CN107043774A - A kind of chimeric strong promoter and application thereof - Google Patents

Abstract

The invention belongs to biology field, it is related to a kind of chimeric strong promoter and application thereof.The promoter can in tumour cell broad-spectrum high efficacy expression alien gene, a series of its expression activity in tumour cells is higher than existing CAG promoters, and sequence is stable (sequence will not occur in prokaryotic and eukaryotic transfer process to lose).The promoter is applicable to during therapy of tumor, high efficient expression of the driving foreign gene in tumour cell.

Description

A kind of chimeric strong promoter and application thereof

The present invention is the divisional application of the female case of Application No. 201410495099.7, and the applying date of the female case is 2014 September 25 days, entitled " a kind of tumour cell wide spectrum high activity promoter and application thereof ".

Technical field

The invention belongs to biology field, it is related to a kind of tumour cell wide spectrum high activity promoter and application thereof.Institute Promoter is stated for artificial synthesized chimeric promoters, the promoter has the high activity of wide spectrum in tumour cell.The present invention is also Being related to the recombinant vector containing the promoter, recombinant virus and promoter control therapeutic gene is used for gene therapy Purposes.

Background technology

Promoter is a part of gene, be usually located at structural gene 5 ' end upstream, be RNA polymerase identification, With reference to start transcription section of DNA sequence.Promoter can instruct holoenzyme (holoenzyme) correctly to be combined with template, activation RNA polymerase, promotor gene transcription, so as to control the initial time of gene expression (transcription) and the degree of expression.Promoter is One of key factor of transgene expression efficiency is influenceed, the pass that efficient promoter is high-efficient expression foreign gene is selected Key.

3 classes can be classified as according to the transcriptional profile of promoter：Constitutive promoter, tissue or organ specific promoters And inducible promoter.So-called constitutive promoter refer to constitutive promoter regulate and control under, different tissues organ and development rank The gene expression of section does not have notable difference, thus referred to as constitutive promoter.

The constitutive promoter commonly used in mammal includes viral source：Mouse or human cytomegalovirus (CMV) promoter (abbreviation mCMV and hCMV respectively), vacuolating virus of monkey SV40 promoters；Human genome natural origin：EF1 α promoters, ubiquitin are opened Mover (Ubiquitin, abbreviation Ubi), β-actin promoters, PGK-1 promoters, Rosa26 promoters, HSP70 promoters, GAPDH promoters, eIF4A1 promoters, Egr1 promoters, FerH promoters, SM22 α promoters, Endothelin-1 promoters Deng.

Mammal often has with tissue-specific promoter：B29 promoters (B cell specificity), CD14 promoters are (single Nucleus specificity), CD43 promoters (lymphocyte and blood-platelet specific), (hematopoietic cell is special for CD45 and INF- β promoters The opposite sex), CD68 promoters (macrophage specificity), Desmin and Myoglobin promoters (muscle cell specificity), CD105 and CD102 promoters (endothelial cell specific), GFAP promoters (astroglia specificity), GPIIb promoters (megacaryocyte specificity), Surfactant Protein B promoters (lung specificity), (mature neuron is thin for NSE promoters Born of the same parents' specificity), Alb promoters (liver specificity) etc..

Conventional tumor-specific promoters have：AFP promoters (liver cancer-specific), (cancer of pancreas is special for CCKAR promoters Property), PSA promoters (prostatic cancer specific), Tyr promoters (melanoma specificity), hTERT promoters/CEA start Son/Survivin promoters/CXCR4 promoters/COX-2/L-plastin promoters/epididymis protein 4 start Son/E2F1 promoters (tumour Broadspectrum specificity) etc..

Conventional inducible promoter has：Inducible promoter (including Tet-On or Tet- based on tetracycline (Tet) system Off), the inducible promoter of molting hormone class inducible system, the inducible promoter of FK506 regulator control systems, rapamycin are lured Inducible promoter, inducible promoter of RU486 inducible systems of guiding systems etc..

In therapy of tumor, maintain the high efficiency stable expression of foreign gene extremely important.However, some viral sources Although constitutive promoter Transient Expression it is higher (such as CMV promoter), be easily closed because of epigenetic modification Expression；Although and the natural constitutive promoter in some sources or tumor-specific promoters expression are stable, expression activity is relative It is weaker, it is difficult to meet gene therapy demand.Thus, a series of researcher's artificial chimeric's promoters of design construction again, they Some cis-regulating elements are contained, it is main to include the promoter core sequence for the expressional function that play stably, and can strengthen The enhancers upstream or downstream introne of expression efficiency, representative be chimeric promoters CAG (comprising people's cmv enhancer-chicken β- Actin promoters-rabbit β-globin intrones), it is widely used in the expression of foreign gene.

The promoter for being adapted to the broad-spectrum high efficacy expression alien gene in tumour cell will be developed by still needing, and it is in a series of tumours Expression activity in cell is higher than CAG promoters, and sequence stabilization (will not be sent out in prokaryotic and eukaryotic transfer process Raw sequence is lost), and high efficient expression of the driving foreign gene in tumour cell can be applied to.

The content of the invention

The present inventor passes through substantial amounts of experiment and performing creative labour, design construction a series of new chimeric promoters, And therefrom screening obtain one can in tumour cell broad-spectrum high efficacy expression alien gene promoter.The present inventor sends out in surprise Existing, the promoter sequence is stable, will not occur sequence Loss with its transfer in prokaryotic or eukaryotic, And it can stably express the expression of driving foreign gene.Thus provide following inventions：

One aspect of the present invention is related to a kind of polynucleotides of separation, and it includes following element：

HCMV enhancers, β-Actin promoters and mCMV enhancers；

Specifically, it also includes Ubi enhancers；More specifically, Ubi enhancers are located at the downstream of above-mentioned 3 kinds of elements；

Specifically, above-mentioned 4 kinds of elements are each independently 1,2,3 or more than 3；

Specifically, the polynucleotides have promoter function.

Polynucleotides according to any one of the present invention, it is included successively：

HCMV enhancer+β-Actin promoter+mCMV enhancers, or

MCMV enhancer+hCMV enhancer+β-Actin promoters；

Preferably, it is included successively：

HCMV enhancer+β-Actin promoter+mCMV enhancer+Ubi enhancers, or

MCMV enhancer+hCMV enhancer+β-Actin promoter+Ubi enhancers.

Polynucleotides according to any one of the present invention, wherein：

The nucleotide sequence of hCMV enhancers such as SEQ ID NO：Shown in 17；

The nucleotide sequence of β-Actin promoters such as SEQ ID NO：Shown in 18；

The nucleotide sequence of mCMV enhancers such as SEQ ID NO：19 or SEQ ID NO：Shown in 20；Preferably SEQ ID NO：20；

The nucleotide sequence of Ubi enhancers such as SEQ ID NO：Shown in 21.

Be with or without between polynucleotides according to any one any one of of the invention, its each element catenation sequence or Person's splice site；Specifically, have respectively in the upstream and downstream of mCMV enhancers and/or hCMV enhancers and/or Ubi enhancers Donor splicing site and acceptor splicing site；More specifically, the nucleotide sequence of the donor splicing site such as SEQ ID NO：Shown in 22；It is described to cut The nucleotide sequence of acceptor such as SEQ ID NO：Shown in 23.

Donor splicing site (splice donor, SD)：AAAACAGGTAAGTCC(SEQ ID NO：22)

Acceptor splicing site (splice acceptor, SA)： GCCTCTACTAACCATGTTCATGTTTTCTTTTTTTTTCTACAGGTCCTGGGTGACGAACAG(SEQ ID NO：23)

In one embodiment of the invention, the enhancer sequence two ends behind the limitation of theory, promoter are not limited to Contain shearing site, it is ensured that after transcription, the enhancer sequence positioned at promoter downstream can accurately be cut off, and not influence purpose The translation of albumen；Remaining element is directly connected to.

Another aspect of the present invention is related to a kind of polynucleotides of separation, and it is included or to appoint in following a-e Anticipate one group of polynucleotides：

a.SEQ ID NO：1-SEQ ID NO：Polynucleotides in 4 shown in any sequence；

B. with SEQ ID NO：1-SEQ ID NO：The complementary polynucleotides of any sequence in 4；

C. it can hybridize and have the multinuclear of promoter function with above-mentioned a or b polynucleotides under the conditions of high stringency Thuja acid；

D. substitution, missing, the addition that polynucleotides shown in above-mentioned a or b are carried out with one or more bases are modified and had The polynucleotides of promoter function；With

E. there are at least 90% homogeneity and the polynucleotides with promoter function with polynucleotides shown in above-mentioned a or b；

Specifically, the polynucleotides in a or b have promoter function.

The above-mentioned polynucleotides of the present invention are promoter；Specifically chimeric promoters.

SEQ ID NO：1-SEQ ID NO：4 particular sequence is as follows：

CAC promoters (+β-Actin promoter+mCMV of enhancer containing hCMV enhancers)：

GGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAA TAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACT GCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGC CTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTA CCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTA TTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGC GAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTAT GGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCC CCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTAAAACAGGTAAGTCCC TGAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAGTCCCAT TGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTC AATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATT AAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTT TCCCATAGCTGATTAATGGGAAAGTACCGTTCGCCTCTACTAACCATGTTCATGTTTTCTTTTTTTTTCTACAGGTC CTGGGTGACGAACAG(SEQ ID NO：1)

CACU promoters (+β-Actin promoter+mCMV enhancer-Ubi of enhancer containing hCMV enhancers)：

GGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAA TAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACT GCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGC CTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTA CCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTA TTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGC GAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTAT GGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCC CCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTAAAACAGGTAAGTCCC TGAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAGTCCCAT TGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTC AATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATT AAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTT TCCCATAGCTGATTAATGGGAAAGTACCGTTCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCC TCACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGATCCTTCCGCCCGGACGCTCAGGACAGCG GCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTC TAGGGCACTGGTTTTCTTTCCAGAGAGCGGAACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGAT CTCCGTGGGGCGGTGAACGCCGATGATGCCTCTACTAACCATGTTCATGTTTTCTTTTTTTTTCTACAGGTCCTGGG TGACGAACAG(SEQ ID NO：2)

CCAU the promoters (+hCMV enhancer+β-Actin promoter+Ubi of enhancer containing mCMV enhancers)：

ACTGAGTCATTAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCC CATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATTAAAACGCCATGTA CTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGAT TAATGGGAAAGTACCGTTCGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGAC CCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGT GGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCA ATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTAC GTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCC ACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGCGCGCGCC AGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGC TCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTC GCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTT ACTAAAACAGGTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTCACGGCGAGCGCT GCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATA AGACTCGGCCTTAGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTGGTTT TCTTTCCAGAGAGCGGAACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCGGT GAACGCCGATGATGCCTCTACTAACCATGTTCATGTTTTCTTTTTTTTTCTACAGGTCCTGGGTGACGAACAG(SEQ ID NO：3)

(+hCMV enhancer+mCMV enhancer+hCMV enhancer+the β of enhancer containing mCMV-Actin start 4CAU promoters Son+Ubi enhancers)：

CTGAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAGTCCCA TTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGT CAATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAAT TAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACT TTCCCATAGCTGATTAATGGGAAAGTACCGTTCGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCT GACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCAT TGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCC CCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTT GGCAGTACATCTACGTATTAGTCATCGCTATTACCACTGAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACA TAAGGTCAATAGGGGTGAATCAACAGGAAAGTCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGG GTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAAT AGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCT ATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACCGTTCGGAGTTCC GCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACG TATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTT GGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATT ATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTC GAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTT TTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCG GGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGC GGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCC CGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTAAAACAGGTAAGTCCGGCCTCCGC GCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAG CGTCCTGATCCTTCCGCCCGGACGCTCAGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCA GCAGAAGGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTGGTTTTCTTTCCAGAGAGCGGAACAGGCGAGG AAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCCGTGGGGCGGTGAACGCCGATGATGCCTCTACTAACCA TGTTCATGTTTTCTTTTTTTTTCTACAGGTCCTGGGTGACGAACAG(SEQ ID NO：4)

Typically, " hybridization conditions " classify according to " stringency " degree of condition used during measurement hybridization.Stringency journey Degree can be with the melting temperature (Tm) of such as nucleic acid binding complex or probe for foundation.For example, " maximum stringency " is typically Occur about Tm-5 DEG C (being less than 5 DEG C of probe Tm)；" high stringency " occurs in about 5-10 DEG C of below Tm；" moderate stringency Property " occur in about 10-20 DEG C of below probe Tm；" low stringency " occurs in about 20-25 DEG C of below Tm.Alternatively, or Further, the stringency washes that hybridization conditions can using the salt or ionic strength conditions of hybridization and/or one or more times is foundations. For example, the extremely low stringencies of 6 × SSC=；3 × SSC=as little as moderate stringencies；1 × SSC=moderate stringencies；0.5 × SSC= High stringency.Functionally, it can be determined using maximum stringent conditions tight same or near tight same with hybridization probe One nucleotide sequence；And use high stringency condition to determine the nucleic acid sequence for having about 80% or more sequence identity with the probe Row.

Application for requiring high selectivity, typically expects to form crossbred using relatively restricted condition, for example, The relatively low salt of selection and/or high-temperature condition.(Sambrook, J. etc. (1989) molecular cloning, laboratory hand such as Sambrook Volume, Cold Spring Harbor Press, Plainview, N.Y.) provide and include moderate stringency and high stringency exists Interior hybridization conditions.

For purposes of illustration only, for detecting the suitable Moderate that the polynucleotides of the present invention hybridize with other polynucleotides Condition includes：With 5 × SSC, 0.5%SDS, 1.0mM EDTA (pH8.0) solution prewashing；It is miscellaneous in 5 × SSC at 50-65 DEG C Friendship is stayed overnight；Then with 2 containing 0.1%SDS ×, 0.5 × and 0.2 × SSC is respectively washed twice 20 minutes at 65 DEG C.This area skill Art personnel, which should be appreciated that, can easily operate hybridization stringency, such as change the salt content and/or hybridization temperature of hybridization solution.Example Such as, in another embodiment, suitable high stringency hybridizat condition includes above-mentioned condition, and difference is hybridization temperature It is increased to such as 60-65 DEG C or 65-70 DEG C.

In the present invention, it is described under the conditions of high stringency with SEQ ID NO：1-SEQ ID NO：Nucleotides shown in 4 The nucleotide sequence of sequence hybridization, it has and SEQ ID NO：1-SEQ ID NO：Nucleotide sequence shown in 4 is identical or phase As promoter activity.

In the present invention, it is described to SEQ ID NO：1-SEQ ID NO：Nucleotide sequence shown in 4 carries out one or many The substitution of individual base, missing, the nucleotide sequence of addition modification, refer to separately or concurrently at 5 ' ends of the nucleotide sequence And/or 3 ' ends, and/or interior sequences are carried out for example no more than 2-45, either no more than 2-30 or no more than 3- It is 20, either individual no more than 4-15 or no more than 5-10, or continuous integral number one by one is used respectively no more than 6-8 Substitution, missing, the addition modification of the base of expression.

In the present invention, it is described to SEQ ID NO：1-SEQ ID NO：Nucleotide sequence shown in 4 carries out as described above one The substitution of individual or multiple bases, missing, the nucleotide sequence of addition modification have and SEQ ID NO：1-SEQ ID NO：Shown in 4 The same or analogous promoter activity of nucleotide sequence.

Illustrated by a kind of polynucleotides, its nucleotide sequence for example with SEQ ID NO：1-SEQ ID NO：" homogeneity " that 4 reference nucleotide sequence at least has 95% refers to：In SEQ ID NO：1-SEQ ID NO：4 reference In every 100 nucleotides of nucleotide sequence, the nucleotide sequence of the polynucleotides is except the difference containing up to 5 nucleotides Outside, the nucleotide sequence of the polynucleotides is identical with reference sequences.In other words, nucleotide sequence and nucleosides is referred to obtain Up to 5% nucleotides can be deleted or by another nucleotides in acid sequence at least 95% identical polynucleotides, reference sequences Substitute；Or can by some nucleotides inserted reference sequences, wherein the nucleotides inserted can up to reference sequences total nucleotide 5%；Or in some nucleotides, exist deletion, insertion and replace combination, wherein the nucleotides up to reference sequences it The 5% of total nucleotide.5 ' or 3 ' terminal positions in reference nucleotide sequence can occur for these mutation of reference sequences, or at this Between a little terminal positions anywhere, they or be individually dispersed in the nucleotides of reference sequences, or with one or more neighbours Near group is present in reference sequences.

In the present invention, for determine the algorithm of sequence identity and sequence similarity percentage be such as BLAST and The algorithms of BLAST 2.0, they are described in Altschul etc. (1977) Nucl.Acid.Res.25 respectively：3389-3402 and Altschul etc. (1990) J.Mol.Biol.215：403-410.Using for example described in document or default parameters, BLAST and BLAST 2.0 is determined for the nucleotide sequence homology percentage of the present invention.Performing the software of BLAST analyses can lead to Cross National Biotechnology information centre (NCBI) for the public to obtain.

In the present invention, described and SEQ ID NO：1-SEQ ID NO：Nucleotide sequence shown in 4 has at least 90% Sequence identity nucleotide sequence include and SEQ ID NO：1-SEQ ID NO：The same multinuclear substantially of sequence disclosed in 4 Nucleotide sequence, such as when using methods described herein (being analyzed for example with the BLAST of canonical parameter), with many nucleosides of the invention Acid sequence compare containing at least 90% sequence identity, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, Those sequences of 98% or 99% or higher sequence identity.

In the present invention, described and SEQ ID NO：1-SEQ ID NO：Nucleotide sequence shown in 4 has at least 90% Sequence identity nucleotide sequence have and SEQ ID NO：1-SEQ ID NO：Nucleotide sequence shown in 4 is identical or phase As promoter activity.

Another aspect of the invention is related to a kind of nucleic acid construct, comprising the polynucleotides any one of the present invention, And the foreign gene being operably connected；Specifically, the foreign gene is selected from p53, GM-CSF, IL-2, IL-12, IL- 24th, any one or more in Trail, p16, TK, IFN γ, TNF α, Rb, Sirp α etc.；Specifically, the foreign gene is SEQ ID NO：The NO of p53 and/or SEQ ID shown in 12：GM-CSF shown in 4.

Another aspect of the invention is related to a kind of recombinant vector, its contain polynucleotides any one of the present invention or The nucleic acid construct of the person present invention；Specifically, the recombinant vector is recombinant viral vector；Specifically, the recombinant vector is The nucleic acid construct of polynucleotides or the present invention any one of the present invention is with pDC315 plasmids or SG655 through recombinating The recombinant vector arrived.

Cloning vector suitable for building recombinant vector of the present invention includes but is not limited to, for example：pUC18、pUC19、 PMD18-T, pMD19-T, pGM-T carrier, pDC315 serial carriers etc..

Include but is not limited to suitable for building expression vector of the present invention, eukaryon expression plasmid, recombinant viral vector etc..

The eukaryon expression plasmid includes but is not limited to, for example：PCDNA3 serial carriers, pCDNA4 serial carriers, PCDNA5 serial carriers, pCDNA6 serial carriers, pRL serial carriers, pDC315 serial carriers etc..In the implementation of the present invention In scheme, the eukaryon expression plasmid is pDC315 carriers.

The recombinant viral vector includes but is not limited to, for example：Recombinant adenoviral vector, recombined glandulae correlation viral vectors, Recombinant retroviral vector, recombinant herpes simplex virus carrier, vaccinia virus recombinant carrier etc..In the implementation of the present invention In scheme, the recombinant viral vector is recombinant adenoviral vector.

Another aspect of the present invention further relates to a kind of promoter containing the present invention or the nucleic acid construct or sheet of the present invention The recombinant cell of the carrier of invention.Specifically, the cell is mammalian cell.In one embodiment of the invention, The mammalian cell is tumour cell.The tumour cell includes but is not limited to, for example：Primary liver cancer cells, liver cancer are thin Born of the same parents strain (Huh7, Hep3B, HepG2, PLC/PRF/5, SMMC-7721, BEL-7404, BEL7402, BEL-7405, L2.2.15, MHCC97-L、MHCC97-H、QGY-7701、HCCLM3、SK-Hep-1)；Primary lung carcinoma cell, lung cancer cell line (A549, NCI- H460、NCI-H446、NCI-H1299、NCI-H292、NCI-H23)；Primary stomach cancer cell, stomach cancer cell line (SGC-7901, BGC-823、HGC-27)；Primary colon cancer cell, colon cancer cell line (HT29, colo205, SW620)；Primary breast cancer is thin Born of the same parents, breast carcinoma cell strain (MCF-7, MDA-MB-453, MDA-MB-468, HTB-122, HTB-133, SK-BR3, T-47D)；It is former For cervical cancer cell, cervical cancer cell lines (SK-OV3, HO-8910, Hela)；Primary melanoma cells, melanoma cells Strain (A375, A431)；Primary glioma cell, glioma cell line (A172, U251)；Primary osteosarcoma cell, osteosarcoma are thin Born of the same parents' strain (U2OS)；Primary lymphocyte oncocyte, lymphoma cell strain (Raji, Jurkat, K562)；Primary pancreatic cancer cell, pancreas JEG-3 (PANC-1, Bxpc-3, Su-86.86)；Primary prostate gland cancer cell, Prostatic cancer cell lines (PC-3, DU145)； Primary transitional cell bladder carcinoma cell line, bladder cancer cell line (T24)；Primary nasopharyngeal carcinoma cell, human nasopharyngeal epithelioma 1 (CNE-1) etc..

Another aspect of the invention be related to by the present invention polynucleotides (promoter) or the present invention nucleic acid construct or The method that the recombinant vector of the present invention imports mammalian cell；Methods described includes virus-mediated conversion, microinjection, grain Son bombardment, via Particle Bombardment Transformation and electroporation etc..In one embodiment of the invention, methods described turns for virus-mediated Change, more specifically adenovirus mediated conversion.

Another aspect of the invention is related to a kind of Pharmaceutical composition, and it includes the polynucleotides any one of the present invention Or the nucleic acid construct or the recombinant vector of the present invention of the present invention, and optional pharmaceutically acceptable auxiliary material.

Another aspect of the invention is related to the purposes selected from following (1) or (2)：

(1) polynucleotides any one of the present invention or the restructuring of the nucleic acid construct of the present invention or the present invention Purposes of the carrier in treatment and/or prevention and/or auxiliary for treating cancer or anti-tumor drug is prepared；Specifically, it is described Cancer or tumour are lung cancer, hepatocellular carcinoma, lymthoma, colon cancer, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, stomach cancer, courage Pipe cancer, gallbladder cancer, the cancer of the esophagus, kidney, glioma, melanoma, cancer of pancreas or prostate cancer；

(2) polynucleotides any one of the present invention or the restructuring of the nucleic acid construct of the present invention or the present invention Carrier is preparing the purposes in suppressing the medicine or reagent of tumour cell；Specifically, the tumour cell is following tumour Cell：Lung cancer, hepatocellular carcinoma, lymthoma, colon cancer, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, stomach cancer, cholangiocarcinoma, gall-bladder Cancer, the cancer of the esophagus, kidney, glioma, melanoma, cancer of pancreas or prostate cancer；In specific embodiments, it is described swollen Oncocyte is any one in Hep3B, Huh7, HepG2, PLC/PRF/5, BEL-7404, H460 and H1299 cell.

Another aspect of the invention is related to a kind of method for the treatment of and/or prevention and/or auxiliary for treating cancer or tumour, Including the use of the polynucleotides any one of the present invention of effective dose or the nucleic acid construct or the present invention of the present invention Recombinant vector or the present invention Pharmaceutical composition the step of；Specifically, the cancer or tumour are lung cancer, liver cell Cancer, lymthoma, colon cancer, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, stomach cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, Glioma, melanoma, cancer of pancreas or prostate cancer.

Another aspect of the invention is related to a kind of method for suppressing tumour cell in vivo or in vitro, including the use of effective dose The present invention any one of polynucleotides or the present invention nucleic acid construct or the present invention recombinant vector or The step of Pharmaceutical composition of the present invention；Specifically, the tumour cell is the cell of following tumour：Lung cancer, hepatocellular carcinoma, pouring Bar knurl, colon cancer, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, stomach cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, neuroglia Matter knurl, melanoma, cancer of pancreas or prostate cancer；In specific embodiments, the tumour cell be selected from Hep3B, Any one in Huh7, HepG2, PLC/PRF/5, BEL-7404, H460 and H1299 cell.

Another aspect of the invention is related to purposes of the polynucleotides in as promoter any one of the present invention.

Another aspect of the invention is related to a kind of polynucleotides of separation, and it includes or is SEQ ID NO：Shown in 20 Nucleotide sequence or its complementary series.The invention further relates to purposes of the polynucleotides in promoter is prepared；Specifically, it is described Promoter is with the polynucleotides any one of the present invention before promoter function.The inventors discovered that, it is many by this Promoter sequence prepared by nucleotides is stable, will not occur sequence with its transfer in prokaryotic or eukaryotic and lose Phenomenon is lost, and can stably express the expression of driving foreign gene.

ACTGAGTCATTAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCC CATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATTAAAACGCCATGTA CTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGAT TAATGGGAAAGTACCGTTC(SEQ ID NO：20)

In the present invention, term " being operably connected " refers to the function of two or more nucleotide regions or nucleotide sequence The space arrangement of property.In the nucleic acid construct of the present invention, for example, promoter is placed in the specific of the nucleotide sequence of the gene Position, such as promoter are located at the upstream position of the gene nucleic acid sequence so that the transcription of nucleotide sequence is by the promoter The guiding in region, so that, promoter region is " operably connected " on the nucleotide sequence of the gene.The gene is usually Any nucleotide sequence of raising transcriptional level is needed, or, promoter of the present invention and gene can be designed specific to lower Nucleotide sequence.Namely realized by the way that promoter is connected with the gene of antisense orientation.

Described " being operably connected " can realize that specifically, the nucleic acid construct is by the means of genetic recombination Recombinant nucleic acid construct.In a specific embodiment of the invention, the gene is luciferase (luciferase) base Cause；In another of the invention specific embodiment, the gene is mankind p53 genes and GM-CSF gene granulocyte-huge Phagocyte colony stimulating factor (GM-CSF) gene.

The promoter (polynucleotides) of the present invention can with singly copy and/or multicopy in the form of application, can also with it is existing There is known promoter combination in technology.

The beneficial effect of invention

The invention provides a kind of new promoter.The promoter can not only be in tumour cell outside broad-spectrum high efficacy expression Source gene, and a series of its expression activity in tumour cells is higher than CAG promoters, and sequence stabilization (will not be in protokaryon Sequence occurs in cell and eukaryotic transfer process to lose).The promoter is applicable to driving foreign gene in tumour cell Interior high efficient expression.

Brief description of the drawings

Fig. 1：PDC315-CCAU-RLuc Vector map.

Fig. 2：The activity of each promoter is determined using adenovirus Dual-luciferase reportor systerm.

Fig. 3：The ideograph of 11R-p53-2A-GM-CSF expression cassettes.

Fig. 4：Viral SG655-GMP3 shuttle vectors P74-Tp-GMP3 Vector map.

Fig. 5：Viral SG655-GMP3 infects the Western blotting detection figures of expression p53 after 293 cells.Blank, 293 cells of uninfecting virus；1,2,3,4,5,6 represents different virus clones respectively；Ad-p53, infection Ad-p53 viruses.

Fig. 6：Difference clone's (1#-6#) virus SG655-GMP3 infects the quantitative detection that hGM-CSF is expressed after 293 cells.

Fig. 7：Cytotoxicity figures of the SG655-GMP to liver cancer cells Huh7.

Fig. 8：SG655-mGMP suppresses the curve map of Huh7 transplantable tumor tumor growths.

Embodiment

Embodiment of the present invention is described in detail below in conjunction with embodiment.Those skilled in the art will manage Solution, the following examples are merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.It is unreceipted specific in embodiment Technology or condition person, (write, Huang according to the technology described by document in the art or condition such as with reference to J. Pehanorm Brookers What training hall etc. was translated《Molecular Cloning:A Laboratory guide》, the third edition, Science Press) or carry out according to product description.Examination used Agent or the unreceipted production firm person of instrument, being can be by the conventional products of acquisition purchased in market.

Embodiment 1：Carry the structure of each promoter nucleotide sequence expression vector

1. according to renilla luciferase (Renilla in psi-CHECK2 plasmids (being purchased from Promega companies) Luciferase, abbreviation RLuc) gene coded sequence, head and the tail design a pair of PCR specificity amplification primer (sense primers F1, plus EcoRI restriction enzyme sites and protection base；Anti-sense primer R1, plus SalI restriction enzyme sites and protection alkali Base).F1 and R1 sequence is as follows：

F1:GCCgaattcGCCACCATGACTTCGAAAGT(SEQ ID NO：5), wherein lowercase represents EcoRI enzymes Enzyme site

R1：TGTgtcgacTTATTGTTCATTTTTGAGAACTCGCT(SEQ ID NO：6), wherein lowercase is represented SalI restriction enzyme sites.

Using psi-CHECK2 plasmids as template, RLuc gene coded sequences are amplified, through EcoRI+SalI double digestions, are loaded Adenovirus shuttle vector pDC315 equally through EcoRI+SalI double digestions (is purchased from this yuan of Beijing Zhenyang company, gland-containing virus are left Arm, adenoviral packaging signal, LTR), obtain pDC315-CMV-Rluc carriers (pDC315 contains CMV promoter).

2. by SEQ ID NO：1-SEQ ID NO：Nucleotide sequence shown in 4, and XbaI is introduced at its upstream, downstream Restriction enzyme site EcoRI is introduced, the synthesis of commission Shanghai JaRa biotech firm loads the pDC315- through XbaI+EcoRI double digestions CMV-Rluc carriers (replace the CMV promoter in original pDC315-CMV-Rluc carriers), are respectively designated as pDC315-CAC- RLuc, pDC315-CACU-RLuc, pDC315-CCAU-RLuc (specific Vector map is shown in Fig. 1), pDC315-4CAU-RLuc.

3. according to the sequence of CAG promoters in pCAGGS carriers (being purchased from Addgene plasmids storehouse), in a pair of head and the tail design PCR specificity amplification primers (sense primer F2, plus NheI restriction enzyme sites and protection base；Anti-sense primer R2, plus EcoRI restriction enzyme sites and protection base).F2 and R2 sequence is as follows：

F2:GCCgctagcTCTAGTTATTAATAGTAATCAATT(SEQ ID NO：7), wherein lowercase is represented NheI restriction enzyme sites

R2：TGTgaattcTTTGCCAAAATGATGAGACAGCAC(SEQ ID NO：8), wherein lowercase is represented EcoRI restriction enzyme sites.

Using pCAGGS plasmids as template, CAG promoter nucleotide sequences are amplified, through NheI+EcoRI double digestions, are loaded PDC315-Rluc carriers (replacing the CMV promoter in original pDC315-CMV-Rluc carriers) through XbaI+EcoRI double digestions, It is respectively designated as pDC315-CAG-RLuc.

4. as above each plasmid will convert after DH5 α bacteriums, life work in commission Shanghai is measured to the DNA sequence dna of each promoter, As a result find that the DNA sequence dna of CAC, CACU, 4CAU promoter has different degrees of Loss (it is poor that different bacterium clone is present It is different), sequence, which is lost, to be occurred mainly in mCMV enhancer sections；And the sequence of CMV, CAG, CCAU promoter keeps stable.

Embodiment 2：Carry the structure of the adenovirus Dual-luciferase reportor systerm of each promoter nucleotide sequence

1. according to firefly luciferase (Firefly in psi-CHECK2 plasmids (being purchased from Promega companies) Luciferase, abbreviation FLuc) gene coded sequence, head and the tail design a pair of PCR specificity amplification primer (sense primers F3, plus EcoRI restriction enzyme sites and protection base；Anti-sense primer R3, plus SalI restriction enzyme sites and protection alkali Base).F3 and R3 sequence is as follows：

F3:GCCgaattcGCCACCATGGAAGACGCC(SEQ ID NO：9), wherein lowercase represents EcoRI digestions Site；

R3：TGTgtcgacTTACACGGCGATCTTTCCGC(SEQ ID NO：10), wherein lowercase represents SalI enzymes Enzyme site.

Using psi-CHECK2 plasmids as template, FLuc gene coded sequences are amplified, through EcoRI+SalI double digestions, are loaded The same pENTR12 through EcoRI+SalI double digestions^TMCarrier (is purchased from Invitrogen companies, external source is driven by hCMV promoters Gene expression, attL1 the and attL2 sequences containing bacteriophage lambda site-specific recombination system), obtain pENTR12-Fluc and carry Body.PENTR12-Fluc plasmids and pPE3 plasmids (are purchased from MicrobixBiosystems companies of Canada, contain bacteriophage lambda AttR1 the and attR2 sequences of site-specific recombination system, ccdB genes, and 5 type adenovirus right arms) cotransformation BJ5183 bacteriums, the skeleton plasmid pPE3-Fluc that restructuring obtains carrying Fluc genes and 5 type adenovirus right arms is reacted by LR.

2. respectively by pDC315-CMV-Rluc, pDC315-CAG-Rluc, pDC315-CAC-RLuc, pDC315-CACU- RLuc, pDC315-CCAU-RLuc, pDC315-4CAU-RLuc and pPE3-Fluc by Lipofectamine cotransfections extremely HEK293 cell lines (are purchased from the biological product collecting center of Unite States Standard, ATCC), its specific method referring to GIBCOBRL companies behaviour Explain.There is virus plaque within 9-14 days after cotransfection, purified by three virus plaques, produce each promoter nucleotides of carrying The adenovirus Dual-luciferase reportor systerm of sequence, be respectively designated as Ad-CMV-2Luc, Ad-CAG-2Luc, Ad-CAC-2Luc, Ad-CACU-2Luc、Ad-CCAU-2Luc、Ad-4CAU-2Luc。

Above recombined adhenovirus amount reproduction in HEK293 cells, using the method large-scale purification of caesium chloride density gradient centrifugation Adenovirus, then determining virus titer using 50% tissue culture infection dose (TCID50) method, (method is referring to the U.S. The AdEasyTM operation manuals of Qbiogene companies).

3. extracting the genome of above adenovirus, life work in commission Shanghai is measured to the DNA sequence dna of each promoter, as a result It was found that the DNA sequence dna of CAC, CACU, 4CAU promoter equally exists different degrees of Loss, (it is poor that different virus clone is present It is different), sequence, which is lost, also to be occurred mainly in mCMV enhancer sections；And the sequence of CMV, CAG, CCAU promoter keeps stable.

Embodiment 3：Utilize the activity for carrying each promoter of adenovirus Dual-luciferase reportor systerm measure

By the good low algebraically HEK293 of growth conditions, Hep3B, Huh7, HepG2, PLC/PRF/5, BEL-7404, H460, H1299 cell line (being purchased from ATCC) are respectively by 1 × 10⁴Cells/ holes spread 96 orifice plates, put 37 DEG C, 5%CO₂Incubator culture 24 hours；By viral infection multiplicity MOI=5, Ad-CMV-2Luc, Ad-CAG-2Luc, Ad-CAC-2Luc, Ad- are infected respectively Every group of recombinant virus of 6 kinds of CACU-2Luc, Ad-CCAU-2Luc, Ad-4CAU-2Luc etc. sets 4 multiple holes；Then put 37 DEG C, 5% CO₂Incubator culture；After 24 hours, cell lysis, by Dual-Luciferase detection kit (being purchased from Promega companies), is placed in RLuc enzymatic activity is determined in ELIASA, using FLuc enzymatic activity as internal reference, RLuc/FLuc relative ratio is obtained.Specific behaviour Make step to complete by kit specification.

As a result it is as shown in Figure 2.

As a result show, in a series of promoters, CCAU promoters activity it is most stable, respectively HEK293, Hep3B, Occupy the 2nd in Huh7, HepG2, PLC/PRF/5, BEL-7404, H460, H1299, the 2nd, the 1st, the 1st, the 1st, the 1st, the 2nd；Its Activity is respectively CAG promoters active 2.8 in corresponding cell, 6.2,2.0,1.8,2.5,4.5,3.5,1.1 times of (specific knots Fruit sees Fig. 2).

As a result it is also shown that the promoter particularly CCAU promoters of the present invention can be sent out in various kinds of cell (tumour cell) Promoter function is waved, with broad spectrum activity, and broad spectrum activity is higher than CAG promoters.

Embodiment 4：Recombined adhenovirus SG655-GMP3 structure

With reference to Publication No. CN103614416A Chinese patent application, (Application No. 201310460980, publication date is On 03 05th, 2014).Comprise the following steps that：

1. synthesize one section of artificial first insulator (particular sequence such as SEQ ID NO：Shown in 11), and introduce at its upstream many Cloning site (BglII-XbaI-EcoRI-BamHI-SalI-NheI-HindIII-SpeI), is introducing restriction enzyme site downstream (EcoRV-BglII), the synthesis of commission Shanghai JaRa biotech firm, loads between carrier segments pCA13 carriers (BglII) site, Build the carrier obtained and be named as pCA16.PCA13 carriers are purchased from Canadian Microbix Biosystem Inc. (Toronto) be, an adenovirus shuttle vector, containing 5 type adenovirus left arm sequences (bp22-5790), missing E1 areas 342 to 3523bp fragments, available for cloned foreign gene and with the carrier package comprising adenovirus right arm into adenovirus vector.

2. by CAC promoter sequences, SEQ ID NO：CCAU promoter sequences shown in 3 is respectively charged into pCA16 carriers, structure Build up work(carrier and be respectively designated as pCA20, pCA21.

3. according to people's 11R cell-penetrating peptide p53 genes (SEQ ID NO：Shown in 12), GM-CSF Gene (abbreviation hGM-CSF, SEQ ID NO：13), mouse GM-CSF gene (abbreviation mGM-CSF, SEQ ID NO：14), Furin-2A coded sequences (SEQ ID NO：15) 11R-p53-F2A-hGM-CSF (abbreviation hGMP, see Fig. 3) and 11R-p53-F2A-mGM-CSF, two, are respectively synthesized End introduces restriction enzyme site (EcoRI+SalI), and the full genome synthesis of commission Shanghai JaRa biotech firm is respectively charged into pCA20, pCA21 In carrier, carrier is successfully constructed, pCA20-hGMP, pCA20-mGMP, pCA21-hGMP, pCA21-mGMP is respectively designated as.

4. by SEQ ID NO：The long sequence of sequent synthesis section of DNA shown in 16, the sequence includes 5 type adenopathy toxogens successively One section of sequence before E1A promoters, the second insulator, hTERT promoter, E1A coded sequences, E1A polyA Tailing signal sequence, two ends include restriction enzyme site EcoRI and BglII, and the fragment is connected to after EcoRI and BglII double digestions Through the pXC.1 carriers (being purchased from Canadian Microbix Biosystem Inc) after EcoRI and BglII double digestions, build and obtain Carrier be named as p74-Tp, the carrier substituted for the original E1A promoters of adenovirus with hTERT promoter, and Delete E1b 55KDa and 19KDa coding region sequences.

5. plasmid pCA20-hGMP, pCA20-mGMP, pCA21-hGMP, pCA21-mGMP are respectively after (BglII) digestion, Reclaim CAG-hGMP-SV40 PolyA- insulators, CAG-mGMP-SV40 PolyA- insulators, CCAU-hGMP- SV40PolyA- insulators, CCAU-mGMP-SV40 PolyA- insulator expression cassette fragments, whole expression cassette is loaded through same In carrier segments p74-Tp (BglII) after digestion, the positive clone molecule of Opposite direction connection is selected, carrier is successfully constructed and names respectively For p74-Tp-GMP2, p74-Tp-mGMP2, p74-Tp-GMP3 (Vector map is as shown in Figure 4), p74-Tp-mGMP3.

6. p74-Tp-GMP2, p74-Tp-mGMP2, p74-Tp-GMP3, the p74-Tp-mGMP3 obtained will be purified, respectively With the skeleton plasmid pPE3 (being purchased from Canadian Microbix Biosystem Inc) containing adenoviral gene group right arm, pass through Recombinate, recombinated in Lipofectamine (being purchased from Invitrogen companies) cotransfections to HEK293 cells (being purchased from ATCC) Oncolytic adenovirus SG655-GMP2, SG655-mGMP2, SG655-GMP3, SG655-mGMP3.

First insulator sequence：

AGAGAAATGTTCTGGCACCTGCACTTGCACTGGGGACAGCCTATTTTGCTAGTTTGTTTTGTTTCGTTTTGTTTTGA TGGAGAGCGTATGTTAGTACTATCGATTCACACAAAAAACCAACACACAGATGTAATGAAAATAAAGATATTTTATT (SEQ ID NO：11)

People's cell-penetrating peptide p53 genes：

ATGGGCCGCCGCAGGAGACGACGGCGACGGCGAAGAAGGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCT GAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGTCCCAAGCAA TGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGA ATGCCAGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTG GCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTG GGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCT GTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCA CATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATC TTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCC TATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGG CATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTG AGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCAC CACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCTCCCCAGCCAAAGAAGAAACC ACTGGATGGAGAATATTTCACCCTTCAGATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCT TGGAACTCAAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAG GGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGAC(SEQ ID NO：12)

GM-CSF Gene：

ATGTGGCTGCAGAGCCTGCTGCTCTTGGGCACTGTGGCCTGCAGCATCTCTGCACCCGCCCGCTCGCCCAGCCCCAG CACGCAGCCCTGGGAGCATGTGAATGCCATCCAGGAGGCCCGGCGTCTCCTGAACCTGAGTAGAGACACTGCTGCTG AGATGAATGAAACAGTAGAAGTCATCTCAGAAATGTTTGACCTCCAGGAGCCGACCTGCCTACAGACCCGCCTGGAG CTGTACAAGCAGGGCCTGCGGGGCAGCCTCACCAAGCTCAAGGGCCCCTTGACCATGATGGCCAGCCACTACAAGCA GCACTGCCCTCCAACCCCGGAAACTTCCTGTGCAACCCAGATTATCACCTTTGAAAGTTTCAAAGAGAACCTGAAGG ACTTTCTGCTTGTCATCCCCTTTGACTGCTGGGAGCCAGTCCAGGAGTGA(SEQ ID NO：13)

Mouse GM-CSF gene：

ATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCACCCACCCGCTCACCCATCACTGT CACCCGGCCTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCCTGTCACGTTGAATG AAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAGACCCGCCTGAAGATATTCGAG CAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGACAGCCAGCTACTACCAGACATACTGCCC CCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTATGCGGATTTCATAGACAGCCTTAAAACCTTTCTGA CTGATATCCCCTTTGAATGCAAAAAACCAGGCCAAAAATGA(SEQ ID NO：14)

Furin-2A coded sequences：

CGTAAAAGGCGAGCTCCTGTTAAACAGACTTTGAATTTTGACCTTCTCAAGTTGGCGGGAGACGTCGAGTCCAACCC TGGGCCC(SEQ ID NO：15)

P74-TP vector construction transition fragment sequences：

GAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTC AGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGC TTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCT GCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCC CAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCCGG GCCCCCATTTCCCCTCCCTTCCAGCTCTCTGCCCCTTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTTTG TGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACGTAGTAGTGTGGCGGAAGTGTGATGTTGCAAGTGTGGCGGA ACACATGTAAGCGACGGATGTGGCAAAAGTGACGTTTTTGGTGTGCGCCGGTGTACACAGGAAGTGACAATTTTCGC GCGGTTTTAGGCGGATGTTGTAGTAAATTTGGGCGTAACCGAGTAAGATTTGGCCATTTTCGCGGGAAAACTGAATA AGAGGAAGTGAAATCTGAATAATTTTGTGTTACTCATAGCGCGTAATTTCTAGTAATAAAGGATCCTTTATTTTCAT TGGATCCGTGTGTTGGTTTTTTGTGTGCGGCCGCGTACCGGTCACAGACGCCCAGGACCGCGCTTCCCACGTGGCGG AGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTC CCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCC TCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAAGCCCTGGCCCCGGCCACTCGAGG ACGCACGTGGGTTCGAATGAAAATGAGACATATTATCTGCCACGGAGGTGTTATTACCGAAGAAATGGCCGCCAGTC TTTTGGACCAGCTGATCGAAGAGGTACTGGCTGATAATCTTCCACCTCCTAGCCATTTTGAACCACCTACCCTTCAC GAACTGTATGATTTAGACGTGACGGCCCCCGAAGATCCCAACGAGGAGGCGGTTTCGCAGATTTTTCCCGACTCTGT AATGTTGGCGGTGCAGGAAGGGATTGACTTACTCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCACCTTT CCCGGCAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAACCTTGTACCGGAGGTGATCGAT CTTACCTGCCACGAGGCTGGCTTTCCACCCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGT GGAGCACCCCGGGCACGGTTGCAGGTCTTGTCATTATCACCGGAGGAATACGGGGGACCCAGATATTATGTGTTCGC TTTGCTATATGAGGACCTGTGGCATGTTTGTCTACAGTAAGTGAAAATTATGGGCAGTGGGTGATAGAGTGGTGGGT TTGGTGTGGTAATTTTTTTTTTAATTTTTACAGTTTTGTGGTTTAAAGAATTTTGTATTGTGATTTTTTTAAAAGGT CCTGTGTCTGAACCTGAGCCTGAGCCCGAGCCAGAACCGGAGCCTGCAAGACCTACCCGCCGTCCTAAAATGGCGCC TGCTATCCTGAGACGCCCGACATCACCTGTGTCTAGAGAATGCAATAGTAGTACGGATAGCTGTGACTCCGGTCCTT CTAACACACCTCCTGAGATACACCCGGTGGTCCCGCTGTGCCCCATTAAACCAGTTGCCGTGAGAGTTGGTGGGCGT CGCCAGGCTGTGGAATGTATCGAGGACTTGCTTAACGAGCCTGGGCAACCTTTGGACTTGAGCTGTAAACGCCCCAG GCCATAAGGTGTAAACCTGTGATTGCGTGTGTGGTTAACGCCTTTGTTTGCTGAATGAGTTGATGTAAGTTTAATAA AGGGTGAGATAATGTTTAACTTGCATGGCGTGTTAAATGGGGCGGGGCTTAAAGGGTATATAATGCGCCGTGGGCTA ATCTTGGTTACATCTGACCTCATGGAGGCTTGGGAGTGTTAAAGATCT(SEQ ID NO：16)

Embodiment 5：Recombined adhenovirus SG655-GMP3 exogenous gene expression activity identification

HEK293 cells (being purchased from ATCC) are by 5 × 10⁵Cells/well is layered in 6 orifice plates, in 37 DEG C of incubator 5%CO₂Culture, the Serum-free liquid 1ml is changed within two days, then recombination oncolytic adenovirus SG655-GMP3 is separately added into by MOI=5, cultivated 90 minutes Afterwards, washed twice with phosphate buffer (PBS), virus is washed away, the nutrient solution culture with adding 5% hyclone, culture 48 After hour, cell lysis collects sample, the expression of Western Blotting experiment detection p53 albumen, with house-keeping gene GAPDH It is used as internal reference.

As a result it is as shown in Figure 5.

As a result show, relative to comparison virus, (Ad-p53, is purchased from Shenzhen City SaiBaiNuo Gene Technology Co., Ltd, expression 53KDa product), recombination oncolytic adenovirus SG655-GMP3 can express the 11R- that size is about 55KDa in HEK293 cells P53 fusion proteins, it is specific as shown in Figure 5.

As a result it is also shown that the amount of recombination oncolytic adenovirus SG655-GMP3 expression 11R-P53 fusion proteins is higher than control disease The expression quantity of malicious p53 albumen.

2. recombination oncolytic adenovirus SG655-GMP3 each virus clone supernatant is taken respectively, employment after dilution certain multiple GM-CSF ELISA MAX Deluxe detection kits (being purchased from Biolegend companies) detect that the virus is respectively cloned in HEK293 The expression of hGM-CSF albumen in cell.As a result it is as shown in Figure 6.

As a result show, each clone of recombination oncolytic adenovirus SG655-GMP3 can express hGM- in HEK293 cells Csf protein, and expression quantity is higher, and the difference between each clone is little.

Embodiment 6：Recombination oncolytic adenovirus SG655-GMP3 and SG655-GMP2 are in vitro to the tumour cell of culture Killing experiments

Hepatoma cell strain Huh7 (being purchased from Chinese Academy of Sciences's biochemistry and cell research institute) is by 1 × 10⁴Cells/well is layered on 96 holes In plate, in 37 DEG C of incubator 5%CO₂Culture, second day by different MOI values gradients addition recombination oncolytic adenovirus SG655-GMP2 and SG655-GMP3 (so that No. 5 are cloned as an example), each MOI values set 3 repetitions, after cultivating 7 days, using MTT (3- (4,5- diformazans Base thiazole -2) -2,5- diphenyltetrazolium bromide bromides, it is purchased from SIGMA companies) method detection cell growth curve.

As a result it is as shown in Figure 7.

As a result show, SG655-GMP2 and SG655-GMP3 has good killing ability, and SG655- to liver cancer cells GMP3 fragmentation effect is better than SG655-GMP2, shows that the in vitro effects of CCAU promoters control therapeutic gene start better than CAG Son.

Embodiment 7：Recombination oncolytic adenovirus SG655-mGMP3 and SG655-mGMP2 zoopery

Due to species difference, mankind's GM-CSF gene is to mouse DC cells and the stingless activity of macrophage.Should for research The in vivo functionality of virus, the present invention constructs the experimental oncolytic virus SG655-mGMP for carrying mouse GM-CSF gene simultaneously. Those skilled in the art known, mankind's GM-CSF gene has good thorn to mankind DC cells and macrophage Activity.Thus, for GM-CSF this gene, functions of the SG655-mGMP in Mice Body can directly reflect Functions of the SG655-GMP in human body.

The first step：4~6 week old BALB/C nude mices 50,22~27g of average weight is trained by Shanghai Chinese Academy of Sciences experimental animal Center offer is educated, cleaning grade Animal Lab. is raised.

Second step：Extracorporeal culture human liver cancer cell Huh7, growth period adherent growth cell of taking the logarithm, 0.25% pancreatin disappears Change, centrifugation, collect after cell and to be resuspended with PBS liquid, 3000g room temperatures are centrifuged 2 minutes, abandon supernatant, then centrifugation receipts after being resuspended with PBS liquid Collect cell, adjustment concentration of cell suspension to 5 × 10⁷Individual/ml.

3rd step：In the right ribbed back portion subcutaneous vaccination Huh7 cells of nude mice, 0.1ml/ is only.After inoculation three weeks or so, it is seen that connect Plant position and subcutaneously grow the scleroma of grain of rice size, Transplanted tumor model is built up.Start treatment when Tumor diameter grows to 7-9mm.Choose Select 40 Subcutaneous Tumor Growths to 7-9mm Huh7 transplantable tumors to be treated, nude mice is divided into 4 groups at random.Method of administration is Multi-point injection in direct knurl.

4th step：The animation of daily observation mouse and the volume of periodic measurement tumour, tumour of periodic measurement Most major diameter (A) and its vertical diameter (B), by formula (A × B²)/2 calculate the volume of tumour, observe the curative effect of various dose group.

As a result it is as shown in Figure 8.

As a result show, relative to placebo (injection PBS), two kinds of gene-oncolytic adenovirus SG655-mGMP can show Write the growth (p for suppressing transplantable tumor<0.05)；And the oncolytic gland that 11R-P53 is expressed with GM-CSF gene is driven by CCAU promoters Viral SG655-mGMP2 is shown stronger relative to the control oncolytic adenovirus SG655-mGMP2 driven by CAG promoters Suppress tumour growth effect, gross tumor volume is significantly less than comparison virus group, there is notable significant difference (p always<0.05), specifically As shown in Figure 8.Gene-oncolytic adenovirus SG655-mGMP3 is better than SG655- to the antitumor action of liver cancer animal model MGMP2, shows that internal effect of the CCAU promoters in therapy of tumor is better than CAG promoters.

Although the embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.Root According to disclosed all teachings, various modifications and replacement can be carried out to those details, these change the guarantor in the present invention Within the scope of shield.The four corner of the present invention is provided by appended claims and its any equivalent.

Sequence table

<110>Eastern Hepatobiliary Hospital, the Second Military Medical University of Chines

Shanghai Allbright Biotech Co., Ltd.

<120>A kind of chimeric strong promoter and application thereof

<130> IDC170029

<160> 23

<170> PatentIn version 3.2

<210> 1

<211> 1093

<212> DNA

<213>Artificial sequence

<400> 1

ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc 60

ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag ggactttcca 120

ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac atcaagtgta 180

tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta 240

tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg tattagtcat 300

cgctattacc atggtcgagg tgagccccac gttctgcttc actctcccca tctccccccc 360

ctccccaccc ccaattttgt atttatttat tttttaatta ttttgtgcag cgatgggggc 420

gggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg gggcggggcg 480

aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt tccttttatg 540

gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc gggagtcgct 600

gcgcgctgcc ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc gccccggctc 660

tgactgaccg cgttactaaa acaggtaagt ccctgagtca ttagggactt tccaatgggt 720

tttgcccagt acataaggtc aataggggtg aatcaacagg aaagtcccat tggagccaag 780

tacactgagt caatagggac tttccattgg gttttgccca gtacaaaagg tcaatagggg 840

gtgagtcaat gggtttttcc cattattggc acgtacataa ggtcaatagg ggtgagtcat 900

tgggtttttc cagccaattt aattaaaacg ccatgtactt tcccaccatt gacgtcaatg 960

ggctattgaa actaatgcaa cgtgaccttt aaacggtact ttcccatagc tgattaatgg 1020

gaaagtaccg ttcgcctcta ctaaccatgt tcatgttttc tttttttttc tacaggtcct 1080

gggtgacgaa cag 1093

<210> 2

<211> 1396

<212> DNA

<213>Artificial sequence

<400> 2

ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc 60

ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag ggactttcca 120

ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac atcaagtgta 180

tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta 240

tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg tattagtcat 300

cgctattacc atggtcgagg tgagccccac gttctgcttc actctcccca tctccccccc 360

ctccccaccc ccaattttgt atttatttat tttttaatta ttttgtgcag cgatgggggc 420

gggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg gggcggggcg 480

aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt tccttttatg 540

gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc gggagtcgct 600

gcgcgctgcc ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc gccccggctc 660

tgactgaccg cgttactaaa acaggtaagt ccctgagtca ttagggactt tccaatgggt 720

tttgcccagt acataaggtc aataggggtg aatcaacagg aaagtcccat tggagccaag 780

tacactgagt caatagggac tttccattgg gttttgccca gtacaaaagg tcaatagggg 840

gtgagtcaat gggtttttcc cattattggc acgtacataa ggtcaatagg ggtgagtcat 900

tgggtttttc cagccaattt aattaaaacg ccatgtactt tcccaccatt gacgtcaatg 960

ggctattgaa actaatgcaa cgtgaccttt aaacggtact ttcccatagc tgattaatgg 1020

gaaagtaccg ttcggcctcc gcgccgggtt ttggcgcctc ccgcgggcgc ccccctcctc 1080

acggcgagcg ctgccacgtc agacgaaggg cgcagcgagc gtcctgatcc ttccgcccgg 1140

acgctcagga cagcggcccg ctgctcataa gactcggcct tagaacccca gtatcagcag 1200

aaggacattt taggacggga cttgggtgac tctagggcac tggttttctt tccagagagc 1260

ggaacaggcg aggaaaagta gtcccttctc ggcgattctg cggagggatc tccgtggggc 1320

ggtgaacgcc gatgatgcct ctactaacca tgttcatgtt ttcttttttt ttctacaggt 1380

cctgggtgac gaacag 1396

<210> 3

<211> 1305

<212> DNA

<213>Artificial sequence

<400> 3

actgagtcat tagggacttt ccattgggtt ttgcccagta caaaaggtca atagggggtg 60

agtcaatggg tttttcccat tattggcacg tacataaggt caataggggt gagtcattgg 120

gtttttccag ccaatttaat taaaacgcca tgtactttcc caccattgac gtcaatgggc 180

tattgaaact aatgcaacgt gacctttaaa cggtactttc ccatagctga ttaatgggaa 240

agtaccgttc ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 300

ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 360

ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac 420

atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 480

cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 540

tattagtcat cgctattacc atggtcgagg tgagccccac gttctgcttc actctcccca 600

tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta ttttgtgcag 660

cgatgggggc gggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg 720

gggcggggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 780

tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 840

gggagtcgct gcgcgctgcc ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc 900

gccccggctc tgactgaccg cgttactaaa acaggtaagt ccggcctccg cgccgggttt 960

tggcgcctcc cgcgggcgcc cccctcctca cggcgagcgc tgccacgtca gacgaagggc 1020

gcagcgagcg tcctgatcct tccgcccgga cgctcaggac agcggcccgc tgctcataag 1080

actcggcctt agaaccccag tatcagcaga aggacatttt aggacgggac ttgggtgact 1140

ctagggcact ggttttcttt ccagagagcg gaacaggcga ggaaaagtag tcccttctcg 1200

gcgattctgc ggagggatct ccgtggggcg gtgaacgccg atgatgcctc tactaaccat 1260

gttcatgttt tctttttttt tctacaggtc ctgggtgacg aacag 1305

<210> 4

<211> 2048

<212> DNA

<213>Artificial sequence

<400> 4

ctgagtcatt agggactttc caatgggttt tgcccagtac ataaggtcaa taggggtgaa 60

tcaacaggaa agtcccattg gagccaagta cactgagtca atagggactt tccattgggt 120

tttgcccagt acaaaaggtc aatagggggt gagtcaatgg gtttttccca ttattggcac 180

gtacataagg tcaatagggg tgagtcattg ggtttttcca gccaatttaa ttaaaacgcc 240

atgtactttc ccaccattga cgtcaatggg ctattgaaac taatgcaacg tgacctttaa 300

acggtacttt cccatagctg attaatggga aagtaccgtt cggagttccg cgttacataa 360

cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata 420

atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggag 480

tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc 540

cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta 600

tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac cactgagtca 660

ttagggactt tccaatgggt tttgcccagt acataaggtc aataggggtg aatcaacagg 720

aaagtcccat tggagccaag tacactgagt caatagggac tttccattgg gttttgccca 780

gtacaaaagg tcaatagggg gtgagtcaat gggtttttcc cattattggc acgtacataa 840

ggtcaatagg ggtgagtcat tgggtttttc cagccaattt aattaaaacg ccatgtactt 900

tcccaccatt gacgtcaatg ggctattgaa actaatgcaa cgtgaccttt aaacggtact 960

ttcccatagc tgattaatgg gaaagtaccg ttcggagttc cgcgttacat aacttacggt 1020

aaatggcccg cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta 1080

tgttcccata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 1140

gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 1200

cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt 1260

tcctacttgg cagtacatct acgtattagt catcgctatt accatggtcg aggtgagccc 1320

cacgttctgc ttcactctcc ccatctcccc cccctcccca cccccaattt tgtatttatt 1380

tattttttaa ttattttgtg cagcgatggg ggcggggggg ggggggggcg cgcgccaggc 1440

ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga gaggtgcggc ggcagccaat 1500

cagagcggcg cgctccgaaa gtttcctttt atggcgaggc ggcggcggcg gcggccctat 1560

aaaaagcgaa gcgcgcggcg ggcgggagtc gctgcgcgct gccttcgccc cgtgccccgc 1620

tccgccgccg cctcgcgccg cccgccccgg ctctgactga ccgcgttact aaaacaggta 1680

agtccggcct ccgcgccggg ttttggcgcc tcccgcgggc gcccccctcc tcacggcgag 1740

cgctgccacg tcagacgaag ggcgcagcga gcgtcctgat ccttccgccc ggacgctcag 1800

gacagcggcc cgctgctcat aagactcggc cttagaaccc cagtatcagc agaaggacat 1860

tttaggacgg gacttgggtg actctagggc actggttttc tttccagaga gcggaacagg 1920

cgaggaaaag tagtcccttc tcggcgattc tgcggaggga tctccgtggg gcggtgaacg 1980

ccgatgatgc ctctactaac catgttcatg ttttcttttt ttttctacag gtcctgggtg 2040

acgaacag 2048

<210> 5

<211> 29

<212> DNA

<213>Artificial sequence

<400> 5

gccgaattcg ccaccatgac ttcgaaagt 29

<210> 6

<211> 35

<212> DNA

<213>Artificial sequence

<400> 6

tgtgtcgact tattgttcat ttttgagaac tcgct 35

<210> 7

<211> 33

<212> DNA

<213>Artificial sequence

<400> 7

gccgctagct ctagttatta atagtaatca att 33

<210> 8

<211> 33

<212> DNA

<213>Artificial sequence

<400> 8

tgtgaattct ttgccaaaat gatgagacag cac 33

<210> 9

<211> 27

<212> DNA

<213>Artificial sequence

<400> 9

gccgaattcg ccaccatgga agacgcc 27

<210> 10

<211> 29

<212> DNA

<213>Artificial sequence

<400> 10

tgtgtcgact tacacggcga tctttccgc 29

<210> 11

<211> 154

<212> DNA

<213>Artificial sequence

<400> 11

agagaaatgt tctggcacct gcacttgcac tggggacagc ctattttgct agtttgtttt 60

gtttcgtttt gttttgatgg agagcgtatg ttagtactat cgattcacac aaaaaaccaa 120

cacacagatg taatgaaaat aaagatattt tatt 154

<210> 12

<211> 1215

<212> DNA

<213>Artificial sequence

<400> 12

atgggccgcc gcaggagacg acggcgacgg cgaagaaggg aggagccgca gtcagatcct 60

agcgtcgagc cccctctgag tcaggaaaca ttttcagacc tatggaaact acttcctgaa 120

aacaacgttc tgtccccctt gccgtcccaa gcaatggatg atttgatgct gtccccggac 180

gatattgaac aatggttcac tgaagaccca ggtccagatg aagctcccag aatgccagag 240

gctgctcccc gcgtggcccc tgcaccagca gctcctacac cggcggcccc tgcaccagcc 300

ccctcctggc ccctgtcatc ttctgtccct tcccagaaaa cctaccaggg cagctacggt 360

ttccgtctgg gcttcttgca ttctgggaca gccaagtctg tgacttgcac gtactcccct 420

gccctcaaca agatgttttg ccaactggcc aagacctgcc ctgtgcagct gtgggttgat 480

tccacacccc cgcccggcac ccgcgtccgc gccatggcca tctacaagca gtcacagcac 540

atgacggagg ttgtgaggcg ctgcccccac catgagcgct gctcagatag cgatggtctg 600

gcccctcctc agcatcttat ccgagtggaa ggaaatttgc gtgtggagta tttggatgac 660

agaaacactt ttcgacatag tgtggtggtg ccctatgagc cgcctgaggt tggctctgac 720

tgtaccacca tccactacaa ctacatgtgt aacagttcct gcatgggcgg catgaaccgg 780

aggcccatcc tcaccatcat cacactggaa gactccagtg gtaatctact gggacggaac 840

agctttgagg tgcgtgtttg tgcctgtcct gggagagacc ggcgcacaga ggaagagaat 900

ctccgcaaga aaggggagcc tcaccacgag ctgcccccag ggagcactaa gcgagcactg 960

cccaacaaca ccagctcctc tccccagcca aagaagaaac cactggatgg agaatatttc 1020

acccttcaga tccgtgggcg tgagcgcttc gagatgttcc gagagctgaa tgaggccttg 1080

gaactcaagg atgcccaggc tgggaaggag ccagggggga gcagggctca ctccagccac 1140

ctgaagtcca aaaagggtca gtctacctcc cgccataaaa aactcatgtt caagacagaa 1200

gggcctgact cagac 1215

<210> 13

<211> 435

<212> DNA

<213>Artificial sequence

<400> 13

atgtggctgc agagcctgct gctcttgggc actgtggcct gcagcatctc tgcacccgcc 60

cgctcgccca gccccagcac gcagccctgg gagcatgtga atgccatcca ggaggcccgg 120

cgtctcctga acctgagtag agacactgct gctgagatga atgaaacagt agaagtcatc 180

tcagaaatgt ttgacctcca ggagccgacc tgcctacaga cccgcctgga gctgtacaag 240

cagggcctgc ggggcagcct caccaagctc aagggcccct tgaccatgat ggccagccac 300

tacaagcagc actgccctcc aaccccggaa acttcctgtg caacccagat tatcaccttt 360

gaaagtttca aagagaacct gaaggacttt ctgcttgtca tcccctttga ctgctgggag 420

ccagtccagg agtga 435

<210> 14

<211> 426

<212> DNA

<213>Artificial sequence

<400> 14

atgtggctgc agaatttact tttcctgggc attgtggtct acagcctctc agcacccacc 60

cgctcaccca tcactgtcac ccggccttgg aagcatgtag aggccatcaa agaagccctg 120

aacctcctgg atgacatgcc tgtcacgttg aatgaagagg tagaagtcgt ctctaacgag 180

ttctccttca agaagctaac atgtgtgcag acccgcctga agatattcga gcagggtcta 240

cggggcaatt tcaccaaact caagggcgcc ttgaacatga cagccagcta ctaccagaca 300

tactgccccc caactccgga aacggactgt gaaacacaag ttaccaccta tgcggatttc 360

atagacagcc ttaaaacctt tctgactgat atcccctttg aatgcaaaaa accaggccaa 420

aaatga 426

<210> 15

<211> 84

<212> DNA

<213>Artificial sequence

<400> 15

cgtaaaaggc gagctcctgt taaacagact ttgaattttg accttctcaa gttggcggga 60

gacgtcgagt ccaaccctgg gccc 84

<210> 16

<211> 2281

<212> DNA

<213>Artificial sequence

<400> 16

gaattctcat gtttgacagc ttatcatcga taagctttaa tgcggtagtt tatcacagtt 60

aaattgctaa cgcagtcagg caccgtgtat gaaatctaac aatgcgctca tcgtcatcct 120

cggcaccgtc accctggatg ctgtaggcat aggcttggtt atgccggtac tgccgggcct 180

cttgcgggat atcgtccatt ccgacagcat cgccagtcac tatggcgtgc tgctagcgct 240

atatgcgttg atgcaatttc tatgcgcacc cgttctcgga gcactgtccg accgctttgg 300

ccgccgccca gtcctgctcg cttcgctact tggagccact atcgactacg cgatcatggc 360

gaccacaccc gtcctgtgga tccgggcccc catttcccct cccttccagc tctctgcccc 420

ttttggattg aagccaatat gataatgagg gggtggagtt tgtgacgtgg cgcggggcgt 480

gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg atgttgcaag tgtggcggaa 540

cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg tgtgcgccgg tgtacacagg 600

aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt aaatttgggc gtaaccgagt 660

aagatttggc cattttcgcg ggaaaactga ataagaggaa gtgaaatctg aataattttg 720

tgttactcat agcgcgtaat ttctagtaat aaaggatcct ttattttcat tggatccgtg 780

tgttggtttt ttgtgtgcgg ccgcgtaccg gtcacagacg cccaggaccg cgcttcccac 840

gtggcggagg gactggggac ccgggcaccc gtcctgcccc ttcaccttcc agctccgcct 900

cctccgcgcg gaccccgccc cgtcccgacc cctcccgggt ccccggccca gccccctccg 960

ggccctccca gcccctcccc ttcctttccg cggccccgcc ctctcctcgc ggcgcgagtt 1020

tcaggcagcg ctgcgtcctg ctgcgcacgt gggaagccct ggccccggcc actcgaggac 1080

gcacgtgggt tcgaatgaaa atgagacata ttatctgcca cggaggtgtt attaccgaag 1140

aaatggccgc cagtcttttg gaccagctga tcgaagaggt actggctgat aatcttccac 1200

ctcctagcca ttttgaacca cctacccttc acgaactgta tgatttagac gtgacggccc 1260

ccgaagatcc caacgaggag gcggtttcgc agatttttcc cgactctgta atgttggcgg 1320

tgcaggaagg gattgactta ctcacttttc cgccggcgcc cggttctccg gagccgcctc 1380

acctttcccg gcagcccgag cagccggagc agagagcctt gggtccggtt tctatgccaa 1440

accttgtacc ggaggtgatc gatcttacct gccacgaggc tggctttcca cccagtgacg 1500

acgaggatga agagggtgag gagtttgtgt tagattatgt ggagcacccc gggcacggtt 1560

gcaggtcttg tcattatcac cggaggaata cgggggaccc agatattatg tgttcgcttt 1620

gctatatgag gacctgtggc atgtttgtct acagtaagtg aaaattatgg gcagtgggtg 1680

atagagtggt gggtttggtg tggtaatttt ttttttaatt tttacagttt tgtggtttaa 1740

agaattttgt attgtgattt ttttaaaagg tcctgtgtct gaacctgagc ctgagcccga 1800

gccagaaccg gagcctgcaa gacctacccg ccgtcctaaa atggcgcctg ctatcctgag 1860

acgcccgaca tcacctgtgt ctagagaatg caatagtagt acggatagct gtgactccgg 1920

tccttctaac acacctcctg agatacaccc ggtggtcccg ctgtgcccca ttaaaccagt 1980

tgccgtgaga gttggtgggc gtcgccaggc tgtggaatgt atcgaggact tgcttaacga 2040

gcctgggcaa cctttggact tgagctgtaa acgccccagg ccataaggtg taaacctgtg 2100

attgcgtgtg tggttaacgc ctttgtttgc tgaatgagtt gatgtaagtt taataaaggg 2160

tgagataatg tttaacttgc atggcgtgtt aaatggggcg gggcttaaag ggtatataat 2220

gcgccgtggg ctaatcttgg ttacatctga cctcatggag gcttgggagt gttaaagatc 2280

t 2281

<210> 17

<211> 311

<212> DNA

<213>Artificial sequence

<400> 17

ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc 60

ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag ggactttcca 120

ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac atcaagtgta 180

tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta 240

tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg tattagtcat 300

cgctattacc a 311

<210> 18

<211> 366

<212> DNA

<213>Artificial sequence

<400> 18

tggtcgaggt gagccccacg ttctgcttca ctctccccat ctcccccccc tccccacccc 60

caattttgta tttatttatt ttttaattat tttgtgcagc gatgggggcg gggggggggg 120

ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg ggcggggcga ggcggagagg 180

tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt ccttttatgg cgaggcggcg 240

gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg ggagtcgctg cgcgctgcct 300

tcgccccgtg ccccgctccg ccgccgcctc gcgccgcccg ccccggctct gactgaccgc 360

gttact 366

<210> 19

<211> 341

<212> DNA

<213>Artificial sequence

<400> 19

ctgagtcatt agggactttc caatgggttt tgcccagtac ataaggtcaa taggggtgaa 60

tcaacaggaa agtcccattg gagccaagta cactgagtca atagggactt tccattgggt 120

tttgcccagt acaaaaggtc aatagggggt gagtcaatgg gtttttccca ttattggcac 180

gtacataagg tcaatagggg tgagtcattg ggtttttcca gccaatttaa ttaaaacgcc 240

atgtactttc ccaccattga cgtcaatggg ctattgaaac taatgcaacg tgacctttaa 300

acggtacttt cccatagctg attaatggga aagtaccgtt c 341

<210> 20

<211> 250

<212> DNA

<213>Artificial sequence

<400> 20

actgagtcat tagggacttt ccattgggtt ttgcccagta caaaaggtca atagggggtg 60

agtcaatggg tttttcccat tattggcacg tacataaggt caataggggt gagtcattgg 120

gtttttccag ccaatttaat taaaacgcca tgtactttcc caccattgac gtcaatgggc 180

tattgaaact aatgcaacgt gacctttaaa cggtactttc ccatagctga ttaatgggaa 240

agtaccgttc 250

<210> 21

<211> 303

<212> DNA

<213>Artificial sequence

<400> 21

ggcctccgcg ccgggttttg gcgcctcccg cgggcgcccc cctcctcacg gcgagcgctg 60

ccacgtcaga cgaagggcgc agcgagcgtc ctgatccttc cgcccggacg ctcaggacag 120

cggcccgctg ctcataagac tcggccttag aaccccagta tcagcagaag gacattttag 180

gacgggactt gggtgactct agggcactgg ttttctttcc agagagcgga acaggcgagg 240

aaaagtagtc ccttctcggc gattctgcgg agggatctcc gtggggcggt gaacgccgat 300

gat 303

<210> 22

<211> 15

<212> DNA

<213>Artificial sequence

<400> 22

aaaacaggta agtcc 15

<210> 23

<211> 60

<212> DNA

<213>Artificial sequence

<400> 23

gcctctacta accatgttca tgttttcttt ttttttctac aggtcctggg tgacgaacag 60

Claims (13)

1. a kind of polynucleotides of separation, it includes following element：

HCMV enhancers, β-Actin promoters and mCMV enhancers；

It also includes Ubi enhancers, and the Ubi enhancers are located at the downstream of above-mentioned 3 kinds of elements；

And the polynucleotides are included successively：

MCMV enhancer+hCMV enhancer+β-Actin promoter+Ubi enhancers；

The polynucleotides have promoter function.

2. polynucleotides according to claim 1, wherein, 4 kinds of elements be each independently 1,2,3 or 3 with On.

3. polynucleotides according to claim 1, wherein：

The nucleotide sequence of hCMV enhancers such as SEQ ID NO：Shown in 17；

The nucleotide sequence of β-Actin promoters such as SEQ ID NO：Shown in 18；

The nucleotide sequence of mCMV enhancers such as SEQ ID NO：19 or SEQ ID NO：Shown in 20；Preferably SEQ ID NO： 20；

The nucleotide sequence of Ubi enhancers such as SEQ ID NO：Shown in 21.

4. be with or without between polynucleotides according to any one of claim 1 to 3, its each element catenation sequence or Person's splice site；Preferably, have respectively in the upstream and downstream of mCMV enhancers and/or hCMV enhancers and/or Ubi enhancers Donor splicing site and acceptor splicing site；It is highly preferred that the nucleotide sequence of the donor splicing site such as SEQ ID NO：Shown in 22；It is described to cut The nucleotide sequence of acceptor such as SEQ ID NO：Shown in 23.

5. a kind of polynucleotides of separation, it is any one group in following a-e of polynucleotides：

a.SEQ ID NO：Polynucleotides shown in 3；

B. with SEQ ID NO：3 complementary polynucleotides；

C. it can hybridize and have the polynucleotides of promoter function with above-mentioned a or b polynucleotides under the conditions of high stringency；

D. substitution, missing, the addition that polynucleotides shown in above-mentioned a or b are carried out with one or more bases are modified and with startup The polynucleotides of subfunction；With

E. there are at least 90% homogeneity and the polynucleotides with promoter function with polynucleotides shown in above-mentioned a or b；

And the polynucleotides in a or b have promoter function.

6. a kind of nucleic acid construct, comprising the polynucleotides any one of claim 1 to 5, and is operably connected Foreign gene；Preferably, the foreign gene be selected from p53, GM-CSF, IL-2, IL-12, IL-24, Trail, p16, TK, Any one or more in IFN γ, TNF α, Rb, Sirp α etc.；Preferably, the foreign gene is SEQ ID NO：Shown in 12 P53 and/or SEQ ID NO：13 or SEQ ID NO：GM-CSF shown in 14.

7. a kind of recombinant vector, it contains described in polynucleotides or claim 6 any one of claim 1 to 5 Nucleic acid construct；Preferably, the recombinant vector is recombinant viral vector；Preferably, the recombinant vector is claim 1 To the nucleic acid construct described in the polynucleotides or claim 6 any one of 5 and pDC315 plasmids or SG655 through weight The recombinant vector that group is obtained.

8. a kind of Pharmaceutical composition, it includes the polynucleotides any one of claim 1 to 5 or claim 6 institute The recombinant vector described in nucleic acid construct or claim 7 stated, and optional pharmaceutically acceptable auxiliary material.

9. the purposes selected from following (1) or (2)：

(1) nucleic acid construct or power described in the polynucleotides or claim 6 any one of claim 1 to 5 Profit requires purposes of the recombinant vector in treatment and/or pre- anti-cancer or anti-tumor drug is prepared described in 7；Preferably, The cancer or tumour are lung cancer, hepatocellular carcinoma, lymthoma, colon cancer, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, stomach Cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, glioma, melanoma, cancer of pancreas or prostate cancer；

(2) nucleic acid construct or power described in the polynucleotides or claim 6 any one of claim 1 to 5 Profit requires that the recombinant vector described in 7 is preparing the purposes in suppressing the medicine or reagent of tumour cell；Preferably, the tumour Cell is the cell of following tumour：Lung cancer, hepatocellular carcinoma, lymthoma, colon cancer, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, Stomach cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, glioma, melanoma, cancer of pancreas or prostate cancer；Specific In embodiment, the tumour cell is selected from Hep3B, Huh7, HepG2, PLC/PRF/5, BEL-7404, H460 and H1299 Any one in cell.

10. a kind of method for suppressing tumour cell in vitro, including the use of any one of the claim 1 to 5 of effective dose Polynucleotides or claim 6 described in nucleic acid construct or the step of recombinant vector described in claim 7；It is preferred that Ground, the tumour cell is the cell of following tumour：Lung cancer, hepatocellular carcinoma, lymthoma, colon cancer, colorectal cancer, breast cancer, ovum Nest cancer, cervical carcinoma, stomach cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, glioma, melanoma, cancer of pancreas or prostate Cancer；In specific embodiments, the tumour cell be selected from Hep3B, Huh7, HepG2, PLC/PRF/5, BEL-7404, Any one in H460 and H1299 cells.

11. purposes of the polynucleotides any one of claim 1 to 5 in as promoter.

12. a kind of polynucleotides of separation, it is SEQ ID NO：Nucleotide sequence or its complementary series shown in 20.

13. purposes of the polynucleotides in promoter is prepared described in claim 12；Preferably, the promoter is with opening Polynucleotides any one of the claim 1 to 5 of mover function.