CN113230404B

CN113230404B - Use of SAGE1 inhibitor in preparation of medicine or kit

Info

Publication number: CN113230404B
Application number: CN202110481546.3A
Authority: CN
Inventors: 雷鸣; 邓玮; 张燕捷; 翁凯
Original assignee: Ninth Peoples Hospital Shanghai Jiaotong University School of Medicine; Shanghai Jiaotong University School of Medicine
Current assignee: Ninth Peoples Hospital Shanghai Jiaotong University School of Medicine; Shanghai Jiaotong University School of Medicine
Priority date: 2019-12-13
Filing date: 2019-12-13
Publication date: 2023-01-24
Anticipated expiration: 2039-12-13
Also published as: CN110960677B; CN113230404A; CN110960677A

Abstract

The invention relates to the technical field of biology, in particular to application of SAGE1 inhibitor in preparation of a medicine or a kit. The present invention provides the use of a SAGE1 inhibitor in the manufacture of a medicament or kit for: modulating the expression level of SAGE1-INTS3 complex. SAGE1 provided by the invention is taken as a tumor specific antigen to be abnormally activated in various types of human tumors and can form a functional complex with INTS3, the SAGE1-INTS3 complex specifically exists in various tumor cells and tumor tissues, and the specificity is further proved to be specifically directed to SAGE1 gene/protein targeting or to SAGE1-INTS3 complex gene/protein targeting, so that the proliferation, anchorage-independent growth and in-vivo xenograft tumor growth of SAGE1 positive cancer cells can be greatly inhibited.

Description

Use of SAGE1 inhibitor in preparation of medicine or kit

The application is a divisional application, the application number of the original application is 201911282567.1, the application date is 2019-12-13, and the invention and creation name is' application of SAGE1 inhibitor in preparation of drugs or kits

Technical Field

The invention relates to the technical field of biology, in particular to application of an SAGE1 inhibitor in preparation of a medicament or a kit.

Background

Tuschl et al in 2001 first demonstrated that the expression inhibition of a target gene can be achieved after artificially synthesized siRNA is introduced into mammalian cells, and since then, RNA interference technology is widely applied in both basic research and pharmaceutical application fields. The technology is considered to have huge application potential on diseases or targets where traditional medicines are not feasible (undrugable). Therefore, the RNA interference technology is not only used as an efficient and multifunctional important biomedical research tool, but also brings revolutionary breakthrough to the development of more targeted drugs. For as little as a decade, biopharmaceuticals based on RNA interference have become an emerging strategic area and have made tremendous progress. Currently, the varieties of drugs that have entered the clinical research stage are mainly focused on antiviral, antitumor, and some rare diseases, or on conditions where no drug is available (unmet).

The in vitro and in vivo delivery strategies of siRNA that have been reported at present can be roughly divided into two main categories, namely viral vector delivery and non-viral vector delivery. Naked siRNA/shRNA/dsRNA can be administered by systemic delivery or directly delivered to the site of action of siRNA targeted to a specific gene depending on the delivery technique can produce the desired induced inhibitory effect. Common viral delivery vectors include adenovirus, adeno-associated virus, retrovirus, lentivirus, and the like, such as herpes virus vectors and baculovirus vectors have also been used to express shRNA upon transduction into cells. The new anti-tumor therapeutic drug oncolytic virus belongs to the class, not all viruses can cause the death of host cells after infection, and in order to achieve the aim, the killing capacity of the oncolytic virus on tumor cells can be further strengthened by methods such as the method of connecting shRNA of a specific targeting oncogene and the like. The selection of target genes and targeting sequences for targeted silencing is critical for these viral drugs.

Disclosure of Invention

In view of the above-described drawbacks of the prior art, the present invention aims to provide the use of a SAGE1 inhibitor in the preparation of a medicament or a kit for solving the problems in the prior art.

To achieve the above and other related objects, the present invention provides, in one aspect, use of a SAGE1 inhibitor for the manufacture of a medicament or a kit for:

modulating the expression level of SAGE1-INTS3 complex.

In some embodiments of the invention, the inhibitor of SAGE1 is capable of inhibiting the expression and/or function of SAGE 1.

In some embodiments of the invention, the SAGE1 inhibitor is a single active ingredient.

In some embodiments of the invention, the SAGE1 inhibitor is selected from a nucleic acid molecule, a protein molecule, or a compound.

In some embodiments of the invention, the nucleic acid molecule is selected from the group consisting of an interfering RNA for SAGE1, an antisense oligonucleotide for SAGE1, an agent for knocking-out or knocking-down SAGE1 expression.

In some embodiments of the invention, the protein molecule is selected from an anti-SAGE 1 antibody, preferably a monoclonal antibody.

In some embodiments of the invention, the target sequence of the nucleic acid molecule comprises a sequence as set forth in one of SEQ ID Nos. 1 to 9.

In some embodiments of the invention, the polynucleotide sequence of the nucleic acid molecule comprises the sequence shown in one of SEQ ID Nos. 10 to 18.

In some embodiments of the invention, the polynucleotide sequence of the nucleic acid molecule comprises the sequence set forth in one of SEQ ID Nos. 19 to 22.

In some embodiments of the invention, the SAGE1 inhibitor is selected from a compound that competes with SAGE1 for binding to INTS3 or interferes with the interaction between SAGE1 and INTS3.

In some embodiments of the invention, the SAGE1 inhibitor is selected from the group consisting of INTS6, a combination of one or more of INTS 6L.

In some embodiments of the invention, the tumor is a SAGE1 positive tumor.

In some embodiments of the invention, the tumor is selected from a solid tumor or a hematological tumor, preferably selected from intestinal cancer, lung cancer, liver cancer, breast cancer, esophageal cancer, head and neck cancer, skin cancer, kidney cancer, leukemia, colon cancer, hepatocellular cancer, ovarian serous cystadenocarcinoma, endometrial cancer, thyroid cancer, cutaneous melanoma, lung adenocarcinoma, head and neck squamous cell carcinoma, glioblastoma multiforme, prostate cancer, thymus cancer, brain low-grade glioma, rectal adenocarcinoma, pheochromocytoma and paraganglioma, esophageal cancer, renal clear cell carcinoma, cervical squamous cell carcinoma and adenocarcinoma, bladder urothelial carcinoma, renal papillary cell carcinoma, pancreatic cancer, gastric cancer, renal chromophobe carcinoma, breast infiltrating carcinoma, lung squamous carcinoma, sarcoma, acute myeloid leukemia.

In another aspect, the invention provides a composition comprising a SAGE1 inhibitor for use in:

modulating the expression level of SAGE1-INTS3 complex.

Drawings

FIG. 1A is a diagram showing the results of sequencing analysis in example 1 of the present invention.

FIG. 1B is a diagram showing the analysis of the proportion of SAGE1-positively expressing cancer patients in example 1 of the present invention.

FIG. 1C is a schematic diagram showing the comparison of SAGE1 expression between tumor tissue and tissue adjacent to cancer in example 1 of the present invention.

FIG. 1D is a schematic diagram showing the overall survival of patients with SAGE1 positive expression and SAGE1 negative expression in example 1 of the present invention.

FIG. 1E is a graph showing the overall survival of patients with high expression of SAGE1 compared to those with low expression of SAGE1 in example 1 of the present invention.

FIG. 2A is a schematic representation of tumor immunoimaging of tissue according to example 2 of the present invention.

FIG. 2B is a schematic view showing the QPCR detection result in embodiment 2 of the present invention.

FIG. 2C is a schematic diagram showing the detection results of example 2 of the present invention for the universal cell lines LO2, 293T, K562, hutu80, U2 OS.

FIG. 2D is a schematic view showing the QPCR detection result in embodiment 2 of the present invention.

FIG. 2E is a graph showing the results of evaluating the correlation between SAGE1 expression and CRC prognostic factor in example 2 of the present invention.

FIG. 3A is a schematic diagram showing the proliferation of A375 tumor cells by SAGE1 in example 3 of the present invention.

FIG. 3B is a schematic diagram showing the effect of SAGE1 on Hutu80 tumor cell proliferation in example 3 of the present invention.

FIG. 3C is a schematic diagram showing the effect of SAGE1 on CaCO2 tumor cell proliferation in example 3 of the present invention.

FIG. 3D is a schematic diagram showing the experiment of soft agar colony formation after sorting of the recovered SAGE1 cells in example 3 of the present invention.

FIG. 3E is a schematic diagram illustrating the experimental results of the transplanted tumor of duodenal cancer in nude mice according to embodiment 3 of the present invention.

FIG. 3F is a schematic view showing the experimental results of colon cancer transplantable tumor in example 3 of the present invention.

FIG. 4A is a graph showing the result of inhibition of SAGE 1-positive PDX model of hepatoma carcinoma tumor by shRNA adenovirus against SAGE1 in example 4 of the present invention.

FIG. 4B is a graph showing the inhibition results of SAGE 1-positive poorly differentiated non-small cell epithelial derived lung cancer PDX tumor model by the shRNA adenovirus for SAGE1 in example 4 of the present invention.

FIG. 4C is a graph showing the result of the inhibition of SAGE 1-negative liver cancer tumor PDX model by the shRNA adenovirus against SAGE1 in example 4 of the present invention.

FIG. 5A is a schematic diagram showing the analysis results of silver staining gel in example 5 of the present invention.

FIG. 5B is a schematic diagram showing the result of mass spectrometric identification in example 5 of the present invention.

FIG. 5C is a schematic diagram showing the endogenous interaction of cells between SAGE1 and INTS3 in example 5 of the present invention.

FIG. 5D is a schematic diagram showing the results of in vitro purification of SAGE1-INTS3 complex protein in example 6 of the present invention.

FIG. 5E is a schematic representation of the results of in vitro expression and purification of INTS6-INTS3 complex in example 6 of the present invention.

FIG. 5F is a graph showing the result of analysis of the relationship between INTS3 and INTS6 in 293T cell line in the absence of SAGE1 in example 5.

FIG. 5G shows a schematic diagram of the alignment of protein sequences of SAGE1 and INTS6 of the present invention.

FIG. 5H is a schematic diagram showing the results of in vivo cell competition experiments performed on SAGE1, INTS3 and INTS6 proteins according to the present invention.

FIG. 5I is a schematic diagram showing the results of the in vitro protein complex competition formation experiment in example 6 of the present invention.

FIG. 5J is a schematic diagram showing the crystal structure analysis result of SAGE1-INTS3 complex in example 6 of the present invention.

FIG. 6A is a graph showing the measurement results of the binding constants of wild-type SAGE1 and INTS3 in example 7 of the present invention.

FIG. 6B is a graph showing the measurement results of the binding constants of SAGE1 and INTS3 mutants in example 7 of the present invention.

FIG. 6C is a schematic diagram showing the results of CO-IP experiments in 293T cells according to example 8 of the present invention.

FIG. 6D is a schematic diagram showing the results of the reversion experiment of wild type SAGE1 and SAGE1 mutants in SAGE1 knocked-down intestinal cancer tumor cells in example 9 of the present invention.

FIG. 6E is a graph showing the results of the experiments on the recovery of wild type SAGE1 and SAGE1 mutants in esophageal cancer tumor cells with knockdown of SAGE1 according to example 9 of the present invention.

FIG. 6F is a graph showing the results of a reversion experiment of wild type SAGE1 and SAGE1 mutants in a duodenal tumor cell in which SAGE1 was knocked out in example 9 of the present invention.

FIG. 6G is a graph showing the tumor volume results of the experimental transplantation of tumors in example 10 of the present invention.

Fig. 6H is a graph showing the tumor weight results of the experimental transplantation of tumors in example 10 of the present invention.

FIG. 6I is a schematic diagram showing the significant variation genes and the consistent variation directions of RNAseq after knocking down SAGE1 or INTS3, respectively, in HUTU80 of example 11.

FIG. 6J is a schematic diagram showing the signaling pathways involved in differential gene enrichment for significant changes in RNAseq of reverted wild-type SAGE1 in CaCO2 knocked-down SAGE1 according to example 11 of the present invention.

FIG. 6K is a schematic diagram showing the signaling pathways involved in RNAseq significant change differential gene enrichment of reversion mutant SAGE1 in CaCO2 with knockdown of SAGE1 in example 11 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments, and other advantages and effects of the present invention will be apparent to those skilled in the art from the disclosure of the present specification.

Cancer/testis (cancer-testis antigen) family genes are normally expressed only in the testis of adult animals, and are low or absent in other normal tissues, but are also expressed in almost all types of malignancies and blood cancers. These CTAs are considered as key biomarkers of cancer and are also excellent antigen sources for cancer immunotherapy, and many tumor testis antigens such as NY-ESO-1 cancer vaccines have entered third-phase clinics. Related studies in recent years have evaluated their role in tumorigenesis, possibly involving the regulation of important cellular processes during development, stem cell differentiation and carcinogenesis. Studies have demonstrated the selective expression of a number of cancer-testis antigens in tumor stem cells (CSCs) or tumor-derived cells (CICs), however, whether and how these reactivated testis proteins play a role in supporting tumorigenicity remains largely unexplained. The inventor of the invention unexpectedly discovers through a great deal of research that CT-X cancer testis antigen SAGE1 positioned on an X chromosome (X: 135895410-135913726, xq26.3) is outside normal testis tissues, SAGE1 is abnormally activated in various human tumors as a tumor-specific antigen and can form a functional complex with INTS3, SAGE1-INTS3 complex is specifically existed in various tumor cells and tumor tissues, and further proves that the gene/protein targeting of SAGE1 or the gene/protein targeting of SAGE1-INTS3 complex can greatly inhibit the proliferation, anchorage-independent growth and in-vivo xenograft tumor growth of SAGE1 positive cancer cells, thereby providing a new effective target for the treatment of tumors and completing the invention on the basis.

In a first aspect, the invention provides the use of an inhibitor of SAGE1 in the manufacture of a medicament or kit for the treatment of a tumour. The present inventors found that SAGE1 not only has positive expression universally across cancer species in tumor patients, but that patients with SAGE1 positive expression generally show poor prognosis, but also specifically positive expression in tumor tissues, but not in healthy tissues (e.g., cancer-adjacent tissues). Upon further inhibition of the expression and/or function of SAGE1, it was found that inhibition of SAGE1 could significantly inhibit proliferation, migration, anchorage-independent growth, etc. of tumor cells, while recovery of SAGE1 in disrupted somatic cells could recover the cell clonogenic capacity, thereby verifying that SAGE1 inhibitors could be used as drugs for treating tumors.

In the present invention, the term "treatment" includes prophylactic, curative or palliative treatment which results in the desired pharmaceutical and/or physiological effect. Preferably, the effect is a medical treatment that reduces one or more symptoms of the disease or eliminates the disease altogether, or blocks, delays the onset of the disease and/or reduces the risk of developing or worsening the disease.

In a second aspect, the invention provides the use of an SAGE1 inhibitor in the manufacture of a medicament or kit for modulating the expression level of the SAGE1-INTS3 complex. The inventor of the invention finds that SAGE1 can form a complex with INTS3 after abnormal activation as a tumor specific antigen, SAGE1-INTS3 complex exists specifically in various tumor cells and tumor tissues, and after SAGE1 is inhibited, the point mutation SAGE1 protein with key amino acid mutation interacting with INTS3 is recovered (F838A, F873A, K874A, R872A, M832A and Q840A), and the recovery mutant SAGE1 cannot promote the proliferation of tumor cells like the recovery wild SAGE1, which indicates that SAGE1 must form a complex with INTS3 to function, so that the interaction of SAGE1-INTS3 complex is destroyed, the amount of SAGE1-INTS3 complex existing in the cells is reduced, and the SAGE1-INTS3 complex can be used for preparing a medicine or a kit for inhibiting the growth of tumor cells.

In the present invention, SAGE1-INTS3 complex generally refers to a complex formed between SAGE1 and INTS3 by protein-protein interaction. The INTS3 may typically form a dimer (e.g., in solution), and the formed dimer may further form a SAGE1-INTS3 complex with SAGE1, which may be via hydrogen bondingSalt bridges, and the like. The crystal structure of the SAGE1-INTS3 complex may generally have the unit cell parameters shown below:

α =90 ± 0.1 °, β =113.280 ± 0.1 °, γ =90 ± 0.1 °. In the SAGE1-INTS3 complex, the key amino acids forming the complex between SAGE1 and INTS3 can generally comprise F838, F873, K874, R872, M832, Q840 and the like.

In the present invention, the SAGE1 inhibitor generally refers to a substance that can inhibit the expression and/or function of SAGE 1. For example, the SAGE1 inhibitor may partially inhibit, i.e., reduce the expression and/or function of SAGE1, or may completely inhibit, i.e., completely eliminate the expression and/or function of SAGE1, and this function may be the function of SAGE1 binding to INTS3 to form the SAGE1-INTS3 complex. The kind of suitable substances capable of acting as SAGE1 inhibitors should be known to those skilled in the art, for example, the inhibitors may be antagonists, blockers, etc., and further for example, the inhibitory function of the SAGE1 inhibitor may be inhibition of the expression level at the nucleic acid molecule level (e.g., mRNA level, DNA level) and/or protein molecule level of the SAGE1 gene, and further for example, the SAGE1 inhibitor may also be a substance that competes with SAGE1 for binding to INTS3. More specifically, the SAGE1 inhibitor may be a nucleic acid molecule, a protein molecule, a compound or the like, for example, the nucleic acid molecule may be selected from an interfering RNA against SAGE1, an antisense oligonucleotide against SAGE1, a substance for knocking out or knocking down expression of SAGE1, more specifically, siRNA, miRNA, shRNA, a gene knock-out vector, a gene expression vector (for example, capable of expressing siRNA, shRNA, interfering RNA or the like), or the like; for another example, the protein molecule may be selected from an anti-SAGE 1 antibody, which may be a monoclonal antibody, a polyclonal antibody, or the like; as another example, the SAGE1 inhibitor may be a substance capable of competing with SAGE1 for binding to INTS3, and specifically may be a combination of one or more of INTS6 (DDX 26, access: NP 036273.1), INTS6L (DDX 26b, access: Q8BND4.1), and the like. In a specific embodiment of the present invention, the target sequence of the nucleic acid molecule may comprise a sequence shown in one of SEQ ID Nos. 1 to 9. In another embodiment of the invention, the polynucleotide sequence of the nucleic acid molecule may comprise the sequence shown in one of SEQ ID Nos. 10 to 18. In another embodiment of the invention, the polynucleotide sequence of the nucleic acid molecule may comprise the sequence shown in one of SEQ ID Nos. 19 to 22.

In the medicament or the kit provided by the invention, the SAGE1 inhibitor can be used as a single effective component, and can also be combined with other active components to be jointly used for treating tumors.

In the medicine or kit provided by the invention, the tumor is usually SAGE1 positive tumor. SAGE1 positivity generally indicates that SAGE1 expression is present, or SAGE1 expression level is higher than a certain criterion, for example, SAGE1 positivity may be expression of mRNA in tumor tissue from which SAGE1 is detectable, further for example, SAGE1 positivity may be expression of protein in tumor tissue from which SAGE1 is detectable, further for example, SAGE1 positivity may be expression of mRNA in tumor tissue higher than in its surrounding healthy tissue, further for example, SAGE1 positivity may be expression of SAGE1 protein in tumor tissue higher than in its surrounding healthy tissue. The tumour may be a solid or haematological tumour, more particularly intestinal, lung, liver, breast, oesophageal, head and neck, skin, kidney, leukaemia, coad (colon), lihc (hepatocellular), ov (ovarian serous cystadenocarcinoma), ucec (endometrial), thca (thyroid), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate), thym (thymus), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pc (pheochromocytoma and paraganglioma), esca (oesophageal), kirc (renal clear cell carcinoma), cec (squamous cell carcinoma and adenocarcinoma of the cervix), blca (urothelial carcinoma), kirp (papillary cell carcinoma), paad (pancreatic carcinoma), pd (stomach carcinoma), kirch (renal chromophocyte carcinoma), brca (squamous cell carcinoma), squamous cell carcinoma (mammary carcinoma), acute myeloid leukemia (breast carcinoma), or the like sarcoma.

In a third aspect, the invention provides a composition comprising a SAGE1 inhibitor for use in: treating tumors; and/or, modulating the expression level of the INTS3-SAGE1 complex. The SAGE1 inhibitor can be any of the various SAGE1 inhibitors described above.

In a fourth aspect, the present invention provides a method for regulating the expression level of an SAGE1-INTS3 complex, in particular, for regulating the expression level of an SAGE1-INTS3 complex in a subject, cell or the like. For example, it may be the administration of an effective amount of a SAGE1 inhibitor, or a composition provided by the third aspect of the invention, to an individual.

In a fifth aspect the invention provides a method of treatment comprising: administering to the subject a therapeutically effective amount of a SAGE1 inhibitor, or a composition provided by the third aspect of the invention. The treatment provided by the present invention may be used to treat indications including, but not limited to, tumors and the like. The tumour may be a solid or haematological tumour, more particularly intestinal, lung, liver, breast, oesophageal, head and neck, skin, kidney, leukaemia, coad (colon), lihc (hepatocellular), ov (ovarian serous cystadenocarcinoma), ucec (endometrial), thca (thyroid), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate), thym (thymus), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pc (pheochromocytoma and paraganglioma), esca (oesophageal), kirc (renal clear cell carcinoma), cec (squamous cell carcinoma and adenocarcinoma of the cervix), blca (urothelial carcinoma), kirp (papillary cell carcinoma), paad (pancreatic carcinoma), pd (stomach carcinoma), kirch (renal chromophocyte carcinoma), brca (squamous cell carcinoma), squamous cell carcinoma (mammary carcinoma), acute myeloid leukemia (breast carcinoma), or the like sarcoma.

In the present invention, a "subject" generally includes human, non-human primates, such as mammals, dogs, cats, horses, sheep, pigs, cows, etc., which would benefit from treatment with the formulation, kit or combined formulation.

In the present invention, a "therapeutically effective amount" generally refers to an amount which, after an appropriate period of administration, is capable of achieving the effect of treating the diseases as listed above.

The SAGE1 gene provided by the invention can be used as a target spot to be applied to tumor drugs, and the silencing of SAGE1 gene expression can obviously inhibit the proliferation and migration of tumor cells, particularly, the SAGE1 gene can obviously inhibit the proliferation and migration of tumor cells by aiming at various different types of tumor cells with positive expression of SAGE1, such as malignant melanoma A375, duodenal adenocarcinoma HUTU80, colorectal carcinoma CaCO2 and esophageal carcinoma TE 1. In addition, silencing SAGE1 gene expression can obviously inhibit the growth of human solid tumor and promote the death of tumor cells at the solid tumor part, thus indicating that the target has obvious physiological function. In addition, SAGE1 is not expressed in other normal tissues except testis and is specifically expressed in various tumor tissues, and SAGE1 protein is positioned in nucleus, but the peptide end of the protein can be specifically presented on the surface of tumor cells by MHC (major histocompatibility complex), so that the targeted recognition by using targeted therapy or the activation of an immune system is facilitated to be applied to immune targeted therapy, and therefore, the gene interference therapy aiming at SAGE1 has good specificity, the normal tissues without SAGE1 expression are not influenced, and the normal physiological function and health are not influenced. In conclusion, the SAGE1 inhibitor (i.e., a substance for inhibiting the expression and/or function of SAGE 1) has a good application prospect in the fields of biopharmaceutical industry, tumor clinical treatment and the like.

The invention of the present application is further illustrated by the following examples, which are not intended to limit the scope of the present application.

Unless otherwise indicated, the methods of testing, methods of preparation, and methods of preparation disclosed herein employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts. These techniques are well described in the literature and are described in particular in Sambrook et al, molecular CLONING: a LABORATORY MANUAL, second edition, cold Spring Harbor LABORATORY Press,1989and Third edition,2001; ausubel et al, current PROTOCOLS IN MOLECULAR BIOLOGY, john Wiley & Sons, new York,1987and periodic updates; the series METHODS IN ENZYMOLOGY, academic Press, san Diego; wolffe, CHROMATIN STRUCTURE AND FUNCTION, third edition, academic Press, san Diego,1998; METHOD IN ENZYMOLOGY, vol.304, chromatin (P.M. Wassarman and A.P. Wolffe, eds.), academic Press, san Diego,1999; and METHODS IN MOLECULAR BIOLOGY, vol.119, chromatography Protocols (P.B.Becker, ed.) Humana Press, totowa,1999, etc.

Example 1

Sequencing data of RNAseq in a human normal Tissue in a GTEX database (Genotype-Tissue Expression (GTEx) Program, http:// common fund. Nih.gov/GTEx /) are used for sequencing the TPM value to analyze the mRNA Expression quantity of SAGE1, and sequencing analysis results of 30 parts of a normal human body show that SAGE1 gene is mainly specifically and highly expressed in testis, slightly expressed in brain nerve Tissue and basically not transcribed in other human body tissues, and the figure 1A shows that the SAGE1 gene is mainly and specifically expressed in testis, slightly expressed in brain nerve Tissue and not transcribed in other human body tissues.

<xnotran> TCGA (the cancer genome atlas, https:// www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga) (pan-cancer) ( https:// www.cbioportal.org) , 26 (coad (), lihc ( ), ov ( ), ucec ( ), thca ( ), tgct ( ), skcm ( ), luad ( ), hnsc ( ), gbm ( ), prad ( ), thym (), lgg ( ), read ( ), pcpg ( ), esca ( ), kirc ( ), cesc ( ), blca ( ), kirp ( ), paad (), stad (), kich ( ), brca ( ), lusc ( ), sarc ()) 1 (laml ( )) , SAGE1 (SAGE 1 SAGE1FPKM >0,SAGE1 SAGE1FPKM = 0) , </xnotran> See fig. 1B.

Using TCGA (the cancer gene atlas, https: cancer. Gov/about-nci/organization/ccg/research/structural-genomics/TCGA) pan-cancer (pan-cancer) patient public database (download link https: analysis was performed in 25 solid tumors (coad (colon carcinoma), lihc (hepatocellular carcinoma), ov (ovarian serous cystadenocarcinoma), ucec (endometrial carcinoma), thca (thyroid carcinoma), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate carcinoma), thym (thymus carcinoma), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pc (pheochromocytoma and paraganglioma), esca (esophageal carcinoma), kirc (renal clear cell carcinoma), cec (cervical squamous cell carcinoma and adenocarcinoma), gobl (bladder urothelial carcinoma), pgrp (renal papillary cell carcinoma), paad (pancreatic carcinoma), stad (gastric carcinoma), kich (renal chromocytoma), brca (mammary infiltrating carcinoma), sarcal carcinoma (lung carcinoma), sarca (squamous cell carcinoma)) and sarc (renal squamous cell carcinoma), and acute expression of human leukemia (SAGE 1 ml) were mapped simultaneously in the amounts of acute expression in human blood and SAGE-like carcinomas, SAGE1 was shown to be expressed in higher amounts in tumor tissues than in paracarcinoma tissues, as shown in FIG. 1C.

<xnotran> TCGA (the cancer genome atlas, https:// www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga) (pan-cancer) ( https:// www.cbioportal.org) , 25 (coad (), lihc ( ), ov ( ), ucec ( ), thca ( ), skcm ( ), luad ( ), hnsc ( ), gbm ( ), prad ( ), thym (), lgg ( ), read ( ), pcpg ( ), esca ( ), kirc ( ), cesc ( ), blca ( ), kirp ( ), paad (), stad (), kich ( ), brca ( ), lusc ( ), sarc ()) 1 (laml ( )) 8979 , SAGE1 (SAGE 1 SAGE1FPKM >0,SAGE1 SAGE1FPKM = 0) (4483 ) 96 </xnotran> Shorter duration, poorer prognosis (p =1.389031 e-14), and specific results are shown in fig. 1D.

<xnotran> TCGA (the cancer genome atlas, https:// www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga) (pan-cancer) ( https:// www.cbioportal.org) , 25 (coad (), lihc ( ), ov ( ), ucec ( ), thca ( ), skcm ( ), luad ( ), hnsc ( ), gbm ( ), prad ( ), thym (), lgg ( ), read ( ), pcpg ( ), esca ( ), kirc ( ), cesc ( ), blca ( ), kirp ( ), paad (), stad (), kich ( ), brca ( ), lusc ( ), sarc ()) 1 (laml ( )) SAGE1 (SAGE 1 SAGE1FPKM >0,SAGE1 SAGE1FPKM = 0) (4483 ) SAGE1 (SAGE 1 2242 </xnotran> SAGE1 underexpression example 2241), showed short overall survival and poor prognosis in SAGE1 high expression patients within 96 months of observation (p = 1.244621E-11), and the specific results are shown in FIG. 1E.

Example 2

Immunohistochemistry on tissues using antibodies specific for SAGE1 was used as tumor immunoimaging of tissues: as shown in FIG. 2A, the normal testis, intestinal cancer, esophageal cancer, skin cancer, larynx cancer, kidney cancer and section thereof are all from the northern hospital Oncology of the ninth national Hospital of Shanghai city, and the liver cancer and lung cancer section thereof is obtained from the northern hospital Oncology PDX tumor model of the ninth national Oncology of Shanghai city.

1. Reagent: PBST buffer solution, hematoxylin staining solution, antigen renaturation agent, DAB solution, primary anti-dilution solution, SAGE1 primary Antibody (NOVUS, NBP1-84355SAGE1 Antibody rabbit anti-human), HRP labeled secondary Antibody (anti-rabbit).

2. Experimental operating procedure

1) Reagent preparation

Xylene, 100% ethanol, 95% ethanol, 75% ethanol, 50% ethanol

Inactivating the enzyme reagent: 3% of the H2O2-methanol solution, 1mL of the H2O2 solution was added to 9ml of methanol

PBST washing solution: 1000mL of Triton with pH7.4 PBS +3mL are mixed evenly

Primary anti-dilution solution: 3% BSA-PBST solution, 0.03g BSA in 1mL PBST

1% hydrochloric acid-ethanol solution: 1mL of hydrochloric acid was dissolved in 99mL of ethanol

Antigen renaturation agent ph6.0 citric acid buffer: 810mL of 0.1M citric acid solution +190mL of 0.1M trisodium citrate solution

DAB solution: ready prepared for use in the dark, consumed within 3 minutes after preparation, 85% ddH2O +5% DAB buffer (20X) +5% DAB substrate (20X) +5% DAB chromogen (20X)

2) Baking the slices: before dewaxing, the tissue paraffin sections are placed in a thermostat, and the temperature is adjusted to 60 ℃ for baking for 30 minutes.

3) Dewaxing and rehydration: respectively operate according to the following steps

Two cylinders of xylene, 10 minutes each;

two cylinders of absolute ethyl alcohol, each cylinder for 7 minutes;

1 jar with 95% alcohol for 5 minutes;

1 jar with 75% alcohol for 5 minutes;

1 jar with 50% alcohol for 5 minutes;

ddH2O for 5min, and 3 washes.

4) Antigen retrieval:

a citric acid high-temperature high-pressure repairing method: putting the citric acid repairing liquid into a high-temperature high-pressure sterilization pot in advance, covering a high-pressure pot cover, stopping heating after 5 minutes of air outlet, putting the dewaxed and rehydrated tissue slices into the preheated antigen repairing liquid, reheating the sterilization pot, closing an air release valve after 5 minutes of air outlet, starting timing 5 minutes when the temperature is increased to 121 ℃, stopping heating, slowly exhausting air when the temperature is slightly reduced to 100 ℃, and opening the sterilization pot cover to naturally cool the sterilization pot for more than 30 minutes.

5) Washing: ddH2O for 5min, and washed 2 times, PBST for 5min, and washed 2 times.

6) Inactivating the enzyme: 50 μ L of inactivated enzyme reagent was added dropwise to each section, and the sections were protected from light at room temperature for 15 minutes.

7) Washing: PBST was soaked for 5 minutes and washed 3 times.

8) And (3) sealing: each section was blocked with 50. Mu.L of PBST blocking solution containing 3% BSA at room temperature for 30 minutes in a wet box.

9) Adding a primary antibody: the blocking solution was discarded and each section was added dropwise with 50. Mu.L of sage primary antibody and incubated overnight in a wet box at 4 ℃ or for 2 hours at 37 ℃. Once sage diluted at 1.

10 Temperature recovery: after incubation overnight at 4 ℃ the next day was removed and rewarmed for 1 hour at room temperature.

11 Washing: PBST was soaked for 5 minutes and washed 3 times. (first quick pour)

12 Adding an enzyme-labeled secondary antibody: HRP-labeled secondary antibodies (anti-rabbit) were added dropwise to each section, and incubated at 37 ℃ for 30 minutes.

13 Washing: PBST was soaked for 5 minutes and washed 3 times. (first quick pour)

14 Color development (DAB method): 50 mu.L of color developing solution is dripped into each slice, and the slices are developed for 5 minutes in a wet box.

15 Terminate the color development: the color reaction was stopped with distilled water. And (5) observing whether the color development is obvious and the background is dark and light by using an inverted microscope, and photographing and storing the image.

16 Counterdyeing: 50 mu L of hematoxylin cell staining solution is dripped into each section, the section is stained for 5-10 minutes, and the section is washed clean by ddH 2O.

17 Decolorized to blue): and (3) dropwise adding 1% hydrochloric acid-ethanol into each slice in sequence, quickly adding ddH2O within 3 seconds to terminate, and then adding the slices into PBST to return blue for 5-30 minutes.

18 Sealing sheet): soaking in 75% ethanol and anhydrous ethanol for 2 min, soaking in xylene for 2 min and 2 times, dripping neutral gum on the slices, and covering with glass slide.

19 Observation): and observing the photographed images under a microscope in a color mode of 10 times and 20 times.

The experimental results of the tissues are shown in fig. 2A, and it can be seen from fig. 2A that positive expression of SAGE1 in normal testicular tissue and various tumor tissues was found by immunohistochemical staining using an antibody specific for SAGE1 (liver cancer, lung cancer derived from northern institute oncology, ninth hospital, PDX tumor section, esophageal cancer, head and neck cancer, skin cancer, kidney cancer derived from northern institute oncology section). A PDX tumor model was constructed by taking tumor tissues of nine different kinds of patients (HCC 15: primary hepatocellular carcinoma, Q003: lung adenocarcinoma, LU1030: poorly differentiated squamous carcinoma, CRC31: colon carcinoma, HCC7: primary hepatocellular carcinoma, Q003: lung squamous carcinoma, LU1062: lung adenocarcinoma, CRC1: colon carcinoma, CRC44: colon carcinoma) from the ninth national Hospital affiliated to Shanghai transportation university: PDX P0 operation step:

1) Under aseptic conditions, fresh human tumor tissue is placed in RPMI1640 cell culture medium (double antibody is added) for pruning, and necrotic tissue is removed

2) Cutting the tumor into small pieces with the diameter of about 5mm, and fully soaking the small pieces in matrigel

3) Clamping tissue block with forceps, and placing into puncture trocar

4) Disinfecting the skin of the chest and abdomen of the nude mouse with alcohol, and cutting a 3-5 mm incision at the manubrium of the chest with scissors to a depth of subcutaneous part

5) Using a puncture needle, the tumor tissue is inoculated subcutaneously near the inguinal region of the abdomen

6) Sealing wound with tissue glue, and placing back into cage box for continuous breeding

7) And (5) regularly observing, recording a growth curve, and tracing clinical information.

8) Tumors grew to the appropriate size, P0 passage.

QPCR detection of SAGE1 in 9 tumor tissues derived from the human PDX tumor model showed the presence of SAGE1 transcriptional expression in 4 of them (fig. 2B); the QPCR detection of SAGE1 was performed on paracarcinoma and tumor tissues of 60 intestinal cancer patients (FIG. 2D) by the following method:

experimental materials used in this example tumor tissues of the humanized PDX tumor model were obtained from nine oncology departments in shanghai, 60 paracarcinoma and tumor tissues of intestinal cancer patients from tianjin tumor hospital, and approved by tianjin cancer institute and ethical committee of hospital, tissues containing colorectal cancer and specimens of tissues adjacent to normal colon were taken from patients (N = 60) who underwent surgical resection after histopathological diagnosis of colorectal cancer at the institution (N = 60).

The RNA extraction Kit used was RNeasy Mini Kit (50) (QIANGEN Cat No./ID: 74104) and GOMag Blood and Tissue RNA Kit (Zhi On Bio Cat. # GO-MNTR), and the RNA reverse transcription Kit used was PrimeScript ^TM 1st strand cDNA Synthesis Kit (TaKaRa Cat. # 6110A), the Q-PCR Kit used was TB Green ^TM Premix Ex Taq ^TM II(Tli RNaseH Plus)(TaKaRa Cat.#RR820A)。

(1) RNA extraction:

RNA extraction used the following two methods:

centrifugal column method:

1) Collecting the cells (selected to 1a or 1b depending on the case)

1a) Suspension of cells: determining the number of cells (total amount not exceeding 1X 10) ⁷ ) The cells were collected by centrifugation (5 min,300 Xg) into a centrifuge tube, and all supernatant carefully aspirated and discarded, and washed twice with PBS for use.

1b) Adherent cells in monolayer (total amount not exceeding 1X10 in case of 10cm dish) ⁷ ): the cells were washed twice with PBS, PBS was discarded, 300-500. Mu.l of pancreatin (0.25%) was added, mixed well, incubated in a37 ℃ incubator (incubation times vary widely depending on cell lines, typical cell lines are such as A375 for about 3 minutes, HUTU80 for about 3-5 minutes), 1ml of 10% serum-containing medium was added to stop digestion when cells started to fall off from the dish, cells were collected in a centrifuge tube, 5min,300 Xg was centrifuged for 5 minutes, the supernatant was discarded, and washed twice with PBS for use.

2) Add 175. Mu.l of precooled (4 ℃ C.) buffer RLN to the centrifuge tubes and incubate for 5 minutes on ice.

3) Centrifuge at 4 ℃ 300 Xg for 2 minutes, transfer the supernatant to a new centrifuge tube, and discard the pellet.

4) 600 microliters of buffer RLT was added to the supernatant and mixed by vigorous vortexing.

5) 430 microliters of ethanol (96-100%) was added and blown with a gun to mix well (without centrifugation).

6) Transfer 700. Mu.l of sample (which was also transferred if any pellet was formed) to RNeasy spin column, gently cover the lid, centrifuge at 10000 Xg for 30 seconds, and discard the flow-through. This step was repeated until all samples had flowed through the spin column.

7) 700 μ l of buffer RW1 was added to RNeasy spin column, the lid was gently closed, centrifuged at 10000 Xg for 30 seconds, and the flow-through was discarded.

8) To RNeasy spin column was added 500. Mu.l of buffer RPE, the lid was gently closed, and the flow-through was discarded by centrifugation at 10000 Xg for 30 seconds.

9) To RNeasy spin column was added 500. Mu.l of buffer RPE, capped gently, and centrifuged at 10000 Xg for 2 minutes.

10 RNeasy spin column was transferred to a clean 2ml collection tube, the original tube was discarded and centrifuged at maximum speed for 1 minute.

11 The collection tube was discarded, the RNeasy spin column was transferred to a new 1.5ml collection tube, 30-50. Mu.l of RNase-free water was added thereto, the cap was gently closed, and centrifugation was carried out at 10000 Xg for 1 minute to elute the RNA from the column.

Magnetic bead method:

sample preparation:

a. blood sample: mu.l of fresh whole blood or white membrane is taken, 350. Mu.l of lysis solution Lr is added, and the mixture is evenly mixed for 2 minutes by vortex oscillation.

b. Animal tissue: about 10mg of animal tissue is taken and added with 400. Mu.l of lysis solution Lr, and the tissue is fully ground or homogenized.

1) The samples prepared according to the "sample preparation" procedure were incubated at room temperature for 10 minutes, during which time they were vortexed 1-2 times for 1 minute each.

2) And (3) after the incubation is finished, performing instantaneous centrifugation, then adding 510 mu l of absolute ethyl alcohol and 60 mu l of magnetic beads, uniformly mixing by vortex oscillation, standing at room temperature for 5 minutes, wherein the mixture can be subjected to vortex oscillation for 1-2 times, and each oscillation time is 1 minute. After room temperature adsorption, vortex oscillation and uniform mixing are carried out, the centrifugal tube is placed on a magnetic frame, and magnetic attraction is carried out for 1 minute or the solution is clarified. Carefully discard the liquid in the centrifuge tube completely, taking care not to touch the magnetic beads.

3) Adding 750 mu l of cleaning solution DW added with beta-ME, covering a centrifuge tube cap, carrying out vortex oscillation and uniform mixing for 1 minute, putting the centrifuge tube cap back on a magnetic frame, repeatedly reversing the magnetic frame under the condition that the centrifuge tube does not leave the magnetic frame, cleaning the centrifuge tube cap (preventing residual lysate on the tube cap from influencing subsequent experiments), and carrying out magnetic attraction for 1 minute or until the solution is clarified. The liquid in the tube cap is sucked away first and then all the liquid is sucked away.

4) 850. Mu.l of washing solution DW to which β -ME has been added was added, and washed 1 time in accordance with the method of step 3.

5) Add 850. Mu.l 80% ETr, and wash 1 time according to the method of step 3).

6) Adding 1-5 mul DNase and 55 mul solution DB, fully and evenly mixing, standing for 10 minutes at room temperature, and evenly mixing for 2 times by vortex oscillation during the period.

7) After the DNA digestion is finished, vortex oscillation is carried out to mix the DNA evenly, the centrifugal tube is placed on a magnetic frame, and the DNA is magnetically absorbed for 1 minute or the solution is clarified. Care was taken to completely aspirate the liquid from the centrifuge tube, taking care not to touch the beads.

8) Adding 850 μ l of 80% ETr, and washing 1 time according to the method of step 3).

9) And (4) placing the centrifugal tube on a magnetic frame, and opening a cover to dry for 5-10 minutes at room temperature.

10 50 μ l of the eluent DE was added, mixed well by vortexing and eluted at room temperature for 5 minutes. And (3) uniformly mixing the magnetic beads by vortex oscillation again, magnetically sucking the magnetic beads on a magnetic frame for 1 minute, and then sucking the supernatant, or performing a downstream experiment, or storing the supernatant at-80 ℃ for later use, wherein the repeated freeze thawing of the purified RNA is avoided.

(2) Reverse transcription of RNA

1) A mixture of the following systems was prepared in a PCR tube:

TABLE 1

2) The sample was heated at 65 ℃ for 5 minutes and then immediately placed on ice to cool.

3) 20 microliter of reaction liquid is prepared, and the specific system of the reaction liquid is as follows:

TABLE 2

The mixed liquid of the step 1	10 microliter
		5X PrimeScript Buffer	4 microliter
RNase Inhibitor
		20 units of
PrimeScript RT			100 to 200 units
	RNase-free ddH ₂ O	Make up to 20. Mu.l

4) And (5) mixing the mixture gently.

5) The reaction was carried out according to the reaction conditions shown below:

TABLE 3

42 degree	30-60 minutes
		70 degree	15 minutes

After the reaction, the mixture was placed on ice for further use.

(3)RT-PCR

The process is carried out using a LightCycler/LightCycler 480 System.

The sequence of the primer is positive primer Sage-F: GGAAGAGTATGTCCTCGTGTT (SEQ ID NO. 23), reverse primer Sage-R: GCATCAGGCCATGGTGGGGAG (SEQ ID NO. 24).

Internal control GAPDH forward primer GAPDH-F ATCATCCTGCCTCTACTGG (SEQ ID NO. 25), reverse primer GAPDH-R GTCAGGTCCACCATGACAC (SEQ ID NO. 26).

1) Preparing a PCR mixed solution, wherein the mixed solution system is as follows:

TABLE 4

2) Setting a machine program:

TABLE 5

After the experiment, data were derived and analyzed, and the specific results are shown in fig. 2B (HCC 15: primary hepatocellular carcinoma, Q003: lung adenocarcinoma, LU1030: poorly differentiated squamous carcinoma, CRC31: colon cancer, HCC7: primary hepatocellular carcinoma, Q003: lung squamous carcinoma, LU1062: lung adenocarcinoma, CRC1: colon cancer, CRC44: colon cancer), SAGE1 was positively expressed in some tumors (HCC 15, Q003, LU1030, CRC 31) and negatively expressed in some tumors.

As shown in FIG. 2D, in 60 cases of intestinal cancer, the expression level of SAGE1 mRNA in tumor tissue was higher in 48 patients than in the paracarcinoma tissue, further confirming that SAGE1 is specifically expressed in tumor tissue.

To determine the pathological significance of SAGE1 expression on CRC progression, the correlation between SAGE1 expression and CRC (intestinal cancer) prognostic factors was further evaluated. Statistical analysis the t-test of the paired data was used to compare the mean, the analysis of variance was used to test two sets of data with continuous variables, and the classified data was analyzed using the FisherExact or χ 2 test, statistical analysis using the SPSS software program (version 21.0, ibm corporation). Results PCR experiment detects the expression of SAGE1 in human colorectal cancer and paracarcinoma normal colon tissues, and the expression of SAGE1 in colorectal cancer tissues is obviously higher than that of normal tissues (P)<0.001 (FIG. 2D). To determine the pathological significance of SAGE1 expression in CRC progression, the correlation between SAGE1 expression and CRC prognostic factors was further evaluated (results are shown in fig. 2E). In CRC patients, no correlation was found between SAGE1 expression and gender, histological grade and tumor size. However, in the colon cancer specimen, SAGE1 expression was positively correlated with lymph node metastasis (χ) ² ＝9.586,P<0.01,r＝0.421)。

Detecting whether SAGE1 is positively expressed in tumor cells by using an antibody aiming at SAGE 1:

1) Preparation of samples: rinsing 10cm dish cells twice with PBS, sucking up residual PBS liquid as much as possible, adding 300-400 μ l of 1 xSDS protein lysate per dish, gently scraping the cells with a cell curette, collecting the cells into a 1.5ml EP tube, and after the cells are fully lysed, blowing the viscous substance up and down with a 1ml syringe until the lysate becomes a hanging drop; (for tissue samples, we have previously treated by adding liquid nitrogen, grinding to powder, adding SDS protein lysate, and the same applies thereafter)

1 xSDS protein lysate formula: 50mM Tris-HCl (pH 6.8)

2% SDS electrophoresis grade

10% of glycerol;

2) Quantifying BCA (standard curve) protein, and calculating the concentration of a sample to be detected;

3) Protein denaturation: adding the protein sample into beta-mercaptoethanol, and boiling in a water bath kettle at 98 ℃ for 10min to denature the protein;

4) Electrophoresis: the sample loading amount is 80ug;

5) Electric conversion: soaking the PVDF membrane in methanol, ddH2O and membrane conversion buffer solution in sequence, performing bio-rad semi-dry conversion to 20V, and performing 30min;

preparation of electrotransfer buffer solution

Weighing 2.9g of glycine, 5.8g of Tris alkali and 0.37g of SDS, adding deionized water until the total amount is 700ml, fully and uniformly mixing, then adding 200ml of methanol, and finally fixing the volume to 1L;

6) Immune response and result display;

a) Soaking the PVDF membrane in prepared 5% skimmed milk, and sealing overnight at 4 deg.C;

b) Primary antibody incubation: SAGE1 antibody (Novus: NBP 1-84355) was diluted 1/500, and the PVDF membrane was immersed in the diluted primary antibody and gently shaken overnight at 4 ℃;

c) Taking out the PVDF membrane, and washing the PVDF membrane with TBST for 3 times, 10min each time;

d) HRP-linked secondary antibodies (goat anti-mouse or goat anti-rabbit 1:3000 Soaking the PVDF membrane in the diluted second antibody, and gently shaking for 1 hour at room temperature;

e) Washing the membrane with TBST for 3 times, each time for 10min;

f) Chemiluminescence and color development.

The results of the detection of general cell lines LO2, 293T, K562, hutu80, and U2OS are shown in fig. 2C, and it can be seen from fig. 2C that WB detection of antibodies specific to SAGE1 against normal hepatocyte LO2, normal human renal epithelial cell line 293T, human myeloid leukemia cell K562, human osteosarcoma cell U2OS, and human duodenal adenocarcinoma cell line Hutu80, respectively, revealed that SAGE1 expression was not detected in normal cell LO2 and 293T, and SAGE1 was specifically expressed only in some tumor cell lines, such as K562, U2OS, and Hutu80.

Example 3

A lentivirus-knocked-down cell line or a Cas9 knockout cell line aiming at SAGE1 is screened from three different tumor cell lines respectively, and compared with wild-type cells, cell proliferation experiments are carried out, so that SAGE1 is proved to have a crucial effect on tumor cell proliferation (FIG. 3A, FIG. 3B and FIG. 3C).

Lentiviruses carry foreign genes introduced into A375 (malignant melanoma cell line) and CaCO2 (large intestine adenocarcinoma cell line) cell lines.

1. Preparation of Lentivirus (Lentivirus) carrying exogenous Gene of interest or shRNA

SAGE 1shRNA interference lentiviral vector plasmid, the patent provides 9 target sequences which are screened from a high-throughput commercial library and can efficiently knock down SAGE1 expression, and the sequences are respectively shown in Table 6, wherein SEQ ID NO. 1-9 are target sequences, SEQ ID NO. 10-18 are polynucleotide sequences of shRNA aiming at the target sequences:

TABLE 6

Lentiviral packaging A MISSION Lentiviral packaging mixture from Sigma (cat # SHP 001) was used, and the actual target protocols used in the examples were sh-1 and sh-2 in Table 6.

1) Cells HEK-293T cultured and passaged packaging lentivirus: at 3-5x10 ⁶ cells/10cm culture dish density passage, 24 hours later, when the cell adherence rate reaches 60-80%, then transfection is carried out.

2) 26ul of lentiviral packaging mixture and 2.6 ug of lentiviral expression plasmid were added to 500ul of Opti-MEM and mixed well, 16ul of X-treme transfection reagent was added and mixed well, and left at room temperature for 15 minutes. Taking out HEK-293T cells from a37 ℃ incubator, uniformly dripping the mixed solution of the plasmids and the transfection reagent into the culture solution of the HEK-293T by using a 1ml pipette, slightly mixing the culture solution while dripping in a circle shape, and finally slightly shaking the culture solution back and forth to uniformly distribute the transfection solution.

3) Taking out HEK-293T cells from a37 ℃ incubator, uniformly dripping the mixed solution of the plasmids and the transfection reagent into the culture solution of the HEK-293T by using a 1ml pipette, slightly mixing the culture solution while dripping in a circle shape, and finally slightly shaking the culture solution back and forth to uniformly distribute the transfection solution.

4) After the incubator is placed at 37 ℃ for 5-6 hours, taking out HEK-293T cells, discarding the culture medium containing the transfection solution, carefully adding 8-10ml of fresh culture medium (without adding liquid opposite to the cells to avoid flushing the cells), and continuously placing the incubator at 37 ℃ for culture;

2. collection of supernatant of Lentivirus virus

48 hours after transfection, the medium containing the Lentivirus supernatant was collected using a 10ml syringe and cultured by adding 8-10ml of fresh medium to a HEK-293T dish. Filtering the virus supernatant by a 0.45-micron filter, marking the filtered virus supernatant, and storing the virus supernatant in a refrigerator at 4 ℃; lentivirus supernatant was collected 72 hours after transfection (retrovirus was collected every 24 hours) and was stopped if cells coiled into clumps to begin apoptosis.

3. Lentivirus virus supernatant infects target cells

At 2.5x10 ⁵ Carrying out density passage on cells to be infected in a culture dish of 6cm, taking out filtered virus supernatant in a refrigerator at 4 ℃ after 24 hours, sucking a proper amount of virus liquid into a culture medium of the cells to be infected, and culturing in an incubator at 37 ℃. After 24 hours, the virus solution was replaced with fresh one and cells were infected continuously. And (5) placing the residual virus supernatant in a refrigerator at the temperature of-80 ℃, and subpackaging and storing.

4. Positive selection after infection of cells by Lentivirus

And (3) adding Puromycin into the virus carrying the gene expressing the antibiotic for screening positive clones for 5-7 days 24-48 hours after the infection is finished.

5. Identification of Stable cell lines

And collecting the total protein of the cells infected by the virus and screened, and carrying out western blot to detect the expression condition of the transcription and translation levels of the target gene in the cells so as to identify the establishment of a stable cell strain for over-expressing the exogenous gene or shRNA to silence the endogenous gene.

Western detection:

1) Performing SDS electrophoresis, washing the gel by using a transfer buffer after running, washing the gel for 5min by using a shaker, twice, and wetting the filter paper by using the transfer buffer;

2) Activating the PVDF membrane by using ethanol, then transferring the membrane, arranging filter paper, the PVDF membrane, glue and the filter paper from bottom to top, and driving out bubbles in the PVDF membrane, the glue and the filter paper by using a roller, wherein the membrane transferring time is 7-9 minutes;

3) The PVDF membrane was blocked with 5% skim milk for one hour at room temperature on shaker, the interesting part on the PVDF membrane was cut into small strips, int3 (rabbit, novus, NBP 1-19091) was added as a primary antibody (2ul, 1 2000 in 4mL milk) and incubated for one hour at room temperature;

4) The milk containing the primary antibody was decanted, washed 5 times with TBST solution for 5min, secondary antibody (goat anti-rabbit, 0.6ul in 3mL TBST, 1;

5) Wash 5 times 5min with TBST solution, pour off all TBST solution and develop with ECL.

Construction of HUTU80 (duodenal adenocarcinoma) CRISPR Stable knockout SAGE1 cell lines KO-1 and KO-2 1.SgRNA design

Selecting the high specificity site of the exon region as the target site, analyzing the sequence by bioinformatics, and scoring the screened site. The 2 highest scoring sites were selected as target sites and 2 sgRNA sequences were designed to be cloned into the Px330 vector plasmid (purchased from addrene).

Hum SAGE1 sg1-Up：ACCGaaggaagagtatgtcctcg(SEQ ID NO.19)

Hum SAGE1 sg1-D：AAACCGAGGACATACTCTTCCTT(SEQ ID NO.20)

Hum SAGE1 sg2-Up：ACCGaagtaaatctggttgcaac(SEQ ID NO.21)

Hum SAGE1 sg2-D：AAACGTTGCAACCAGATTTACTT(SEQ ID NO.22)

2. Transfection and cell pool establishment/sequencing validation

The transfection reagent is preheated at 37 ℃ for 10-20 min. The DNA-transfection reagent mixture was added to hutu80 cells (step as described above) and incubated in an incubator. Culturing for 2-3 days after transfection, diluting, centrifuging more than 1000 transfected cells, removing supernatant, extracting DNA and detecting by PCR. And (3) purifying the target gene, sequencing, comparing the detected sequence with the original sequence, and confirming that the gene is knocked out.

3. Monoclonal screening and sequencing validation

And (4) waiting for the cells to grow to a certain number, digesting the cells, and counting the cells. The cells were diluted and 100. Mu.l of the cell dilution was seeded in a 96-well plate. And (3) continuously adding medicine for screening after the cells adhere to the wall, screening positive clones by using a mutation detection kit when the confluence degree of the cells reaches over 70 percent, carrying out sequencing analysis on the screened positive clones, comparing sequencing results, and analyzing the gene knockout condition. And (4) selecting positive gene knockout clones, transferring the positive gene knockout clones to 48-well plates, 24-well plates, 12-well plates and 6-well plates in sequence, and carrying out amplification culture.

4. Identification of Stable cell lines

The total protein of the screened monoclonal cells is collected, and western blot is carried out to detect the expression condition of the target gene in the cells so as to identify the establishment of stable cell strains which over-express exogenous genes or shRNA silence endogenous genes (the method is as described above).

Cell proliferation experiments were performed using the RTCA xcelligene system:

1. preparing a cell suspension:

1) And (4) sucking the old culture solution in the culture dish in a clean bench under aseptic conditions.

2) After washing with PBS 1-2 times, 1mL (T75 flask) of EDTA-containing trypsin solution was added to the petri dish. Covering a cover, placing in a37 ℃ incubator for incubation for 2-6min, observing the digestion condition of the cells under an inverted microscope, and stopping digestion if cytoplasm retracts and the cells intermittently enlarge.

3) Gently removing the digestive juice, adding 10mL of culture medium into a culture bottle, and gently blowing the adherent cells by using a pipette repeatedly to form a cell suspension. The cell suspension was transferred to a 50mL centrifuge tube, centrifuged at 1000x rpm for 5min, the supernatant removed, fresh medium added, and the cells pipetted evenly. And counting the concentration of the cell suspension by using a counting plate, and preparing the cell suspension into the cell concentration required by the experiment.

E-Plate 96 preparation:

1) 50. Mu.l of the medium was added to the wells of E-Plate 96.

2) The E-Plate 96 is placed on the RTCA Station.

3) The RTCA system will automatically Scan ("Scan Plate") - > check if the contact is good (Connection OK is shown on the "Message" page).

4) Initial baseline detection (Background) determines that the selected wells are in normal contact and that the Cell Index for all wells is below 0,063.

5) The E-Plate 96 was removed and 100. Mu.l of the well-mixed A549 cell suspension was added to each well so that the number of cells per well was 2500 cells/100. Mu.l. After addition of the cells to E-Plate 96, there is no need to mix the cells with the original medium in the wells.

6) The E-Plate 96 was placed in a clean bench at room temperature for 30min.

7) E-Plate 96 was placed on the RTCA Station in the incubator.

8) After the system automatically scans the "Scan Plate", step2 (detection of the cell proliferation curve for 120 hours) was started.

3. Experiment Layout and data analysis

The RTCA xcelligene system automatically reads Cell indexes (CI values), calculates relative absorbance values of cells based on the CI value of each group of cells on the first day, plots the relative absorbance values of each group of cells against culture time, and plots Cell growth curves (fig. 3A, 3B, and 3C, where PLKO represents a blank control, i.e., wild-type cells a375, hutu80, caco2 cells were subjected to a control test using empty control plasmids without shRNA sequences). Proliferation experiment results show that SAGE1 knock-down or knockout significantly inhibits tumor cell proliferation in different tumor cell lines.

HUTU80-KO1 reverted SAGE1 cell sorting and soft agar colony formation experiments (as shown in FIG. 3D):

HUTU 80-reply SAGE cell sorting:

1. packaging lentivirus by using a 293T cell line, passaging 293T cells to 10cm dish in advance, and preparing for lentivirus packaging when the 293T cells are cultured to the density of about 50% in the 10cm dish;

2. to a 1.5mL EP tube containing 800. Mu.l of Opti-MEM medium (gibco), 8ug of the target plasmid PCDH-GFP-SAGE1 (with the PCDH-GFP plasmid ligated to the SAGE1 gene codon-optimized in Kinsley, nanjing), or PCDH-GFP (purchased from addge, the full name pCDH1-MCS2-EF 1-copGFP) was mixed with the lentiviral packaging mixture, and 10uL of a Transfection Reagent (X-tremeGENE HP DNA Transfection Reagent, roche) was added thereto. Incubating at room temperature for 15-30 minutes, dropwise adding all the liquid in an EP tube into 10cm dish, uniformly mixing, putting into a 37-DEG carbon dioxide incubator for culturing for 6-8 hours, changing the liquid, and continuously culturing for 36-72 hours;

3. sucking out all liquid in 10cm dish by using an injector, filtering by using a 0.45 micron filter membrane, collecting a virus-containing culture medium, and storing for one week at 4 ℃ or subpackaging and freezing at-80 ℃ for later use;

4. culturing a cell line HUTU80-KO-1/CaCo2 needing virus infection in a 6-well plate until the density is 30-50%, sucking out all culture media, adding 1ml of fresh culture media and 1ml of virus-containing culture media, adding polybrene to enable the final concentration to be 10-20 micrograms/ml, mixing uniformly, putting into a 37-DEG carbon dioxide culture box for culturing, changing the culture solution after 12-24 hours, observing fluorescence under a fluorescence microscope after 36-72 hours, and judging the cell infection condition;

5. adherent cells were lysed from 6-well plates using 0.25% trypsin, trypsinized by centrifugation, 1ml of 1% penillin/Streptomycin Solution (gibco) containing medium was added, cell sorting was performed using a BD infilux flow cytometer to obtain a cell line with GFP expression, PBS was removed by centrifugation, resuspended in 1ml of fresh medium, and transferred to a new six-well plate for culture, and the cultured cells were used for cryopreservation and subsequent experiments.

Soft agar colony formation assay

1) 1.2% and 0.7% agarose were prepared, autoclaved and placed in a 55 ℃ water bath to keep it molten.

2) 20% of FBS and 2X of antibiotic in 2X RPMI1640 medium were added, and the mixture was preheated at 37 ℃.

3) Pouring lower layer glue: 1.2% agarose gel was mixed with 2 × Medium 1, added to 6-well plates, 3ml per well, and left at room temperature until it solidified.

4) While waiting for the lower gel to solidify, HUTU80+ PCDH-GFP, HUTU80-KO1+ PCDHGFP and HUTU80-KO1+ PCDH-GFP-SAGE1 cells were separately digested (cell line construction method described above), counted, and adjusted to a concentration of 5X10 with serum-free medium ⁴ Perml, 100. Mu.l of cells per well, 3 parallel wells.

5) Pouring the upper glue after the lower glue is solidified: 0.7% agarose gel was mixed with 2 × Medium 1 (temperature about 40 ℃), 100 μ l of cell suspension, i.e., 5000 cells, was added, mixed well, and added to a well plate at 3ml per well.

6)37℃5％CO ₂ Culture, harvest cells for about 2-3 weeks, stain with 0.1% crystal violet, count and compare 3 groups of clones formed. As shown in fig. 3D results, knockout of SAGE1 significantly inhibited anchorage-independent growth of HUTU80 tumor cells, while reverting to SAGE1 expression significantly restored tumor cell growth.

Nude mice duodenal cancer (HUTU 80, FIG. 3E) and colorectal cancer (CaCO 2, FIG. 3F) transplantation tumor experiments prove the importance of SAGE1 expression on the growth of xenograft tumors, and prove that SAGE1 knockdown can significantly inhibit the growth of xenograft tumors and SAGE1 overexpression can significantly promote the growth of xenograft tumors.

1) Cell culture before inoculation: the cells to be inoculated are expanded (the cells expressing the foreign gene are prepared as described above):

hutu80 group: hutu80-KO1 (i.e., the CRISPR-stable knockout SAGE1 cell line KO-1 in this example), hutu80-KO1-SAGE1 (i.e., the cell line reverting to wild-type SAGE1 expression in example 9);

caco2 group: caco2 (i.e., the lentiviral knockdown Caco2 cell line for SAGE1 in this example, targeting sh-1 for SAGE), caco2-SAGE1 (i.e., the cell line in Caco-sh-1 that reverts to wild-type SAGE1 expression);

the cells in the logarithmic growth phase were digested, counted, resuspended in 1XPBS and adjusted to a final concentration of 1X10 ⁸ The cells were placed on ice for inoculation into nude mice.

2) Subcutaneous inoculation: operating in sterile environment, fully resuspending and mixing the cells, and injectingThe dosage is 100. Mu.l/cell, i.e. 1X10 ⁷ Cell/cell. The same nude mice were inoculated subcutaneously in the anterior axilla, 6 nude mice per group.

3) Observing the tumor formation condition of the nude mice: the date of the tumor appearance of each nude mouse was recorded by observation, and once the tumor formation was found, the size of the tumor was measured every other day with a vernier caliper to observe the nude mice for the presence or absence of cachexia.

4) Sacrifice of nude mice and isolation treatment of tumor: after 23 days, all nude mice were sacrificed by cervical spondylolysis, pathologically dissected, tumors from each nude mouse were completely isolated, weighed, recorded and photographed. Tumors were soaked in formalin and fixed overnight.

Example 4

Tumor body injection treatment is carried out on SAGE 1-positive liver cancer tumor PDX model (HCC 15, figure 4A), SAGE 1-positive poorly differentiated non-small cell epithelial derived lung cancer PDX tumor model (Lu 1030, figure 4B) and SAGE 1-negative liver cancer tumor PDX model (HCC 7, figure 4C) by using adenovirus shRNA specifically aiming at SAGE1 gene knock-down. The results show that the injection of shRNA adenovirus aiming at SAGE1 has strong treatment effect of inhibiting the growth of the tumor aiming at SAGE1 positive tumor, the injection of shRNA adenovirus aiming at SAGE1 has no treatment effect of inhibiting the growth of the tumor aiming at SAGE1 negative tumor, and SAGE1 is a treatment target with strong specificity.

The consumables used were as follows: RPMI1640 cell culture medium (GBICO), penicillin + streptomycin 100 × (GBICO), PBS (HYCLONE), SAGE-1 monoclonal antibody, ki67 monoclonal antibody, BALB/C nude mouse, male, 4-6 weeks old.

PDX operation steps:

1) The tumors were stripped from the nude mice under sterile conditions, washed in PBS

2) Transferring the tumor to RPMI1640 cell culture medium (adding double antibody), and removing envelope, blood vessel and necrotic tissue

3) Shearing the tumor into small pieces with diameter of about 3mm, transferring into new RPMI1640 cell culture medium (adding double antibody)

4) Clamping the small tissue blocks with forceps, and placing into a puncture trocar

5) Disinfecting the skin of the chest and abdomen of the nude mouse with alcohol, and cutting a 3-5 mm incision at the manubrium of the chest with scissors to a depth of subcutaneous part

6) Using a puncture needle, the tumor tissue is inoculated subcutaneously near the inguinal region of the abdomen by entering from the incision

7) Sealing wound with tissue glue, and placing back into cage box for continuous breeding

8) Observing every other day until the tumor grows to about 5mm in diameter, and giving treatment

9) Control adenovirus and SAGE-1shRNA adenovirus (control adenovirus and SAGE-1shRNA adenovirus produced by Shanghai and Yuan organisms using adenovirus-producing packaging vector, see Table 6 for SAGE1 sequence) were diluted in PBS, 5X 108CFU/100ul, injected in tumor, and injected once every 1-2 days

10 Tumor volume was measured every 2 days using vernier calipers and the experiment was terminated by the time tumor growth reached the ethical end point (maximum diameter =1.5 cm)

11 ) sacrifice nude mice by applying the marrow-breaking method, peeling the tumor from the nude mice under the skin, photographing and weighing

12 A portion of the tissue was fixed in formalin and a portion of the tissue was snap frozen in liquid nitrogen for subsequent analysis.

The IHC operation steps are as follows:

1) Paraffin embedding, anti-dropping film making, 4um slice thickness

2) Baking the slices in a thermostat at 60 ℃ for 30 minutes

3) Dewaxing and hydrating: 1) Soaking the slices in xylene for 10 minutes, and then soaking for 10 minutes after replacing the xylene; 2) Soaking in absolute ethyl alcohol for 5 minutes; 3) Soaking in 95% ethanol for 5min; 4) Soaking in 70% ethanol for 5min

4) Washing with PBS for 5 minutes for 2-3 times; 3% by weight of H2O2 (80% methanol) was added dropwise to TMA, and the mixture was allowed to stand at room temperature for 10 minutes; PBS wash 2-3 times each for 5 minutes

5) Sodium citrate antigen retrieval

6) Immunohistochemical staining: washing with PBS for 5 minutes for 2-3 times; normal goat serum blocking solution is added dropwise, and the temperature is 20 minutes. And throwing off the redundant liquid. Dripping 50 mul of primary antibody at 4 ℃ overnight; rewarming at 37 ℃ for 45 minutes

7) PBS wash 3 times for 5 minutes each

8) Dripping 40-50 mul of second antibody for 1 hour at 37 DEG C

9) PBS wash 3 times for 5 minutes each

10 ) DAB development for 5 to 10 minutes

11 PBS or tap water for 10 minutes

12 Hematoxylin counterstain for 2 min, differentiation with hydrochloric alcohol

13 ) tap water washing for 10-15 minutes

14 Dehydrating, transparentizing, mounting, microscopic examination, and taking a picture.

Example 5

Specific Antibody co-immunoprecipitation experiments against SAGE1 were performed in HUTU80 (duodenal adenocarcinoma), U2OS (osteosarcoma), K562 (chronic myelogenous leukemia cell), KYSE30 (human esophageal squamous carcinoma cell) which specifically expresses SAGE1, and SAGE1 was found to specifically bind to INTS3 protein intratumorally by silver-stained gel analysis and mass spectrometric identification (INIP and hssb1/2 which closely bind to INTS3 were identified by mass spectrometry at the same time), and the specific results of silver-stained gel analysis are shown in FIG. 5A, wherein IP-Rb-IgG represents that an endogenous co-immunoprecipitation experiment was performed with an IgG rabbit Antibody having no specific affinity as a control, IP-SAGE1 represents that an endogenous co-immunoprecipitation experiment was performed with a rabbit Antibody (novus, NBP1-84355SAGE1 Antibody) which specifically binds to SAGE1 as a sample group, and the identification results are shown in FIG. 5B, wherein control is IgG, and each tumor cell line has three replicates. The results demonstrate that SAGE1 and INTS3 have specific endogenous interactions in all experimental group samples. Further IP-WB was performed with antibodies specific for SAGE1 and INTS3, respectively, and the presence of interaction between SAGE1 and INTS3 was verified (fig. 5C).

Endogenous IP (human renal epithelial cell line) was performed for the INTS3 protein in 293T cells without normal SAGE1 expression, the specific experimental procedure is as described above, and the results show that in cell lines without the normal SAGE1 present, INTS3 binds to INTS6 and other INTS proteins, present in the integrator complex in agreement with previous scientific article reports (fig. 5F). Taken together, the above results indicate that in SAGE 1-negative cells, INTS3 binds to INTS6 to form an integrator complex, and that the SAGE1-INTS3 complex is absent. And when SAGE1 is expressed, INTS3 is combined with SAGE1 to form INTS3-SAGE1 complex in the positive cells.

1) Washing HUTU80/293T cells collected from 10cm dish with PBS for 2 times, adding 0.5mL IP lysine buffer, crushing on a non-contact ultrasonic crusher for 25 cycles, performing ultrasonic treatment for 5s, stopping for 5s, and setting the power mode to be High;

IP lysis buffer：

20mM Tris.HCl(pH 7.4)

150mM NaCl

10％Glycerol

0.5％TritonX-100

1mM EDTA

1mM EGTA

2) Placing the crushed liquid after ultrasonic treatment into a freezing table type centrifuge, centrifuging for 15min at 14000rpm, taking supernatant after centrifugation, and removing precipitate;

3) The supernatant was divided into two EP tubes, each 250uL, and 5uL of sage1 rabbit antibody (NOVUS, NBP-84355,0.5 mg/mL) and 2uL of igg rabbit antibody (1.4 mg/mL) were added to the supernatant separately and placed in a 4-degree suspension overnight;

4) Respectively adding 10-20uL of protein G beads balanced by using an IP lysine buffer into the two tubes, placing the mixture in suspension at 4 ℃ for 1 hour, taking out the mixture, placing the EP tube on a magnetic frame, standing the mixture for about 30 seconds, carefully sucking out the supernatant by using a 1mL gun head after the beads are all adsorbed on the wall of the EP tube, adding 1mL buffer again, placing the mixture in a 4-degree suspension instrument for suspension for 5 minutes, and repeating the process for 3 times;

all supernatants were blotted dry, 60uL of Elute buffer (0.2M Glycine,0.1 NP40, pH 2.2) was added to each tube, placed on ice and left to stand for 10min before aspirating the supernatant, which was added to an EP tube containing 20uL of Tris buffer (1M TRIS pH 8.0), flushed with a gun, 10-20uL was taken for silver staining gel identification, 10uL was taken for WB detection of SAGE1 and INTS3, and the rest was sent to mass spectrometry identification.

Endogenous IP-WB was also performed in several of the above tumor cell lines with antibodies specific for INTS3 (Novus, NBP1-19091, INTS3 Antibody), confirming that SAGE1 functions specifically to INTS3 intracellularly (FIG. 5C).

Specific experiments for WB detection of endogenous IP samples:

and (3) Western detection:

3) Sealing the PVDF membrane with 5% skim milk, sealing on shaker for one hour at room temperature, cutting the interesting part on the PVDF membrane into small strips, adding int3 (rabbit) as a primary antibody (2uL, 1 2000 in 4mL milk), and incubating for one hour at room temperature;

Example 6

Using CLUSTALW software (https:// www. Genome. Jp/tools-bin/CLUSTALW) to align the protein sequences of SAGE1 and INTS6, it was found that the C-terminus of INTS6 (790-887 aa) was highly identical in amino acid sequence to the C-terminus of SAGE1 (817-904 aa) (FIG. 5G), suggesting that the C-terminus of SAGE1 and the C-terminus of INTS6 may have the same function. Since both SAGE1 and INTS6 are capable of binding to INTS3, the C-termini of both proteins are thought to be responsible for binding to INTS3.

This was further confirmed by in vitro protein complex co-purification experiments.

The in vitro purified SAGE1-INTS3 complex protein confirms the existence of the brand-new complex SAGE1-INTS3 (FIG. 5D), the in vitro expression purified INTS6-INTS3 complex verifies that INTS3 can also interact with INTS6 (FIG. 5E).

1) Plasmid construction: two strategies are adopted for constructing the compound co-expression plasmid, and genes of int 3-C (access: Q68E01.1, 572-978 aa) and SAGE1 (access: Q9NXZ1.2, 817-904 aa)/INTS 6 (access: Q9UL03.1, 790-887 aa) can be respectively constructed into a pET28a vector (kana) and a pGEX6p1 vector for co-expression and purification.

2) Initial seed culture: positive clones were picked up in 10mL of liquid LB medium containing Amp antibiotics and cultured overnight with shaking at 37 ℃.

3) And (3) amplification culture: inoculating the initial seed into 1L liquid culture medium containing antibiotics, performing shake culture at 37 deg.C until the bacterial concentration OD600 is 0.6-0.8, and cooling to 15 deg.C or 20 deg.C; one hour later, IPTG was added to a final concentration of 0.6mM and expression was induced overnight.

4) And (3) collecting thalli: centrifuging at 4200rpm at 4 deg.C for 15min, discarding supernatant, and collecting thallus; adding a heavy suspension solution (25 mM Tris-HCl pH8.0, 100mM NaCl) to suspend the somatic cells; the protease inhibitor PMSF (phenyl sulfonyl fluoride, benzoate sulfonyl fluoride) was added to a final concentration of 2mM before cell disruption.

5) And (3) carrying out ultrasonic cell disruption: at 400W, the ultrasonic wave is carried out for 3s at an interval of 6s, and the work is carried out for 60 times.

6) Ultracentrifugation: the cell lysate is centrifuged at 14000rpm and 4 ℃ for 50min, and the supernatant is collected and subjected to the next separation and purification.

7) Ni-NTA affinity chromatography: the supernatant was poured into a Ni-NTA column. After washing, 10 column volumes were washed with wash buffer (25 mM Tris-HCl pH8.0, 100mM NaCl,15mM imidazole) to remove contaminating proteins; finally, the target protein was eluted using an elution buffer (25 mM Tris-HCl pH8.0, 100mM NaCl,250mM imidazole). The solubility of the protein, the efficiency of the hanging column and the concentration of the protein were examined by SDS-PAGE. In order to obtain purer and non-labeled protein, after the wash buffer is used for washing and removing the foreign protein, 5ml of resuspension buffer is added into each nickel column, then 100-200 mu L of PPase is added, after 3-5h, the columns are re-washed by 5ml, and the enzyme digestion efficiency is detected by electrophoresis.

8) And (3) anion exchange chromatography purification: first, the ion exchange column is equilibrated. The protein eluted in the previous step was then diluted 4-6 fold with solution A (25 mM Tris-HCl, pH 8.0), applied to ion exchange column Source Q and eluted using a linear gradient of solution A with solution B (25 mM Tris-HCl, pH8.0,1M NaCl). The collection tubes were collected near each peak position (absorbance at 280 nm). And performing SDS-PAGE electrophoresis to detect the peak position, purity and concentration of the target protein.

9) And (3) ultrafiltration concentration: the eluate containing the target protein was concentrated to 2ml with an ultrafiltration cup.

10 Molecular sieve column chromatography purification: the sample was injected onto a gel filtration chromatography column Superdex 200, which had been equilibrated with solution C (10 mM Tris-HCl, pH8.0, 100mM NaCl). Elution was performed with solution C. The location of the outward peak is related to the size and shape of the protein. And collecting protein peaks, performing SDS-PAGE electrophoresis, and detecting the purity and the properties of the protein. All protein purification steps were performed at 4 ℃. Finally, the relatively pure protein with the concentration of about 5-10mg/ml is quickly frozen by liquid nitrogen, subpackaged and stored in a refrigerator at minus 80 ℃.

Since INTS3 interacts with both INTS6 and SAGE1 to form a complex, and INTS6 interacts with SAGE1 to a high degree, these two complex interactions may be exclusively competitive, i.e., INTS3 inhibits the presence of INTS3-INTS6 if it interacts with SAGE1 and reduces the presence of INTS3-SAGE1 if INTS6 is overexpressed.

Competition experiments in vivo and in vitro were performed for three proteins, SAGE1, INTS3 and INTS6, respectively. As shown in FIG. 5H, co-immunoprecipitation experiments against INTS3 protein-specific antibodies were performed in 293T cell lines in which SAGE1 was not present and 293T cell lines in which SAGE1 was overexpressed, respectively (cell line construction method described above), 3 replicates per group were performed, and the final product was detected by mass spectrometry. The results show that in the absence of SAGE1, INTS3 binds to INTS6 to form a complex; in the presence of SAGE1 in cells, INTS3 binds to SAGE1 to form the INTS3-SAGE1 complex, competing to inhibit the formation of INTS3-INTS 6.

Competition between SAGE1 and INTS6 for binding to INTS3 was further confirmed by in vitro protein complex competition formation experiments, the results are shown in FIG. 5I. The GST-SAGE1 (817-904 aa, purification method as described above) protein obtained by purification was subjected to the following procedures, 1:1 (no GST tag, purification method as described previously). After incubation for 1 hour at 4 ℃ after uniform mixing, affinity purification is carried out by GST magnetic beads, and SDS-PAGE gel detection is carried out on the final product, so that SAGE1 competes for INTS6 and is combined with INTS3 to form SAGE1-INTS3 compound.

SAGE1-INTS3 compound crystal structure analysis results are shown in FIG. 5J, key amino acids of the compound interaction are found, and the specific method is as follows:

the structure of the complex is analyzed by crystallography, and key amino acids (F838, F873, K874, R872, M832 and Q840) formed by the SAGE1-INTS3 complex are found by the structure analysis, and specific results are shown in tables 7, 8 and 9, wherein the table 7 is the analysis result of crystal parameters, the table 8 is the amino acid site of interaction between INTS3 dimers, and the table 9 is the amino acid site of interaction between INTS3 dimers and SAGE 1.

TABLE 7

Values in parentheses refer to the highest resolution shell.

R factor＝Σ||F(obs)-F(calc)||/Σ|F(obs)|.

Rfree＝R factor calculated using 5.0％of the reflection data randomly chosen and omitted from the start of refinement.

TABLE 8

TABLE 9

Example 7

Mutant SAGE1 was designed according to the crystal structure for the key interacting amino acids between SAGE1 and INTS3 (F838A, F873A, K874A, R872A, M832A, Q840A), and the effectiveness of the mutant in losing INTS3 binding ability was demonstrated by in vitro ITC (isothermal titration calorimetry) determination of the binding constants of wild type SAGE1 to mutants SAGE1 and INTS3, respectively (FIGS. 6A and 6B).

1. The INTS3 (Access: Q68E01.1, 568aa-981 aa) protein was expressed recombinantly in vitro in E.coli BL21DE3, as well as SAGE1 (Access: Q9NXZ1.2, 815aa-905 aa), SAGE1mutant (Access: Q9NXZ1.2, 815aa-905aa, F838A, F873A, K874A, R872A, M832A, Q840A). The recombinant protein expression vector uses a commercial PET28A plasmid, and the protein expression and purification process is carried out according to the conventional expression and purification steps (refer to molecular cloning experimental guidelines (third edition)).

2. The instrument ITC200 device is opened, the wash tool is inserted into the sample cell to form a closed flow path, and the injection needle is assembled. And cleaning the sample pool and the injection needle.

3. The sample, buffer (2 mL), ultrapure water (2 mL) 500-600mmHg was degassed for 10min.

4. Sample application

1) The sample cell was rinsed 2 times with 300. Mu.L of degassed ultrapure water,

2) A300. Mu.L aliquot of INTS3 protein was aspirated and the syringe wall flicked to expel air bubbles (note: effective volume was 190. Mu.L, but the addition volume was less than 300. Mu.L, the apparatus was unstable)

3) The syringe was inserted into the sample cell (left hole), gently touched to the bottom, raised approximately 1mm, and slowly pushed into the needle (50. Mu.L)

4) The empty injection needle is screwed into the black handle and placed on the instrument (the handle is slightly deviated from the upper measuring range to the right, and then is placed in the groove and is forced downwards, rotated left and clamped in the groove)

5) Calibrating the range of the injection needle (52 μ L), observing the black point in the handle moving up and down, and finally returning to the fixed part

6) Taking out the injection needle, firstly rinsing for 2 times by using buffer, removing bubbles, and absorbing 50 mu L of sample SAGE1/SAGE1-mutant

7) The injection needle is screwed into the black handle and placed on the instrument.

5. Set parameters, click "Insert" after selecting the included tilt:

1) The time interval between two titrations is set, typically 120(s)

2) Volume of sample single injection: 2 (μ L)

3) Total number of injections: 25

4) Click "OK"

6. Set the Syring Concentration (Concentration of liquid in Syringe), cell Concentration (Concentration of sample in Cell)

Clicking a triangular blue key behind the Stimng Rate option, clicking an uppermost triangular green key, storing data to a corresponding position, sucking out a sample after the experiment is finished, and cleaning according to the step of cleaning an instrument when the experiment is started. After the experiment is finished, the binding constant of wild SAGE1 and INTS3 is 39nM (FIG. 6A) through data analysis, and SAGE1mutant and INTS3 are not bound any more after the mutation of key amino acid (FIG. 6B). The effectiveness of the tightly bound and resolved crystal structure of the new complex SAGE1-INTS3 is well documented.

Example 8

SAGE1 mutants were shown to be unable to bind INTS3 by CO-IP experiments in 293T cells (FIG. 6C) as follows:

the key amino acids of site-directed mutations (F838A, F873A, K874A, R872A, M832A, Q840A) were verified by 293T cell Co-IP experiments to be able to disrupt the binding between the INTS3-SAGE1 complex, as shown in FIG. 6C, the upper + and-of the picture represent the loading scheme in the runway, + represents the addition of the protein, + represents the non-addition of the protein, INTS3 represents the wild-type INTS3 protein, SAGE1 represents the wild-type SAGE1 protein, SAGE1-C-del represents the wild-type SAGE1 protein with 100 amino acid residues deleted from the C-terminal, SAGE1-mu represents the mutant SAGE1 (F838A, F873A, K874A, R872A, M832A, Q840A). The specific method comprises the following steps:

1. 293T cells transfected with the flag-SAGE 1/flag-SAGAEmutant and strep-INTS3 plasmids, respectively, were plated in 3X 10cm dishes.

2. Washing the cells with ice-cold 1XPBS for 2-3 times, adding 0.67ml of 1xlysis buffer solution per 10cm dish; the plates were frozen for 5min, and the cells were then resuspended in 2ml EP tubes (total 2ml cell lysate).

3. Centrifuging at 13000rpm for 10 minutes at 4C 5, collecting the supernatant; each sample was divided into three portions: a. as a control input; b. (negative ctrl: none, addition of Potein G beads); c. (2 g of primary antibody added, potein A beads added).

4. Mix overnight at 4 ℃.

5. Washing/equilibrating beads in lysis buffer: 38ul of Potein G beads were added to a 1.5ml EP tube, 750ul of lysis buffer was added to the tube, vortexed, centrifuged at 8200G for 30s, and 50ul of lysis buffer was added to resuspend.

6. For samples-b and-C, washed protein a beads were added and mixed at 4C for 2 hours.

7. Centrifuge at 3000rpm for 2 minutes, wash beads 2 times with 1Xlysis buffer, take 15ul for WB blot. The remainder was centrifuged at 3000rpm for 2 minutes to remove the suspension.

8. For samples b and c, elution buffer was added and samples were taken for WB validation.

Example 9

In intestinal cancer tumor cells (CaCO 2) with SAGE1 knocked down (namely Caco2 cell line with the target of SAGE1 knocked down and Caco2-sh-1 in example 3), the recovery experiments of wild type SAGE1 and SAGE-mutant carrying amino acid mutation critical to interaction with INTS3 are respectively carried out, and data show that the recovered wild type SAGE1 can remarkably promote the proliferation of the cancer cells, and the recovered SAGE1mutant which cannot interact with INTS3 loses the function of promoting the proliferation of the tumor cells (FIG. 6D).

Wild type SAGE1 and SAGE-mutant carrying amino acid mutation critical to interaction with INTS3 were respectively carried out in SAGE 1-knocked-down esophageal cancer tumor cells (TE 1, the cell line construction method for knocking-down SAGE1 refers to the Caco2 cell line experimental method for knocking-down the lentivirus of SAGE1 in example 3), and data show that the restored wild type SAGE1 can remarkably promote the proliferation of cancer cells, and the restored SAGE1mutant which cannot interact with INTS3 loses the function of promoting the proliferation of tumor cells (FIG. 6E).

In the knockout SAGE1 duodenal tumor cell (HUTU 80-KO 1) (i.e. CRISPR-stabilized knockout SAGE1 cell line KO-1 in example 3), constructing wild type SAGE1 and a recovery cell line of SAGE-mutant carrying a mutation of an amino acid critical for interaction with INTS3 (refer to the experimental operation of constructing a HUTU80 recovery SAGE cell line in example 3) respectively, data show that the recovery wild type SAGE1 can remarkably promote the proliferation of cancer cells, and the recovery SAGE1mutant which cannot interact with INTS3 loses the function of promoting the proliferation of tumor cells (FIG. 6E).

Screening to obtain stably over-expressed cell lines was performed as follows, followed by cell proliferation experiments performed in the same manner as SAGE1 knockdown in tumor cells.

2. the plasmid was prepared by pipetting 800. Mu.l of Opti-MEM medium (gibco) into a 1.5mL EP tube, adding 8ug of the target plasmid PCDH-GFP-SAGE1 (codon optimized SAGE1 gene from Nanjing Kingsry ligated into pCDH-MCS2-EF1-copGFP vector), PCDH-GFP-SAGE-mutant (codon optimized SAGE1mutant gene from Nanjing Kingsry ligated into pCDH-MCS2-EF1-copGFP vector containing mutations F838A, F873A, K874A, R872A, M832A, Q840A), PCDH-GFP (purchased from addge, pCDH-MCS2-EF 1-copGFP), lentiviral packaging fluid, mixing the mixture, and adding 10uL Transfection Reagent (X-treeGENE HP DNA Transfection Reagent, roche Reagent) thereto. Incubating at room temperature for 15-30 minutes, dropwise adding all the liquid in an EP tube into 10cm dish, uniformly mixing, putting into a 37-DEG carbon dioxide incubator for culturing for 6-8 hours, changing the liquid, and continuously culturing for 36-72 hours;

4. culturing a cell line needing virus infection in a 6-well plate until the density is 30-50%, sucking out all culture media, adding 1ml of fresh culture medium and 1ml of culture medium containing virus, adding polybrene to enable the final concentration to be 10-20 micrograms/ml, uniformly mixing, putting into a 37-DEG carbon dioxide incubator for culturing, changing the culture solution after 12-24 hours, observing fluorescence under a fluorescence microscope for 36-72 hours, and judging the cell infection condition;

Example 10

FIG. 6G/H transplantation of wild type duodenal cancer cells (Hutu 80), SAGE1 knockout duodenal cancer cells (Hutu 80-KO 1) and SAGE-mutant reverted to wild type SAGE1, reverted to SAGE-mutant carrying amino acid mutations critical for the interaction with INTS3, respectively, using nude mouse colorectal cancer transplantation tumors (see example 9 for construction method of both cells). Experiments prove that the growth of the xenograft tumor can be obviously inhibited by destroying the formation of the INTS3-SAGE1 complex. The experiments prove that SAGE1-INTS3 which is a newly discovered compound can be used as a target for inhibiting the growth of tumor cells, and the damage of the interaction of the compound can obviously inhibit the growth of the tumor cells in vivo. The specific method comprises the following steps:

1) Cell culture before inoculation: the cells to be inoculated are expanded and cultured (the cells expressing the foreign gene are prepared as described above):

hutu80, HUTU80-KO1, HUTU80-KO1-SAGE1 (reverse expression of wild type SAGE1 protein), HUTU80-KO1-SAGE1-c-del (reverse expression of SAGE1 truncation 1aa-806aa, construction method referring to HUTU80-KO1-SAGE1, only different protein fragment in reverse expression), HUTU80-KO1-SAGE1mutant (reverse expression of SAGE1mutant protein, F838A, F873A, K874A, R872A, M832A, Q840A, construction method referring to HUTU80-KO1-SAGE1, only different protein fragment in reverse expression).

2) Subcutaneous inoculation: operating in sterile environment, fully resuspending and mixing cells, and injecting at a dose of 100 μ l/cell, i.e. 1 × 10 ⁷ Cell/cell. The same nude mice were inoculated subcutaneously in the anterior axilla, 6 nude mice per group.

3) Observing the tumor formation condition of the nude mice: the date of tumor formation in each nude mouse was recorded by observation, and once tumor formation was observed, the size of the tumor was measured every other day with a vernier caliper to observe the nude mice for the presence or absence of cachexia.

4) Sacrifice of nude mice and isolation treatment of tumor: after 23 days, all nude mice were sacrificed by cervical spondylolysis, pathologically dissected, tumors were completely isolated from each nude mouse, weighed and recorded and photographed. Tumors were soaked in formalin and fixed overnight.

Example 11

Collecting the cell line (the construction method is as described above) which is stably interfered and knocked down in the HUTU80 and the cell line of the control group thereof, and then sending the collected cell line to an Annuoda company for RNAseq sequencing to find out the significant change gene caused by knocking down INTS 3; collecting a cell line (the construction method is as described above) stably knocking SAGE1 out of HUTU80 and a control cell line thereof, and then sending the cell line to Annuoda company for RNAseq sequencing to find out a significant change gene caused by knocking SAGE1 out; the specific process is that for RNA-seq data, the FastQC software is used for carrying out quality control on the RNA-seq data, the Trimmomatic software is used for removing a linker sequence and a low-quality sequence in the RNA-seq data, the Hisat2 software is used for positioning the reserved reading segment to a human reference genome, the software featureCounts is used for obtaining the original expression quantity of the gene according to the gene annotation of an Ensembl website, and finally the R software package DESeq2 is used for finding the differentially expressed gene and the differential multiple thereof. Comparison of differential expression of genes with each other after high expression of SAGE1 or INTS3 is shown by scatter plot (FIG. 6I). As shown in the figure, the reduction of SAGE1 expression level is consistent with the change of the significantly different gene caused by the reduction of INTS3 expression level, namely, the up-regulated gene in the SAGE1 significantly-changed different gene is also up-regulated in the INTS3 significantly-changed different gene, and the down-regulated gene in the SAGE1 significantly-changed different gene is also down-regulated in the INTS3 significantly-changed different gene, so that SAGE1 and INTS3 form a compound to regulate and change the expression of the tumor-related gene, and INTS3 and SAGE1 in the compound are in positive synergistic correlation and act as a whole.

To verify that disruption of the interaction between INTS3-SAGE1 completely abolished the mechanism of SAGE1 pathway promoting tumor cell growth, we analyzed the related signaling pathway of RNAseq significant change differential gene enrichment in CaCO2 knocked down SAGE1 in example 9 (figure 6J) and RNAseq significant change differential gene enrichment in CaCO2 knocked down SAGE1 (several key amino acids mutated, unable to bind INTS 3) (figure 6K). The specific operation is as follows: for RNA-seq data, the RNA-seq data is subjected to quality control by using software FastQC, a linker sequence and a low-quality sequence in the RNA-seq data are removed by using software Trimmomatic, a reserved read is positioned to a human reference genome by using software Hisat2, the original expression quantity of the gene is obtained by using software featureCounts according to gene annotation of an Ensembl website, and finally the differentially expressed gene and the differential multiple thereof are found by using an R software package DESeq 2. The KEGG pathway enriched by the differentially expressed genes was obtained by clusterirprofiler, software package R. According to the results, the overexpression of wild-type SAGE1 can significantly up-regulate many tumor growth-related pathways, such as proteome, cell cycle, DNA replication, pathway in cancer, and the like, which are important cancer promotion pathways. Whereas mutant proteins reverting to SAGE1 which are unable to bind INTS3 significantly differentially gene-enriched pathways were not enriched to these pathways. This difference in signaling pathway changes is consistent with the differences in the cell experiments in example 9, indicating that SAGE1 appears in cells and that tumor cell growth is significantly promoted only by the formation of SAGE1-INTS3 complex via INTS3 binding.

In conclusion, the present invention effectively overcomes various disadvantages of the prior art and has high industrial utilization value.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Sequence listing

<110> Shanghai university of traffic medical college affiliated ninth people hospital

<120> use of SAGE1 inhibitor for preparing medicine or kit

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtcccacagg gcttattaa 19

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggtatttca tgcagaagt 19

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gttccacctg gttgtatta 19

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctggaattt catccacgat t 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctgctgccta tgtgtttaca a 21

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccaaggagaa acaaggacat a 21

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gctgcctatg tgtttacaaa t 21

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cccagactga taaggtcata t 21

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cccaaactga taaggtcata t 21

<210> 10

<211> 97

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgctgttgac agtgagcgcg gtcccacagg gcttattaat tagtgaagcc acagatgtaa 60

ttaataagcc ctgtgggacc atgcctactg cctcgga 97

<210> 11

<211> 97

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgctgttgac agtgagcgac tggtatttca tgcagaagta tagtgaagcc acagatgtat 60

acttctgcat gaaataccag ctgcctactg cctcgga 97

<210> 12

<211> 97

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgctgttgac agtgagcgag gttccacctg gttgtattaa tagtgaagcc acagatgtat 60

taatacaacc aggtggaacc gtgcctactg cctcgga 97

<210> 13

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccgggctgga atttcatcca cgattctcga gaatcgtgga tgaaattcca gctttttg 58

<210> 14

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ccggctgctg cctatgtgtt tacaactcga gttgtaaaca cataggcagc agtttttg 58

<210> 15

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ccggccaagg agaaacaagg acatactcga gtatgtcctt gtttctcctt ggtttttg 58

<210> 16

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ccgggctgcc tatgtgttta caaatctcga gatttgtaaa cacataggca gctttttg 58

<210> 17

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ccggcccaga ctgataaggt catatctcga gatatgacct tatcagtctg ggtttttg 58

<210> 18

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ccggcccaaa ctgataaggt catatctcga gatatgacct tatcagtctg ggtttttg 58

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

accgaaggaa gagtatgtcc tcg 23

<210> 20

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aaaccgagga catactcttc ctt 23

<210> 21

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

accgaagtaa atctggttgc aac 23

<210> 22

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

aaacgttgca accagattta ctt 23

<210> 23

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ggaagagtat gtcctcgtgg tt 22

<210> 24

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gcatcaggcc atggtggag 19

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

atcatccctg cctctactgg 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gtcaggtcca ccactgacac 20

Claims

Use of a SAGE1 inhibitor in the manufacture of a medicament or kit for:

regulating the expression level of SAGE1-INTS3 complex, inhibiting proliferation of SAGE 1-positive tumor cells.
2. The use of claim 1, wherein said inhibitor of SAGE1 is capable of inhibiting the expression and/or function of SAGE 1.
3. Use according to claim 1, wherein the SAGE1 inhibitor is a single active ingredient.
4. Use according to claim 1, wherein said SAGE1 inhibitor is selected from a nucleic acid molecule, a protein molecule or a compound.
5. Use according to claim 4, wherein the nucleic acid molecule is selected from the group consisting of an interfering RNA for SAGE1, an antisense oligonucleotide for SAGE1, a substance for knocking out or knocking down SAGE1 expression;

and/or, the protein molecule is selected from an anti-SAGE 1 antibody.
6. The use according to claim 4, wherein the protein molecule is a monoclonal antibody.
7. Use according to claim 4, wherein the target sequence of the nucleic acid molecule comprises the sequence shown in one of SEQ ID Nos. 1 to 9.
8. The use of claim 4, wherein the polynucleotide sequence of the nucleic acid molecule comprises SEQ ID No.

10 to 18, or a pharmaceutically acceptable salt thereof.
9. The use of claim 4, wherein the polynucleotide sequence of the nucleic acid molecule comprises SEQ ID No.

19 to 22, or a pharmaceutically acceptable salt thereof.
10. Use according to claim 1, wherein the SAGE1 inhibitor is selected from substances that compete with SAGE1 for binding to INTS3.
11. Use according to claim 1 wherein the SAGE1 inhibitor is selected from one or a combination of two of INTS6, INTS 6L.