Afterwards, the correct positive recombinant pLKO-shEXT1-Tet-on of sequencing result is preserved.WithPlasmid Midi Kit extracts pLKO-shEXT1-Tet-on, psPAX2 and pMD2.G DNA.With X-tremeGene HP DNA Transfectant will recombinate pLKO-shEXT1-Tet-on and virus packaging plasmid psPAX2, pMD2.G cotransfection extremely HEK293T cells.Collect the viral supernatants of 24h and 48h after transfection.Filtered, dispensed after -80 with 0.45 μm of syringe needle pass filter DEG C preserve.

4. slow-virus infection Hep3-B, Huh-7 liver cancer cell lines and its identification of interference EXT1 expression：By Hep3-B, Huh-7 is inoculated in 6 orifice plates, infection cell during next day cell confluency degree 50%.Original fluid is discarded, adds and contains 8 μ g/ml coacervations The viral supernatants liquid measure added in the fresh RPMI-1640 nutrient solutions of amine, every hole need to reach the 1/3 of every hole nutrient solution total amount.Sense Liquid is changed after dye 24h and is passed on.Continue to cultivate and 2 μ g/ml puromycins screening resisting cell is added after 24h.72h is screened to obtain The cell clone of EXT1-shRNA stable transfections.By the inoculation of Hep3-B, Huh-7-pLKO-shEXT1-Tet-on liver cancer cell lines In 6 orifice plates, the fortimicin (Doxycycline) for adding various concentrations induces receipts after EXT1-shRNA expression, induction 24 Collect cell and carry out coherent detection.Hep3-B, Huh-7 liver cancer cell lines of transfection are write respectively：Hep3-B-sh-EXT1 1-5、 Hep3-B-sh-EXT1 2-1、Hep3-B-sh-EXT1 3-1；Huh-7-sh-EXT1 1-5、Huh-7-sh-EXT1 2-1、 Huh-7-sh-EXT1 3-1 and scramble compare Hep3-B-vector, Huh-7-vector.

5. the detection of EXT1 protein expression levels in slow virus infected cell：Total protein of cell is extracted with RIPA lysates simultaneously With Bio-Rad Protein Assay Dye Reagent Concentrate reagent quantitatives.Every group takes equivalent total protein to carry out 10%SDS-PAGE reagent electrophoresis, and transfer them on pvdf membrane, close 1h with the TBST room temperatures containing 5% defatted milk.Respectively Add EXT1 antibody (1:1000) (Santa Cruz Biotechnology, sc-11039) and GAPDH antibody (1:50,000) (Santa Cruz Biotechnology, sc-25778) 4 DEG C of overnight incubations.TBST washes film 4 times, adds secondary antibody incubation at room temperature 1h, washes after film and uses the expression of ECL reagent testing goal albumen.From fig. 4, it can be seen that successfully disturb EXT1 Hep3-B, Expression in Huh-7 hepatoma cell strains.

Embodiment 5：Cell in vitro colony formation

1. prepare agar plate：1.2% low melting-point agarose solution (Lonza, 50101), isometric ratio are prepared with distilled water Example 2 × 1640 culture mediums of mixing, until temperature drops to 60 DEG C or so, by 0.2 zut filter in 6 orifice plates (1.5ml/ Well), room temperature cooled and solidified is placed in, agar plate is obtained.

2. take EXT1 overexpressions/interference cell system of structure：HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3- EXT1 cell lines/Hep3-B-sh-EXT1 1-5, Hep3-B-sh-EXT1 2-1, Hep3-B-sh-EXT1 3-1 cell lines；With And corresponding control cell lines.

3. cell clonal formation:0.6% low melting-point agarose solution is prepared with distilled water, isometric ratio mixes 2X RMPI1640 culture mediums, 0.2 zut filter is degerming, is mixed into cell, and it is 1500 or 2000/ml to make cell concentration.Will step The cell mixed in rapid 3 is added on the agar plate prepared in step 1 at 37 DEG C, and room temperature is placed 1 hour, is then placed in 4 DEG C Half an hour in refrigerator, wait agar solidification.After agar plate solidification, six orifice plates are transferred in cell culture incubator.Per hole after one day Add the complete culture solution (Gibco, C11875500CP and 10% mycillin (hyclone)) of the hyclones of 1ml 10%.14 When cell clone grows to a certain size after it, culture plate is taken out, fixed with 4% paraformaldehyde, PBS (pH= 7.4) half an hour is soaked, is taken out, with 0.05% violet staining 2 hours, is rinsed, is contaminated according to Microscopic observation with 1xPBS after catching The depth of color judges time washed and this time.Micro- Microscopic observation is simultaneously taken a picture.As a result as shown in Figure 5 A and 5B.After violet staining Liver cancer cells colony counts can intuitively be reflected how much.As shown in Figure 5A, EXT1 HLF-EXT1, Bel-7402- are overexpressed EXT1, and MHCC-LM3-EXT1 liver cancer cell lines, compared with its control group, the body outer clone formation of liver cancer cells is increased. As shown in Figure 5 B, Hep3-B-sh-EXT1 1-5, Hep3-B-sh-EXT1 2-1, the Hep3-B-sh-EXT1 of interference EXT1 expression 3-1 liver cancer cell lines, compared with its control group, the body outer clone formation of liver cancer cells is reduced.

Embodiment 6：In vitro CCK-8 method determines cell proliferation experiment

1. take EXT1 overexpressions/interference cell system of structure：HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3- EXT1 cell lines/Hep3-B-sh-EXT1 1-5, Hep3-B-sh-EXT1 2-1, Hep3-B-sh-EXT1 3-1 cell lines； Huh-7-sh-EXT1 1-5, Huh-7-sh-EXT1 2-1, Huh-7-sh-EXT1 3-1 cell lines；And corresponding control Cell line.

2. experimental procedure：Cell suspension is made into complete medium (Gibico, RPMI1640), 96 orifice plates are taken, added respectively Enter above-mentioned cell line, per 3,000, hole cell, the μ l of volume 100, every kind of cell line is parallel to do 10 holes, averages.It is placed in Cell culture incubator is taken out after being incubated 24 hours, and the μ l (seven marine growth Science and Technology Ltd.s) of CCK-8 reagents 20 are added in every hole.With this As initial time 0hr, hereafter choose 1,2,3,4,5 day time point.Fresh medium 200 μ l and CCK- are only added in zeroing hole The μ l of 8 reagent 20, and it is acellular.It is incubated at 37 DEG C 3 hours, the absorbance at 490nm is then detected on ELIASA (BioTek), As a result as shown in Figure 5 A and 5B.Because absorbance is directly proportional to cell number and vigor, so linearly can intuitively reflect Cell proliferative conditions.As shown in Figure 6A, EXT1 HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 are overexpressed Liver cancer cell lines, compared with its control group, the proliferation rates of liver cancer cells are accelerated.As shown in Figure 6B, interference EXT1 is expressed Hep3-B-sh-EXT1 1-5, Hep3-B-sh-EXT1 2-1, Hep3-B-sh-EXT1 3-1 liver cancer cell lines；And Huh-7- Sh-EXT1 1-5, Huh-7-sh-EXT1 2-1, Huh-7-sh-EXT1 3-1 cell lines；Compared with its control group, liver cancer cells Multiplication rate substantially slow down.

Embodiment 7：In vivo into knurl experiment：

1. take EXT1 overexpressions/interference cell system of structure：HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3- EXT1 cell lines/Hep3-B-sh-EXT1 1-5, Hep3-B-sh-EXT1 2-1, Hep3-B-sh-EXT1 3-1 cell lines, Huh-7-sh-EXT1 1-5, Huh-7-sh-EXT1 2-1, Huh-7-sh-EXT1 3-1 cell lines；And corresponding control Cell line.

2. experimental procedure：By the cell line cell of above-mentioned structure be suspended in without serum minimal medium (Gibico, RPMI1640 in), 50 μ l minimal mediums are contained to the suspension and isometric matrigel of 1,000,000 tumour cell (BD, article No. 356234) is well mixed, and is then injected into the subcutaneous of nude mice, and injection rate is 100 μ l/, forms subcutaneous transplantation knurl. Every kind of 6 mouse of cell line constitute one group.Take mice-transplanted tumor dirty after 4 weeks, measure the size of tumour.As shown in Figure 7 A, mouse It is subcutaneously injected into and is overexpressed after EXT1 HLF-EXT1, Bel-7402-EXT1, and MHCC-LM3-EXT1 liver cancer cell lines and it Control group is compared, and the size of transplantable tumor is significantly increased.As shown in Figure 7 B, mouse is subcutaneously injected into the Hep3-B- of interference EXT1 expression Sh-EXT1 1-5, Hep3-B-sh-EXT1 2-1, Hep3-B-sh-EXT1 3-1 liver cancer cell lines；And Huh-7-sh-EXT1 After 1-5, Huh-7-sh-EXT1 2-1, Huh-7-sh-EXT1 3-1 cell lines compared with its control group, the big Xiao Ming of transplantable tumor It is aobvious to reduce.

In summary, we are by the capture to hepatitis B fragment in liver cancer cells, while combining unicellular full genome Group sequencing, it is found that the DNA fragmentation of hepatitis B is incorporated into host MED30-EXT1 intergenic region and causes host hepatocytes EXT1 high expression levels.Further the patient of liver cancer its cancerous tissue is developed into by cancer by being crossed to 50 previous infections after hepatitis B Tissue compares, we demonstrate that EXT1 expression is higher than cancer beside organism in cancerous tissue.By to liver cancer cell lines HLF, Bel- 7402nd, MHCC-LM3 is overexpressed EXT1, it has been found that these height expression EXT1 liver cancer cells proliferative ability in vitro and in vivo One-tenth knurl ability is greatly enhanced.Correspond, interference EXT1 is set up by slow-virus infection Hep3-B, Huh-7 liver cancer cell lines The liver cancer cell lines of expression, it has been found that the proliferative ability of these low expressions EXT1 liver cancer cells in vitro, and in vivo into knurl power Substantially reduction.

Therefore, the high level expression for infecting EXT1 in the Patients ' Hepatocytes after hepatitis B is probably disease to hepatic sclerosis, liver The high risk factor of cancer development.Also therefore EXT1 can be used as the differentiation of Clinical Follow-up hepatitis B patient disease, diagnosing liver cancer and One of standard of clinical operation treatment curative effect evaluation.And targeting intervention is carried out to EXT1, there may be anti-hepatic fibrosis-renal tubular ectasia syndrome and anti- The effect of liver cancer cells evolution.So, EXT1 can be applied to prepare hepatic sclerosis and liver because of caused by infection hepatitis B In the diagnostic reagent of cancer, and applied in the medicine for preparing treatment liver cancer.

Preferred embodiment of the invention described in detail above.It should be appreciated that one of ordinary skill in the art without Need creative work just can make many modifications and variations according to the design of the present invention.Therefore, all technologies in the art Personnel are available by logical analysis, reasoning, or a limited experiment on the basis of existing technology under this invention's idea Technical scheme, all should be in the protection domain being defined in the patent claims.

Claims (2)

1. Applications of the 1.EXT1 in hepatic sclerosis and the diagnostic reagent of liver cancer because of caused by infection hepatitis B is prepared.
2. Applications of the 2.EXT1 in treatment liver cancer medicine is prepared.