CN104745581B - A kind of promoter and application thereof of T cell high activity - Google Patents
A kind of promoter and application thereof of T cell high activity Download PDFInfo
- Publication number
- CN104745581B CN104745581B CN201510021408.1A CN201510021408A CN104745581B CN 104745581 B CN104745581 B CN 104745581B CN 201510021408 A CN201510021408 A CN 201510021408A CN 104745581 B CN104745581 B CN 104745581B
- Authority
- CN
- China
- Prior art keywords
- promoter
- cell
- cancer
- recombinant
- polynucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology fields, are related to a kind of promoter and application thereof of T cell high activity.Specifically, the promoter of the T cell high activity includes element 1 and element 2, wherein the element 1 is EF1 α promoter and/or the EF1 α promoter containing introne；The element 2 be in mCMV enhancer, hCMV enhancer and CD3e enhancer any one, two or three.Promoter of the invention can in T cell efficiently expressing exogenous gene, and sequence stablize, will not occur in prokaryotic cell and eukaryocyte transfer process sequence lose.The promoter is applicable to during adoptive cellular immunotherapy, and driving includes foreign gene especially high efficient expression of the full length antibody gene in T cell.
Description
Technical field
The invention belongs to molecular biology fields, are related to a kind of promoter, and in particular, to a kind of artificial synthesized is fitted into
Promoter, the promoter have high activity in T cell.The invention further relates to the recombinant vectors containing the promoter, recombination disease
The purposes of poison and promoter control foreign gene in transgenic T cells treatment.
Background technique
Immunization therapy for malignant tumour is quickly grown in recent years, obtains the clinical efficacy to attract people's attention.2011,
Nature and the most top magazine JCO of clinical tumor deliver commenting for same title " epoch of immunotherapy of tumors having arrived " respectively
Paper chapter (Nature.2011；480(7378):480；J Clin Oncol.2011；29 (36): 4828), it is believed that tumour immunity
Cell therapy will welcome the research climax of a new round, and future is possible to occupy considerable status in oncotherapy.And
In industrialization field, the report of 2013 U.S. Nian8Yue Gaoshengs, eight may change greatly the field innovation in the world, immunotherapy for cancer row
Name second expects the market only beginning for having hundred million dollars of 100-150 for 2025.It is swollen to be still used for advanced stage for the therapy at present
Tumor patient treatment, but it as chemotherapy, may become a line method for the treatment of of cancer in the future.Recently, Citibank analyst
Think that the patients with advanced cancer of coming 10 years 60% will use immunization therapy, in the U.S. up to 35,000,000,000 dollars.
Currently, the big hot spot of immunization therapy two is respectively: the treatment of 1. immunologic test point monoclonal antibodies, including CTLA-4 monoclonal antibody and PD-1
Monoclonal antibody；2. transgenosis CAR-T cell therapy (T cell after Chimeric antigen receptor gene modification) or transgenosis TCR-T cell
It treats (T cell through T cell receptor gene modification).It merges around the business of the two hot spots and is showed again and again with investment case.
Thus, as can the means modified by transgenosis, have the monoclonal antibody of functional activity (for example, immunologic test point using T cell expression
Monoclonal antibody), then it can cooperate with and play antitumor cell immune (mainly being mediated by killer T cell) and humoral immunity (mainly by antibody
Mediate) double effect, play better antitumous effect.To reach the purpose, the suitable full length antibody expression of building one
System is very crucial.
Promoter is a component part of gene, be usually located at structural gene 5 ' hold upstream, be RNA polymerase identification,
In conjunction with start transcription section of DNA sequence.Promoter can instruct holoenzyme (holoenzyme) correctly to combine with template, activation
RNA polymerase, promotor gene transcription, to control the initial time of gene expression (transcription) and the degree of expression.Promoter is
One of an important factor for influencing transgene expression efficiency, selecting efficient promoter is the pass of high-efficient expression foreign gene
Key.
3 classes: constitutive promoter, tissue or organ specific promoters can be classified as according to the transcriptional profile of promoter
And inducible promoter.So-called constitutive promoter refer to constitutive promoter regulation under, different tissues organ and development rank
The gene expression of section does not have notable difference, thus referred to as constitutive promoter.
Common constitutive promoter includes viral source in mammal: mouse or human cytomegalovirus (CMV) promoter
(abbreviation mCMV and hCMV respectively), vacuolating virus of monkey SV40 promoter；Human genome natural origin: EF1 α promoter, ubiquitin open
Mover (Ubiquitin, abbreviation Ubi), β-actin promoter, PGK-1 promoter, Rosa26 promoter, HSP70 promoter,
GAPDH promoter, eIF4A1 promoter, Egr1 promoter, FerH promoter, SM22 α promoter, Endothelin-1 promoter
Deng.
Mammal often includes: B29 promoter (B cell specificity), CD14 promoter (list with tissue-specific promoter
A nucleus specificity), CD43 promoter (lymphocyte and blood-platelet specific), CD45 and INF- β promoter (hematopoietic cell
Specificity), CD68 promoter (macrophage specificity), Desmin and Myoglobin promoter (muscle cell specificity),
CD105 and CD102 promoter (endothelial cell specific), GFAP promoter (astroglia specificity), GPIIb promoter
(megacaryocyte specificity), Surfactant Protein B promoter (lung specificity), (mature neuron is thin for NSE promoter
Born of the same parents' specificity), Alb promoter (liver specificity) etc..
Common tumor-specific promoters include: AFP promoter (liver cancer-specific), (cancer of pancreas is special for CCKAR promoter
Property), PSA promoter (prostatic cancer specific), Tyr promoter (melanoma specificity), hTERT promoter/CEA starting
Son/Survivin promoter/CXCR4 promoter/COX-2/L-plastin promoter/epididymis protein 4 starts
Son/E2F1 promoter (tumour Broadspectrum specificity) etc..
Common inducible promoter include: based on tetracycline (Tet) system inducible promoter (including Tet-On or
Tet-off), the inducible promoter of molting hormone class inducible system, FK506 regulator control system inducible promoter, receive it is bar mould
Inducible promoter, inducible promoter of RU486 inducible system of plain inducible system etc..
Although we have built up adenovirus mediated full length antibody gene expression system, and just in research before
Step realizes the full length antibody that the expression in T cell has functional activity, but due to lacking suitable promoter, antibody expression amount
It is difficult to reach treatment concentration.Thus, to realize the efficiently expressing exogenous gene especially full length antibody gene in T cell, it is badly in need of
It designs and constructs high activity promoter in new T cell.
Summary of the invention
The present inventor is by a large amount of test and creative labor, design construction a series of new chimeric promoters,
And therefrom screening obtain one group can in T cell high efficient expression promoter.Surprisingly, it was found that with other parallel structures
The chimeric promoters built are different, and promoter sequence of the present invention is stablized, will not be with its turning in prokaryotic cell or eukaryocyte
It moves and sequence Loss occurs.The promoter is especially suitable for driving foreign gene (such as full length antibody gene) in T cell
High efficient expression.Thus provide following inventions:
One aspect of the present invention is related to a kind of isolated polynucleotides, it includes element 1 and element 2,
Wherein,
The element 1 is EF1 α promoter and/or the EF1 α promoter containing introne；
The element 2 be in mCMV enhancer, hCMV enhancer and CD3e enhancer any one, two or
Three.
Specifically, the polynucleotides are promoter；More specifically, being chimeric promoters.
In one embodiment of the invention, the polynucleotides are made of the element 1 and the element 2.
In one embodiment of the invention, the element 1 is single copy or multicopy and/or the element 2 is
Single copy or multicopy.
In one embodiment of the invention, mCMV enhancer, hCMV enhancer or CD3e selected in the element 2
Enhancer independently is single copy or multicopy.
It is not limited to theoretical limitation, mCMV enhancer and hCMV enhancer derive from the same type virus base of different genera
Because of group (being Muromegalovirus and human cytomegalovirus category respectively), function is close, corresponding DNA sequence dna homology compared with
It is high.Thus, previously research is usually used alone as the cis-acting elements of function replacement, combines them even if having
The considerations of use, high in view of the two sequence similarity, there is also the unstable risks being easily lost of sequence.One major reason
It is, either prokaryotic expression carrier or carrier for expression of eukaryon, is replicated in host, relates to the participation of archaeal dna polymerase, and
Archaeal dna polymerase is in the reproduction process to repetitive sequence due to the complexity of template, it is possible to certain repetitive units can be leaked through,
Lead to the loss of sequence.This belongs to a kind of common recognition in genetic manipulation field.Corresponding document can be poly- with reference to DNA during PCR
Synthase to repetitive sequence template amplification when existing mismatching phenomenon.Bias and artifacts in multitemplate
polymerase chain reactions(PCR).J Biosci Bioeng.2003；96(4):317-23.
According to polynucleotides described in any of the above item, wherein the element 2 is located at the upstream (5 ' end) of the element 1.
According to polynucleotides described in any of the above item, successively include:
(1) mCMV enhancer+hCMV enhancer+EF1 α promoter,
(2) CD3e enhancer+EF1 α promoter,
(3) CD3e enhancer+mCMV enhancer+hCMV enhancer+EF1 α promoter,
(4) mCMV enhancer+hCMV enhancer+EF1 α promoter containing introne,
(5) CD3e enhancer+EF1 α promoter containing introne, or
(6) CD3e enhancer+mCMV enhancer+hCMV enhancer+EF1 α promoter containing introne.
According to polynucleotides described in any of the above item, wherein
The nucleotide sequence of the mCMV enhancer is as shown in SEQ ID NO:17；
The nucleotide sequence of the hCMV enhancer is as shown in SEQ ID NO:18；
The nucleotide sequence of the CD3e enhancer is as shown in SEQ ID NO:19；
The nucleotide sequence of the EF1 α promoter is as shown in SEQ ID NO:12；And/or
The nucleotide sequence of the EF1 α promoter containing introne is as shown in SEQ ID NO:13.
MCMV enhancer (stable sequence):
ACTGAGTCATTAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATG
GGTTTTTCCAGCCAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGC
AACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACCGTTC (SEQ ID NO:17)
In a preferred embodiment of the present invention, used above-mentioned mCMV enhancer sequence (SEQ ID NO:17) is under
Face wild type mCMV enhancer sequence (SEQ ID NO:20) is different.The present inventor has selected wild type in the research of early period
MCMV enhancer sequence, but after it is merged with EF1 α promoter, in the cell occurrence sequence Loss during recombinant conversion.
Applicant also has found that the partial sequence loss of wild type mCMV is often random in many experiments, often will lead to enhancing
The decrease of subfunction is even lost.But currently preferred mCMV enhancer (SEQ ID NO:17) is used, it will not be in cell
Occurs partial sequence Loss during interior recombinant conversion.
Wild type mCMV enhancer:
CTGAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGG ACTGAGTCAA
TAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTG TGAGTCATTGGGTTT
TTCCAGCCAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGT
(SEQ ID NO:20, wherein box indicates GACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACCGTTC
One of the major part that sequence is lost)
HCMV enhancer:
GGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCAT
TGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTT
ACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGT
AAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAG
TCATCGCTATTACCA (SEQ ID NO:18)
CD3e enhancer:
AAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCC
ATGACATCATGAAAGTTTCCATGACATCATGACAAATTAATTAAAAATAAAGAACATGATGCAAATTAATTAAAAA
TAAAGAACATGATGCAAATTAATTAAAAATAAAGAACATGATG (SEQ ID NO:19)
The nucleotide sequence of EF1 α promoter and the nucleotide sequence of the EF1 α promoter containing introne please respectively referring to
SEQ ID NO:12 and SEQ ID NO:13 in embodiment 1.
The invention further relates to a kind of isolated polynucleotides, and it includes or for any one group in a-e chosen from the followings
Polynucleotides:
Polynucleotides shown in any sequence in a.SEQ ID NO:1-SEQ ID NO:6；
B. the polynucleotides complementary with any sequence in SEQ ID NO:1-SEQ ID NO:6；
C. it can hybridize and have the multicore of promoter function with the polynucleotides of above-mentioned a or b under the conditions of high stringency
Thuja acid；
D. substitution, missing, the addition for carrying out one or more bases to polynucleotides shown in above-mentioned a or b are modified and are had
The polynucleotides of promoter function；With
E. with polynucleotides shown in above-mentioned a or b at least 90% identity and with the polynucleotides of promoter function；
Specifically, the polynucleotides in a or b have promoter function.
CCEF the promoter (+hCMV enhancer+EF1 α of enhancer containing mCMV promoter):
ACTGAGTCATTAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATG
GGTTTTTCCAGCCAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGC
AACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACCGTTCGGAGTTCCGCGTTACATAACT
TACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATA
GTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATC
AAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA
CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCAAGGATCTGCGATCG
CTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
ACGGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGG
GTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACA
GCTGAAGCTTCGAGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTG
AGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGT
CGAGACCGGGCCTTTGTCCGGCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCT
GCTTGCTCAACTCTACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATCCAAGCTGTGACCGGCGCCTAC
(SEQ ID NO:1)
TEF the promoter (+EF1 α of enhancer containing CD3e promoter):
AAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCC
ATGACATCATGAAAGTTTCCATGACATCATGACAAATTAATTAAAAATAAAGAACATGATGCAAATTAATTAAAAA
TAAAGAACATGATGCAAATTAATTAAAAATAAAGAACATGATGAGGATCTGCGATCGCTCCGGTGCCCGTCAGTGG
GCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACGGGTGCCTAGAGAAGGT
GGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATAT
AAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGGGGCT
CGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTC
CCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCC
GGCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTC
TTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATCCAAGCTGTGACCGGCGCCTAC (SEQ ID NO:2)
TCEF the promoter (+mCMV enhancer+hCMV enhancer+EF1 α of enhancer containing CD3e promoter):
AAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCC
ATGACATCATGAAAGTTTCCATGACATCATGACAAATTAATTAAAAATAAAGAACATGATGCAAATTAATTAAAAA
TAAAGAACATGATGCAAATTAATTAAAAATAAAGAACATGATGACTGAACTGAGTCATTAGGGACTTTCCATTGGG
TTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCAGCCAATTTAATTAAAACGCCATGTAC
TTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGAT
TAATGGGAAAGTACCGTTCGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGA
CCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGG
GTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACG
TCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACAT
CTACGTATTAGTCATCGCTATTACCAGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAG
AAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCG
TGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTT
TCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTAT
GGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTG
GGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTG
GGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAAT
TTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTA
TTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCG
AGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCG
TGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCG
GCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAA
AAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
TTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGT
GGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATC
TTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGGAATTAGC(SEQ
ID NO:3)
CCEFI the promoter (+hCMV of enhancer containing the mCMV enhancer+EF1 α promoter containing introne):
ACTGAGTCATTAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATG
GGTTTTTCCAGCCAATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGC
AACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACCGTTCGGAGTTCCGCGTTACATAACT
TACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATA
GTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATC
AAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA
CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCAGCTCCGGTGCCCGT
CAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGA
GAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACC
GTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTG
TGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGT
ACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTC
GCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGT
CTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATA
GTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGC
GTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCT
GGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGG
CACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTC
GGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCC
ACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGG
AGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTA
ATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTT
TTTCTTCCATTTCAGGTGTCGTGAGGAATTAGC (SEQ ID NO:4)
TEFI promoter (enhancer containing the CD3e+EF1 α promoter containing introne):
AAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCC
ATGACATCATGAAAGTTTCCATGACATCATGACAAATTAATTAAAAATAAAGAACATGATGCAAATTAATTAAAAA
TAAAGAACATGATGCAAATTAATTAAAAATAAAGAACATGATGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACAT
CGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAA
CTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTC
GCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTG
GCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGA
GCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAG
GCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGT
CTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCA
AGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCG
GCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGC
CTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGA
AAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAG
TCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGT
CCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGA
GTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCC
CTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGT
CGTGAGGAATTAGC (SEQ ID NO:5)
TCEFI the promoter (+mCMV enhancer+hCMV of enhancer containing the CD3e enhancer+EF1 α promoter containing introne):
AAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCCATGACATCATGAAAGTTTCC
ATGACATCATGAAAGTTTCCATGACATCATGACAAATTAATTAAAAATAAAGAACATGATGCAAATTAATTAAAAA
TAAAGAACATGATGCAAATTAATTAAAAATAAAGAACATGATGACTGAGTCATTAGGGACTTTCCATTGGGTTTTG
CCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCAGCCAATTTAATTAAAACGCCATGTACTTTCC
CACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATG
GGAAAGTACCGTTCGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCC
GCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGA
GTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAAT
GACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG
TATTAGTCATCGCTATTACCAGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTT
GGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTAC
TGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCA
ACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCC
TTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGG
GAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCC
GCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTG
ATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCG
GTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGC
GGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTAT
CGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCT
GCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGG
CCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTC
GAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTG
GAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGT
TCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGGAATTAGC(SEQ ID
NO:6)
Typically, " hybridization conditions " classify according to " stringency " degree of condition used when measuring hybridization.Stringency journey
Degree can be with the melting temperature (Tm) of such as nucleic acid binding complex or probe for foundation.For example, " maximum stringency " is typically
Occur about Tm-5 DEG C (being lower than 5 DEG C of probe Tm)；" high stringency " occurs at about 5-10 DEG C of Tm or less；" moderate stringency
Property " occur about 10-20 DEG C below probe Tm；" low stringency " occurs at about 20-25 DEG C of Tm or less.Alternatively,
Further, hybridization conditions can stringency washes using the salt of hybridization or ionic strength conditions and/or one or more times as foundation.
For example, the extremely low stringency of 6 × SSC=；3 × SSC=is down to moderate stringency；1 × SSC=moderate stringency；0.5 × SSC=
High stringency.It functionally, can be determining tight same or close tight same with hybridization probe using maximum stringent conditions
One nucleic acid sequence；And use the determining nucleic acid sequence for having about 80% or more sequence identity with the probe of high stringency condition
Column.
For requiring highly selective application, typically expectation forms hybrid using relatively restricted condition, for example,
Select relatively low salt and/or high-temperature condition.(Sambrook, J. etc. (1989) molecular cloning, the laboratory hand such as Sambrook
Volume, Cold Spring Harbor Press, Plainview, N.Y.) it provides and exists including moderate stringency and high stringency
Interior hybridization conditions.
For purposes of illustration only, for detecting the suitable Moderate that polynucleotides of the invention hybridize with other polynucleotides
Condition includes: with 5 × SSC, 0.5%SDS, 1.0mM EDTA (pH8.0) solution prewashing；It is miscellaneous in 5 × SSC at 50-65 DEG C
It hands over overnight；Then with 2 containing 0.1%SDS ×, 0.5 × and 0.2 × SSC respectively washed twice at 65 DEG C 20 minutes.This field skill
Art personnel, which should be appreciated that, can easily operate hybridization stringency, such as change the salt content and/or hybridization temperature of hybridization solution.Example
Such as, in another embodiment, suitable high stringency hybridizat condition includes above-mentioned condition, the difference is that hybridization temperature
It is increased to such as 60-65 DEG C or 65-70 DEG C.
In the present invention, it is described under the conditions of high stringency with nucleotide shown in SEQ ID NO:1-SEQ ID NO:6
The nucleotide sequence of sequence hybridization, has with nucleotide sequence shown in SEQ ID NO:1-SEQ ID NO:6 identical or phase
As promoter activity.
In the present invention, described that one or is carried out more to nucleotide sequence shown in SEQ ID NO:1-SEQ ID NO:6
The substitution of a base, missing, addition modified nucleotide sequence refer to the 5 ' ends separately or concurrently in the nucleotide sequence
And/or 3 ' end and/or interior sequences carry out for example no more than 2-45, be perhaps no more than 2-30 or be no more than 3-
20,5-10 are perhaps perhaps no more than no more than 4-15 or uses continuous integral number one by one respectively no more than 6-8
Substitution, missing, the addition modification of the base of expression.
In the present invention, described that such as above-mentioned one is carried out to nucleotide sequence shown in SEQ ID NO:1-SEQ ID NO:6
The substitutions of a or multiple bases, missing, addition modified nucleotide sequence have with shown in SEQ ID NO:1-SEQ ID NO:6
The same or similar promoter activity of nucleotide sequence.
Be illustrated by a kind of polynucleotides, its nucleotide sequence for example with SEQ ID NO:1-SEQ ID
" identity " that the reference nucleotide sequence of NO:6 at least has 95% refers to: in the reference of SEQ ID NO:1-SEQ ID NO:6
In every 100 nucleotide of nucleotide sequence, difference of the nucleotide sequence of the polynucleotides in addition to containing up to 5 nucleotide
Outside, the nucleotide sequence of the polynucleotides is identical as reference sequences.In other words, in order to obtain nucleotide sequence and with reference to nucleosides
The identical polynucleotides of acid sequence at least 95%, up to 5% nucleotide can be deleted or by another nucleotide in reference sequences
Substitution；Or can by some nucleotides inserted reference sequences, wherein the nucleotide being inserted into can up to reference sequences total nucleotide
5%；Or in some nucleotide, there are the combination of deletion, insertion and replacement, wherein the nucleotide up to reference sequences it
The 5% of total nucleotide.5 ' or 3 ' terminal positions in reference nucleotide sequence can occur for these mutation of reference sequences, or at this
Between a little terminal positions anywhere, they or be individually dispersed in the nucleotide of reference sequences, or with one or more neighbours
Close group is present in reference sequences.
In the present invention, for determine the algorithm of sequence identity and sequence similarity percentage be such as BLAST and
2.0 algorithm of BLAST, they describe respectively in (1977) Nucl.Acid.Res.25:3389-3402 such as Altschul and
Altschul etc. (1990) J.Mol.Biol.215:403-410.Using for example described in document or default parameters, BLAST and
BLAST 2.0 is determined for nucleotide sequence homology percentage of the invention.The software for executing BLAST analysis can lead to
It is for the public to obtain to cross National Biotechnology Information Center (NCBI).
In the present invention, described to have at least 90% with nucleotide sequence shown in SEQ ID NO:1-SEQ ID NO:6
The nucleotide sequence of sequence identity include the multicore substantially same with sequence disclosed in SEQ ID NO:1-SEQ ID NO:6
Nucleotide sequence, such as when using methods described herein (being analyzed for example, by using the BLAST of standard parameter), with multicore glycosides of the present invention
Acid sequence compare containing at least 90% sequence identity, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%,
Those of 98% or 99% or higher sequence identity sequence.
In the present invention, described to have at least 90% with nucleotide sequence shown in SEQ ID NO:1-SEQ ID NO:6
Sequence identity nucleotide sequence have with nucleotide sequence shown in SEQ ID NO:1-SEQ ID NO:6 identical or phase
As promoter activity.
Another aspect of the invention is related to a kind of nucleic acid construct, comprising polynucleotides described in any of the above item, and
The identical or different foreign gene of the one or more being operably connected；Specifically, the foreign gene coding has anti-swollen
The monoclonal antibody of tumor effect especially encodes the overall length of the monoclonal antibody with antitumor action；Specifically, described to have
The monoclonal antibody of antitumor action can express (for example, CTLA-4 monoclonal antibody or PD-1 monoclonal antibody) in T cell；Specifically, institute
Stating foreign gene includes or for nucleotide sequence shown in SEQ ID NO:16.
In the present invention, term " being operably connected " refers to the function of two or more nucleotide regions or nucleic acid sequence
The space arrangement of property.In nucleic acid construct of the invention, for example, promoter is placed in the specific of the nucleic acid sequence of the gene
Position, such as promoter are located at the upstream position of the gene nucleic acid sequence, so that the transcription of nucleic acid sequence is by the promoter
The guidance in region, thus, promoter region is " operably connected " in the nucleic acid sequence of the gene.The gene is usually
Need to improve any nucleic acid sequence of transcriptional level, alternatively, it is specific to lower to design promoter of the present invention and gene
Nucleic acid sequence.Namely realized by the way that promoter is connected with the gene of antisense orientation.
Described " being operably connected " can realize that specifically, the nucleic acid construct is by the means of genetic recombination
Recombinant nucleic acid construct.In a specific embodiment of the invention, the gene is luciferase (luciferase) base
Cause；In another specific embodiment of the invention, the gene is the full length antibody gene of anti-human PD1 albumen.
Another aspect of the invention is related to a kind of recombinant vector, containing described in any item polynucleotides of the invention or
Person's nucleic acid construct of the invention；
Specifically, the recombinant vector is recombinant cloning vector, eukaryotic expression recombinant plasmid or recombinant viral vector；
Specifically,
The recombinant cloning vector is described in any item polynucleotides of the invention or nucleic acid construct of the invention
With pUC18, pUC19, pMD18-T, pMD19-T, pGM-T carrier or pDC315 serial carrier through recombinating obtained recombinant vector；
The recombinant expression carrier is described in any item polynucleotides of the invention or nucleic acid construct of the invention
With pCDNA3 serial carrier, pCDNA4 serial carrier, pCDNA5 serial carrier, pCDNA6 serial carrier, pRL serial carrier or
PDC315 serial carrier is through recombinating obtained recombinant vector；
The recombinant viral vector is recombinant adenoviral vector, recombined glandulae correlation viral vectors, recombinant retrovirus load
Body, recombinant herpes simplex virus carrier or vaccinia virus recombinant carrier.
In one embodiment of the invention, the recombinant viral vector is recombinant adenoviral vector.
Another aspect of the invention is related to a kind of recombinant host cell, wherein the cell contains any one of the invention
The polynucleotides or nucleic acid construct of the invention or recombinant vector of the invention；Specifically, the cell is attached most importance to
Group mammalian cell；Specifically, the cell is recombination T cell；Specifically, the recombination T cell is the Jurkat of recombination
Cell, K562 cell or originally culture T cell.
Another aspect of the invention is related to promoter of the invention or nucleic acid construct of the invention or load of the invention
The method that body imports mammalian cell, the method includes virus-mediated conversion, microinjection, particle bombardment, particle guns
Conversion and electroporation etc..In one embodiment of the invention, the method is virus-mediated conversion, more specifically gland
Virus-mediated conversion.
Another aspect of the invention is related to a kind of Pharmaceutical composition, and it includes described in any item polynucleotides of the invention
Either nucleic acid construct of the invention or recombinant vector of the invention or recombinant host cell of the invention, and it is optional
Pharmaceutically acceptable auxiliary material.
Another aspect of the invention is related to the purposes of (1) or (2) chosen from the followings:
(1) described in any item polynucleotides of the invention or nucleic acid construct of the invention or recombination of the invention
Carrier or recombinant host cell of the invention are in preparation treatment and/or prevention and/or auxiliary for treating cancer or antitumor
Purposes in drug；Specifically, the cancer or tumour are lung cancer, hepatocellular carcinoma, lymthoma, colon cancer, colorectal cancer, mammary gland
Cancer, oophoroma, cervical carcinoma, gastric cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, glioma, melanoma, cancer of pancreas or
Prostate cancer；
(2) described in any item polynucleotides of the invention or nucleic acid construct of the invention or recombination of the invention
The purposes of carrier or recombinant host cell of the invention in the drug or reagent that preparation inhibits tumour cell；Specifically,
The tumour cell is the cell of following tumour: lung cancer, hepatocellular carcinoma, lymthoma, colon cancer, colorectal cancer, breast cancer, ovary
Cancer, cervical carcinoma, gastric cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, glioma, melanoma, cancer of pancreas or prostate
Cancer.
Another aspect of the invention is related to a kind of method for inhibiting tumour cell in vivo or in vitro, including uses effective quantity
Described in any item polynucleotides of the invention or nucleic acid construct of the invention or recombinant vector of the invention or
The step of recombinant host cell of the invention；Specifically, the tumour cell be following tumour cell: lung cancer, hepatocellular carcinoma,
Lymthoma, colon cancer, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, gastric cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, nerve
Glioma, melanoma, cancer of pancreas or prostate cancer.
In one embodiment of the invention, the method for inhibiting tumour cell in vivo or in vitro is non-treatment mesh
.
Another aspect of the invention is related to a kind for the treatment of and/or prevention and/or auxiliary for treating cancer or antitumor side
Method includes using a effective amount of described in any item polynucleotides of the invention or core of the invention including using a effective amount of
The step of acid con-struct or recombinant vector of the invention or recombinant host cell of the invention；Specifically, the cancer or
Person's tumour be lung cancer, hepatocellular carcinoma, lymthoma, colon cancer, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, gastric cancer, cholangiocarcinoma,
Gallbladder cancer, the cancer of the esophagus, kidney, glioma, melanoma, cancer of pancreas or prostate cancer.In one embodiment of the present invention
In case, the method is adoptive cellular immunotherapy.
Another aspect of the invention is related to described in any item polynucleotides of the invention as the purposes in promoter.
To achieve the above object, promoter of the present invention can by singly copy and/or multicopy in the form of application, can also
To be combined with promoter well known in the prior art.
Another aspect of the invention is related to a kind of isolated polynucleotides, and it includes or for shown in SEQ ID NO:17
Nucleotide sequence or its complementary series.It specifically, is stable mCMV enhancer.
Another aspect of the invention is related to use of the polynucleotide sequence shown in SEQ ID NO:17 in preparation promoter
On the way；Specifically, the promoter is described in any item polynucleotides hereinbefore of the invention with promoter function.
The inventors discovered that the promoter sequence prepared by the polynucleotides is stablized, will not with it in prokaryotic cell or
Transfer in eukaryocyte and sequence Loss occurs, and can steadily express the expression of driving foreign gene.
Advantageous effect of the invention
The present invention provides a kind of new promoters.The promoter can not only in T cell efficiently expressing exogenous gene,
And sequence stablizes (such as sequence loss will not occur in prokaryotic cell and eukaryocyte transfer process).The promoter is applicable
In driving foreign gene especially high efficient expression of the full length antibody gene in T cell.
Detailed description of the invention
Fig. 1: the recombined adhenovirus ideograph of Dual-Luciferase expression cassette is carried.
Fig. 2: common Activity determination of the strong promoter in T cell strain.Dual-Luciferase Activity determination in 2A, K562 cell
As a result.2B, Dual-Luciferase Activity determination result in Jurkat cell.
Fig. 3: the ideograph of the T cell strong promoter newly constructed.
Fig. 4: pDC315-CCEF-anti-PD1 carrier figure.
Fig. 5: Activity determination of the new building T cell strong promoter in T cell strain.Dual-Luciferase in 5A, K562 cell
Activity determination result.5B, Dual-Luciferase Activity determination result in Jurkat cell.
Fig. 6: the Ad35-anti-PD1 detection of expression in Jurkat-T cell strain.6A, Western blotting inspection
It surveys.6B, ELISA examination criteria curve.Anti-PD1 antibody expression amount testing result in 6C, K562 cell.6D, Jurkat cell
Middle anti-PD1 antibody expression amount testing result.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment.Those skilled in the art will manage
Solution, the following examples are merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.It is not specified in embodiment specific
Technology or conditions person, described technology or conditions are (yellow such as with reference to the work such as J. Pehanorm Brooker according to the literature in the art
" Molecular Cloning:A Laboratory guide " that training hall etc. is translated, the third edition, Science Press) or carry out according to product description.Examination used
Production firm person is not specified in agent or instrument, and being can be with conventional products that are commercially available.
Embodiment 1: the building of the Dual-Luciferase detection system of common strong promoter
1. according to firefly luciferase (Firefly in psi-CHECK2 plasmid (being purchased from Promega company)
Luciferase, abbreviation FLuc) gene coded sequence, head and the tail design a pair of PCR specificity amplification primer (upstream primer
F1 adds EcoRI restriction enzyme site and protection base；Downstream primer R1 adds SalI restriction enzyme site and protection alkali
Base).The sequence of F1 and R1 is as follows:
F1:GCCgaattcGCCACCATGGAAGACGCC (SEQ ID NO:7), wherein lowercase represents EcoRI digestion
Site；
R1:TGTgtcgacTTACACGGCGATCTTTCCGC (SEQ ID NO:8), wherein lowercase represents SalI enzyme
Enzyme site.
Using psi-CHECK2 plasmid as template, FLuc gene coded sequence is amplified, through EcoRI+SalI double digestion, is packed into
PENTR equally through EcoRI+SalI double digestionTMCarrier (is purchased from Invitrogen company, pENTRTMContain λ bacteriophage site
AttL1 the and attL2 sequence of specific recombination systems), obtain pENTR-Fluc carrier.By pENTR-Fluc plasmid and pPE35
Plasmid (constructs on the basis of being purchased from the pPE3 of MicrobixBiosystems company, Canada, contains λ bacteriophage site-specific
AttR1 the and attR2 sequence of property recombination system, ccdB gene and 5/35 mosaic type adenoviral right arm；Specific construction method ginseng
See that granted patent number is the Chinese invention patent of ZL201010149683.9.) cotransformation BJ5183 bacterium (is purchased from
Invitrogen company), the skeleton matter that recombination obtains carrying Fluc gene and 5/35 mosaic type adenoviral right arm is reacted by LR
Grain pPE35-Fluc.
2. according to renilla luciferase (Renilla in psi-CHECK2 plasmid (being purchased from Promega company)
Luciferase, abbreviation RLuc) gene coded sequence, head and the tail design a pair of PCR specificity amplification primer (upstream primer
F2 adds EcoRI restriction enzyme site and protection base；Downstream primer R2 adds SalI restriction enzyme site and protection alkali
Base).The sequence of F2 and R2 is as follows:
F2:GCCgaattcGCCACCATGACTTCGAAAGT (SEQ ID NO:9), wherein lowercase represents EcoRI enzyme
Enzyme site.
R2:TGTgtcgacTTATTGTTCATTTTTGAGAACTCGCT (SEQ ID NO:10), wherein lowercase represents
SalI restriction enzyme site.
Using psi-CHECK2 plasmid as template, RLuc gene coded sequence is amplified, through EcoRI+SalI double digestion, is packed into
Adenovirus shuttle vector pDC315 equally through EcoRI+SalI double digestion (is purchased from this yuan of Beijing Zhenyang company, gland-containing virus is left
Arm, adenoviral packaging signal, long terminal repeats), obtain pDC315-CMV-Rluc carrier (pDC315 contains CMV promoter).
3. by CMVi promoter shown in following SEQ ID NO:11-SEQ ID NO:15 (intron sequences containing CMV
CMV promoter), EF1 α promoter, EF1 α i promoter (the EF1 α promoters of the intron sequences of α containing EF1), CAG promoter,
CCAU promoter (referring to patent of invention 201410495099.7) nucleotide sequence, and XbaI is introduced at its upstream, downstream
Restriction enzyme site EcoRI is introduced, the synthesis of commission Shanghai JaRa biotech firm is packed into the pDC315- through XbaI+EcoRI double digestion
CMV-Rluc carrier (CMV promoter in replacement original pDC315-CMV-Rluc carrier), is respectively designated as pDC315-CMVi-
RLuc、pDC315-EF1α-RLuc、pDC315-EF1αi-RLuc、pDC315-CAG-RLuc、pDC315-CCAU-RLuc。
CMVi promoter:
GAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAA
AGTCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGG
GGGTGAGTCAATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGC
CATTTAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTA
AACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAAGGG
CAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGGAAATTCCATATTGGCACTCATTCTATTGGCTGAGCTGCGT
TCTACGTGGGTATAAGAGGCGCGACCAGCGTCGGTACCGTCGCAGTCTTCGGTCTGACCACCGTAGAACGCAGATC
GAATTGGGCGTCTAACCAGTCACAGTCGCAAGGTAGGCTGAGCACCGTGGCGGGCGGCAGCGGGTGGCGGTCGGGG
TTGTTTCTGGCGGAGGTGCTGCTGATGATGTAATTAAAGTAGGCGGTCTTGAGACGGCGGATGGTCGAGGTGAGGT
GTGGCAGGCTTGAGATCGATCTGGCCATACACTTGAGTGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGT
CCACTCCC (SEQ ID NO:11)
EF1 α promoter:
AGGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTT
GGGGGGAGGGGTCGGCAATTGAACGGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTAC
TGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCA
ACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTG
AGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTC
TAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCGGCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGC
TCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATC
CAAGCTGTGACCGGCGCCTAC (SEQ ID NO:12)
EF1 α i promoter:
GCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTC
GGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTT
TTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGC
CAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGA
ATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGC
CTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAAT
CTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCG
ACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCG
CGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAAT
CGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGG
GCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCT
CAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTC
AGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGT
ACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTA
GGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCC
TCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGGAATTAGC (SEQ ID NO:13)
CAG promoter:
TATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACT
TACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATA
GTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATC
AAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA
CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGGTCGAGGTGAG
CCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTA
TTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGG
GCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGC
GGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCCCGTGCCCCGCTCCG
CGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCT
CCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTCGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTAAAGGGC
TCCGGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGT
GCGGCCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCGTGTGCGCGAGG
GGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGC
GTGGGGGGGTGAGCAGGGGGTGTGGGCGCGGCGGTCGGGCTGTAACCCCCCCCTGCACCCCCCTCCCCGAGTTGCT
GAGCACGGCCCGGCTTCGGGTGCGGGGCTCCGTGCGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGC
GGCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCGG
AGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGAC
TTCCTTTGTCCCAAATCTGGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGCGAAGC
GGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCATCT
CCAGCCTCGGGGCTGCCGCAGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTG
TGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCT
GGTTGTTGTGCTGTCTCATCATTTTGGCAAAGAATTC (SEQ ID NO:14)
CCAU the promoter (+hCMV enhancer+β-Actin promoter+Ubi of enhancer containing mCMV enhancer):
ACTGAGTCATTAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATG
GGTTTTTCCCATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTTAATTAAA
ACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTC
CCATAGCTGATTAATGGGAAAGTACCGTTCGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGA
CCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATT
GACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCC
CCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACT
TGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCA
TCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGG
GGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAG
CCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAG
CGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCC
CGGCTCTGACTGACCGCGTTACTAAAACAGGTAAGTCCGGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCC
CCCCTCCTCACGGCGAGCGCTGCCACGTCAGACGAAGGGCGCAGCGAGCGTCCTGATCCTTCCGCCCGGACGCTCA
GGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCAGCAGAAGGACATTTTAGGACGGGACTT
GGGTGACTCTAGGGCACTGGTTTTCTTTCCAGAGAGCGGAACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATTCT
GCGGAGGGATCTCCGTGGGGCGGTGAACGCCGATGATGCCTCTACTAACCATGTTCATGTTTTCTTTTTTTTTCTA
CAGGTCCTGGGTGACGAACAG (SEQ ID NO:15)
Respectively by pDC315-CMV-Rluc, pDC315-CMVi-RLuc, pDC315-EF1 α-RLuc, pDC315-EF1 α i-
RLuc, pDC315-CAG-RLuc, pDC315-CCAU-RLuc and pPE35-Fluc pass through Lipofectamine cotransfection extremely
HEK293 cell strain (is purchased from Unite States Standard biology product collecting center, ATCC), specific method referring to GIBCOBRL company behaviour
It explains.There is virus plaque within 9-14 days after cotransfection, is purified by virus plaque three times to get each promoter nucleotide is carried
The adenovirus Dual-luciferase reportor systerm of sequence, is respectively designated as Ad35-CMV-2Luc, Ad35-CMVi-2Luc, Ad35-
EF1 α -2Luc, Ad35-EF1 α i-2Luc, Ad35-CAG-2Luc, Ad35-CCAU-2Luc (specific ideograph is shown in Fig. 1).
Above recombined adhenovirus mass propagation in HEK293 cell, using the method large-scale purification of caesium chloride density gradient centrifugation
Adenovirus, then using 50% tissue culture infection dose (TCID50) method measurement virus titer, (method is referring to the U.S.
The AdEasyTM operation manual of Qbiogene company).
Embodiment 2: common Activity determination of the strong promoter in T cell strain
By good low algebra Jurkat T of growth conditions, K562 cell strain (being purchased from ATCC) respectively by 1 ×
104The hole cells/ spreads 96 orifice plates, sets 37 DEG C, 5%CO2Incubator culture 24 hours；By virus infection plural number MOI=5, infect respectively
Ad35-CMV-2Luc、Ad35-CMVi-2Luc、Ad35-EF1α-2Luc、Ad35-EF1αi-2Luc、Ad35-CAG-2Luc、
Every group of recombinant virus of 6 kinds of Ad35-CCAU-2Luc etc. sets 4 multiple holes；Then 37 DEG C, 5%CO are set2Incubator culture；After 24 hours,
Lytic cell is placed in microplate reader by Dual-Luciferase detection kit (being purchased from Promega company) and measures the enzyme activity of RLuc
Property, using the enzymatic activity of FLuc as internal reference, obtain the relative ratio of RLuc/FLuc.Concrete operation step is complete by kit specification
At.
The result shows that (see Fig. 2A -2B), in various strong promoters, the strong promoter of EF1 α system (including EF1 α and EF1 α
I) there is stronger activity in T cell strain, higher than the strong promoter (including CMV and CMVi) of CMV system and artificial constructed
Chimeric promoters (including CAG and CCAU).
T cell strong promoter building on the basis of embodiment 3:EF1 α promoter
By CCEF promoter, TEF promoter, TCEF promoter, CCEFi shown in SEQ ID NO:1-SEQ ID NO:6
Promoter, TEFi promoter, TCEFi promoter nucleotide sequence (promoter ideograph is shown in Fig. 3), and introduce at its upstream
XbaI is introducing restriction enzyme site EcoRI downstream, and the synthesis of commission Shanghai JaRa biotech firm is packed into through the bis- enzymes of XbaI+EcoRI
The pDC315-CMV-Rluc carrier (CMV promoter in replacement original pDC315-CMV-Rluc carrier) cut, is respectively designated as
pDC315-CCEF-RLuc、pDC315-TEF-RLuc、pDC315-TCEF-RLuc、pDC315-CCEFi-RLuc、pDC315-
TEFi-Rluc, pDC315-TCEFi-Rluc (Vector map is shown in Fig. 4).After as above each plasmid conversion DH5 α bacterium, in commission
Hai Shenggong is measured the DNA sequence dna of each promoter, as a result, it has been found that the sequence of each promoter keeps stablizing.
Respectively by pDC315-CCEF-RLuc, pDC315-TEF-RLuc, pDC315-TCEF-RLuc, pDC315-CCEFi-
RLuc, pDC315-TEFi-Rluc, pDC315-TCEFi-Rluc and pPE35-Fluc pass through Lipofectamine cotransfection extremely
HEK293 cell strain (is purchased from Unite States Standard biology product collecting center, ATCC), specific method referring to GIBCOBRL company behaviour
It explains.There is virus plaque within 9-14 days after cotransfection, is purified by virus plaque three times to get each promoter nucleotide is carried
The adenovirus Dual-luciferase reportor systerm of sequence, is respectively designated as Ad35-CCEF-2Luc, Ad35-TEF-2Luc, Ad35-
TCEF-2Luc,Ad35-CCEFi-2Luc,Ad35-TEFi-2Luc,Ad35-TCEFi-2Luc.Extract the gene of the above adenovirus
Group, the raw work in commission Shanghai is measured the DNA sequence dna of each promoter, as a result, it has been found that the sequence of each promoter keeps stablizing.
Embodiment 4: Activity determination of the new building promoter in T cell strain
By good low algebra Jurkat, K562 cell strain (being purchased from ATCC) of growth conditions respectively by 1 × 104cells/
Hole spreads 96 orifice plates, sets 37 DEG C, 5%CO2Incubator culture 24 hours；By virus infection plural number MOI=5, Ad35-EF1 is infected respectively
α-2Luc、Ad35-CCEF-2Luc、Ad35-TEF-2Luc、Ad35-TCEF-2Luc、Ad35-EF1αi-2Luc、Ad35-
Every group of recombinant virus of 8 kinds of CCEFi-2Luc, Ad35-TEFi-2Luc, Ad35-TCEFi-2Luc etc. sets 4 multiple holes；Then 37 are set
DEG C, 5%CO2Incubator culture；After 24 hours, lytic cell is (public purchased from Promega by Dual-Luciferase detection kit
Department), the enzymatic activity for being placed in measurement RLuc in microplate reader obtains comparing for RLuc/FLuc using the enzymatic activity of FLuc as internal reference
Value.Concrete operation step is completed by kit specification.
The result shows that (see Fig. 5 A-5B), relative to EF1 α promoter, the activity of CCEF, TEF, TCEF in T cell strain compared with
It is high；Relative to EF1 α i promoter, the activity of CCEFi, TEFi, TCEFi in T cell strain is higher.Show to increase cmv enhancer
And/or after CD3e enhancer sequence, the expression activity after sub- EF1 α system promoter sequence in T cell can be significantly increased.
Embodiment 5: the building of recombined adhenovirus Ad35-anti-PD1
By the anti-PD1 full length antibody gene nucleotide series (base of antibody containing PD-1 shown in following SEQ ID NO:16
Because of heavy chain, F2A, light chain gene), and EcoRI is introduced at its upstream, restriction enzyme site SalI is being introduced downstream, and commission Shanghai is prompt
The synthesis of auspicious biotech firm, be respectively charged into pDC315-EF1 α-RLuc through EcoRI+SalI double digestion, pDC315-CCEF-RLuc,
pDC315-TEF-RLuc、pDC315-TCEF-RLuc、pDC315-EF1αi-RLuc、pDC315-CCEFi-RLuc、pDC315-
TEFi-Rluc, pDC315-TCEFi-Rluc carrier (replacement original Rluc coding gene sequence), building obtains pDC315-EF1 α-
anti-PD1、pDC315-CCEF-anti-PD1、pDC315-TEF-anti-PD1、pDC315-TCEF-anti-PD1、
pDC315-EF1αi-anti-PD1、pDC315-CCEFi-anti-PD1、pDC315-TEFi-anti-PD1、pDC315-
TCEFi-anti-PD1。
gaattcGCCACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCAC
CGGACAGGTGTACTTGGTAGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCG
TCTGGATTCACCTTCAGTAACTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAC
TTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTC
CAAGAACACGCTGTATCTGCAAATGACCAGTCTGAGAGTCGAGGACACGGCTGTGTATTATTGTGCGAGCAACGTT
GACCATTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGCTTCCACCAAGGGCCCATCCGTCTTCCCCCTGGCGC
CCTGCTCCAGGAGCACCTCCGAGAGCACAGCCGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGAC
GGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTAC
TCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACGAAGACCTACACCTGCAACGTAGATCACAAGC
CCAGCAACACCAAGGTGGACAAGAGAGTTGAGTCCAAATATGGTCCCCCATGCCCACCATGCCCAGCACCTGAGTT
CCTGGGGGGACCATCAGTCTTCCTGTTCCCCCCAAAACCCAAGGACACTCTCATGATCTCCCGGACCCCTGAGGTC
ACGTGCGTGGTGGTGGACGTGAGCCAGGAAGACCCCGAGGTCCAGTTCAACTGGTACGTGGATGGCGTGGAGGTGC
ATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTTCAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCA
CCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGGCCTCCCGTCCTCCATCGAGAAAACC
ATCTCCAAAGCCAAAGGGCAGCCCCGAGAGCCACAGGTGTACACCCTGCCCCCATCCCAGGAGGAGATGACCAAGA
ACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCA
GCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAGGCTAACC
GTGGACAAGAGCAGGTGGCAGGAGGGGAATGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACA
CACAGAAGAGCCTCTCCCTGTCTCTGGGTAAACGTAAAAGGCGAGCTCCTGTTAAACAGACTTTGAATTTTGACCT TCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCTGGGCCCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTA
CTCTGGCTCCCAGATACCACCGGAGAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAA
GAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGTAGTTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGC
TCCCAGGCTCCTCATCTATGATGCATCCAACAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGG
ACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGAGTAGCAACT
GGCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCC
GCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCC
AAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGG
ACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGA
AGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAAgtcgac(SEQ ID
NO:16), wherein lowercase represents restriction enzyme site, and underscore indicates F2A coded sequence.
By pDC315-EF1 α-anti-PD1, pDC315-CCEF-anti-PD1, pDC315-TEF-anti-PD1,
pDC315-TCEF-anti-PD1、pDC315-EF1αi-anti-PD1、pDC315-CCEFi-anti-PD1、pDC315-TEFi-
Anti-PD1, pDC315-TCEFi-anti-PD1 and pPE35 pass through the (purchase of Lipofectamine cotransfection to HEK293 cell strain
In Unite States Standard biology product collecting center, ATCC), specific method referring to GIBCOBRL company operating instruction.After cotransfection
There is virus plaque within 9-14 days, is purified by virus plaque three times to get the recombination gland of PD1 full length antibody gene expression frame is carried
Virus is named as Ad35-EF1 α-anti-PD1, Ad35-CCEF-anti-PD1, Ad35-TEF-anti-PD1, Ad35-TCEF-
anti-PD1、Ad35-EF1αi-anti-PD1、Ad35-CCEFi-anti-PD1、Ad35-TEFi-anti-PD1、Ad35-
TCEFi-anti-PD1。
Embodiment 6: recombined adhenovirus Ad35-anti-PD1 expresses the detection of antibody in T cell strain
Human T-cell's strain K562 and Jurkat presses 5 × 10 respectively5The hole cells/ spreads 6 orifice plates, sets 37 DEG C, 5%CO2Incubator for 24 hours,
Infect recombined adhenovirus Ad35-EF1 α-anti-PD1, Ad35-CCEF-anti-PD1, Ad35-TEF- respectively by MOI=20
anti-PD1、Ad35-TCEF-anti-PD1、Ad35-EF1αi-anti-PD1、Ad35-CCEFi-anti-PD1、Ad35-
TEFi-anti-PD1, Ad35-TCEFi-anti-PD1 received cell conditioned medium after 48 hours, (were used with Western blotting
Mouse anti-human igg 4 (H+L) be used as primary antibody) and double sandwich-ELISA method (use the how anti-embedding of goat anti-human igg, mouse anti-human igg inspection
Survey, to the west of appropriate former times antibody be used as standard items, measured after 100 times of sample dilution) table of qualitative and quantitative detection anti-PD-1 albumen
It reaches.
Western Blotting experiment shows recombined adhenovirus Ad35-EF1 α-anti-PD1, Ad35-CCEF-anti-
PD1、Ad35-TEF-anti-PD1、Ad35-TCEF-anti-PD1、Ad35-EF1αi-anti-PD1、Ad35-CCEFi-anti-
It, can be at it after PD1, Ad35-TEFi-anti-PD1, Ad35-TCEFi-anti-PD1 infect people Jurkat, K562 cell strain
Intracellular normal expression PD1 full length antibody gene, the light and weight chain gene size of antibody are consistent (Fig. 6 A, to infect Ad35- with expection
The sample of CCEF-anti-PD1 is as representative).
ELISA the result shows that, infect Ad35-CCEF-anti-PD1, Ad35-TEF-anti-PD1, Ad35-TCEF-
It, can be after anti-PD1, Ad35-CCEFi-anti-PD1, Ad35-TEFi-anti-PD1, Ad35-TCEFi-anti-PD1
In K562, Jurkat cell strain express PD1 antibody, expression quantity be all remarkably higher than control virus Ad35-EF1 α-anti-PD1,
Ad35-EF1 α i-anti-PD1 (Fig. 6 B, 6C, 6D).
Although a specific embodiment of the invention has obtained detailed description, it will be understood to those of skill in the art that.Root
According to all introductions having disclosed, those details can be carry out various modifications and be replaced, these change in guarantor of the invention
Within the scope of shield.Full scope of the invention is given by the appended claims and any equivalents thereof.
Claims (29)
1. a kind of isolated polynucleotides, it includes element 1 and element 2,
Wherein,
The element 1 is EF1 α promoter and/or the EF1 α promoter containing introne；
The element 2 includes mCMV enhancer and hCMV enhancer；
The polynucleotides are promoter；
Wherein, the element 2 also includes CD3e enhancer；
Also, the isolated polynucleotides successively include:
(1) CD3e enhancer+mCMV enhancer+hCMV enhancer+EF1 α promoter, or
(2) CD3e enhancer+mCMV enhancer+hCMV enhancer+EF1 α promoter containing introne；
Wherein,
The nucleotide sequence of the mCMV enhancer is as shown in SEQ ID NO:17；
The nucleotide sequence of the hCMV enhancer is as shown in SEQ ID NO:18；
The nucleotide sequence of the CD3e enhancer is as shown in SEQ ID NO:19；
The nucleotide sequence of the EF1 α promoter is as shown in SEQ ID NO:12；
The nucleotide sequence of the EF1 α promoter containing introne is as shown in SEQ ID NO:13.
2. isolated polynucleotides according to claim 1, are chimeric promoters.
3. isolated polynucleotides according to claim 1, wherein the polynucleotides are by the element 1 and the member
Part 2 forms.
4. according to claim 1 to polynucleotides described in any claim in 3, wherein the element 2 is located at the element
1 upstream.
5. a kind of isolated polynucleotides are any one group in a-b chosen from the followings of polynucleotides:
A.SEQ ID NO:1, SEQ ID NO:3, multicore glycosides shown in any sequence in SEQ ID NO:4 and SEQ ID NO:6
Acid；
B. the polynucleotides complementary with any sequence in a；
Wherein, the polynucleotides in a or b have promoter function.
6. a kind of nucleic acid construct comprising polynucleotides described in any claim in claim 1 to 5, and can operate
The identical or different foreign gene of the one or more of ground connection.
7. nucleic acid construct according to claim 6, wherein the foreign gene coding has the Dan Ke of antitumor action
Grand antibody.
8. nucleic acid construct according to claim 6, wherein the foreign gene coding has the Dan Ke of antitumor action
The overall length of grand antibody.
9. nucleic acid construct according to claim 7 or 8, wherein the monoclonal antibody energy with antitumor action
It is enough to be expressed in T cell.
10. nucleic acid construct according to claim 9, wherein the monoclonal antibody with antitumor action is
CTLA-4 monoclonal antibody or PD-1 monoclonal antibody.
11. nucleic acid construct according to claim 6, wherein the foreign gene is core shown in SEQ ID NO:16
Nucleotide sequence.
12. a kind of recombinant vector is wanted containing polynucleotides described in any claim in claim 1 to 5 or right
Seek nucleic acid construct described in any claim in 6 to 11.
13. recombinant vector according to claim 12, wherein the recombinant vector is recombinant cloning vector, recombination eukaryon
Expression plasmid or recombinant viral vector.
14. recombinant vector according to claim 13, wherein the recombinant cloning vector is any in claim 1 to 5
Nucleic acid construct described in any claim and pUC18 in polynucleotides described in claim or claim 6 to 11,
PUC19, pMD18-T, pMD19-T, pGM-T carrier or pDC315 serial carrier are through recombinating obtained recombinant vector.
15. recombinant vector according to claim 13, wherein the eukaryotic expression recombinant plasmid is in claim 1 to 5
In polynucleotides described in any claim or claim 6 to 11 nucleic acid construct described in any claim with
PCDNA3 serial carrier, pCDNA4 serial carrier, pCDNA5 serial carrier, pCDNA6 serial carrier, pRL serial carrier or
PDC315 serial carrier is through recombinating obtained recombinant vector.
16. recombinant vector according to claim 13, wherein the recombinant viral vector is recombinant adenoviral vector, again
Group gland relevant viral vector, recombinant retroviral vector, recombinant herpes simplex virus carrier or vaccinia virus recombinant carrier.
17. a kind of recombinant host cell, wherein the cell contains multicore described in any claim in claim 1 to 5
Any power in nucleic acid construct described in any claim or claim 12 to 16 in thuja acid or claim 6 to 11
Benefit requires the recombinant vector.
18. recombinant host cell according to claim 17 is recombinant mammalian cells.
19. recombinant host cell according to claim 17, for recombination T cell.
20. recombinant host cell according to claim 19, wherein the recombination T cell is the Jurkat cell of recombination
Or originally culture T cell.
21. recombinant host cell according to claim 17, for the K562 cell of recombination.
22. a kind of Pharmaceutical composition, it includes nucleic acid construct described in any claim in claim 6 to 11 or power
Benefit requires in 12 to 16 in recombinant vector described in any claim or claim 17 to 21 described in any claim
Recombinant host cell and pharmaceutically acceptable auxiliary material.
23. any right is wanted in polynucleotides described in any claim or claim 6 to 11 in claim 1 to 5
Seek recombinant vector or claim described in any claim in the nucleic acid construct or claim 12 to 16
Purposes of the recombinant host cell described in any claim in the drug of preparation treatment and/or pre- anti-cancer in 17 to 21.
24. purposes according to claim 23, wherein the cancer or tumour be lung cancer, hepatocellular carcinoma, lymthoma,
Colorectal cancer, breast cancer, oophoroma, cervical carcinoma, gastric cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, glioma, melanin
Tumor, cancer of pancreas or prostate cancer.
25. purposes according to claim 24, wherein the colorectal cancer is colon cancer.
26. any right is wanted in polynucleotides described in any claim or claim 6 to 11 in claim 1 to 5
Seek recombinant vector or claim described in any claim in the nucleic acid construct or claim 12 to 16
Purposes of the recombinant host cell described in any claim in the drug that preparation inhibits tumour cell in 17 to 21.
27. purposes according to claim 26, wherein the tumour cell is the cell of following tumour: lung cancer, liver cell
Cancer, lymthoma, colorectal cancer, breast cancer, oophoroma, cervical carcinoma, gastric cancer, cholangiocarcinoma, gallbladder cancer, the cancer of the esophagus, kidney, neuroglia
Tumor, melanoma, cancer of pancreas or prostate cancer.
28. purposes according to claim 27, wherein the colorectal cancer is colon cancer.
29. polynucleotides described in any claim are as the purposes in promoter in claim 1 to 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510021408.1A CN104745581B (en) | 2015-01-16 | 2015-01-16 | A kind of promoter and application thereof of T cell high activity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510021408.1A CN104745581B (en) | 2015-01-16 | 2015-01-16 | A kind of promoter and application thereof of T cell high activity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104745581A CN104745581A (en) | 2015-07-01 |
| CN104745581B true CN104745581B (en) | 2019-11-29 |
Family
ID=53585840
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510021408.1A Active CN104745581B (en) | 2015-01-16 | 2015-01-16 | A kind of promoter and application thereof of T cell high activity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104745581B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105796597A (en) * | 2016-03-11 | 2016-07-27 | 江苏三特生物科技有限公司 | Application of CAR-T cell carrying PD-L1 and CTLA-4 antibody genes in tumor immunology |
| CN107523548A (en) * | 2016-06-20 | 2017-12-29 | 上海细胞治疗研究院 | A kind of T cell of high efficiency stable expression antibody and application thereof |
| CN107523545A (en) * | 2016-06-20 | 2017-12-29 | 上海细胞治疗研究院 | A kind of lethal cell of high efficiency stable expression antibody and application thereof |
| CN109988759A (en) * | 2017-12-29 | 2019-07-09 | 上海细胞治疗研究院 | A kind of chimeric promoters in T cell with high transcriptional activity |
| CN109486815B (en) * | 2018-11-02 | 2021-12-31 | 成都大学 | Artificial chimeric promoter and construction method thereof |
| CN112143700A (en) * | 2019-06-26 | 2020-12-29 | 上海细胞治疗集团有限公司 | Method for preparing immune effector cells overexpressing foreign genes |
| CN110592014A (en) * | 2019-08-14 | 2019-12-20 | 广东美赛尔细胞生物科技有限公司 | Method for continuously removing feeder cells in vitro and in vivo without irradiation in NK cell therapy |
| CN112813099A (en) * | 2019-11-15 | 2021-05-18 | 上海细胞治疗集团有限公司 | A promoter with high activity in activated T cells |
| CN115044585B (en) * | 2022-06-22 | 2023-01-24 | 浙江欧赛思生物科技有限公司 | Eukaryotic cell promoter CF1 and application thereof in cell gene expression |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101787373A (en) * | 2009-01-23 | 2010-07-28 | 中国人民解放军第二军医大学东方肝胆外科医院 | Foreign gene-carrying recombinant virus vector efficiently produced in packaging cell and construction method and application thereof |
| CN103614416A (en) * | 2013-09-30 | 2014-03-05 | 中国人民解放军第二军医大学东方肝胆外科医院 | Recombinant oncolytic adenovirus carrying human cell-penetrating peptide p53 and GM-CSF gene, and uses thereof |
| CN104212802A (en) * | 2014-09-25 | 2014-12-17 | 中国人民解放军第二军医大学东方肝胆外科医院 | Cancer cell broad spectrum high-activity promoter and usage thereof |
-
2015
- 2015-01-16 CN CN201510021408.1A patent/CN104745581B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101787373A (en) * | 2009-01-23 | 2010-07-28 | 中国人民解放军第二军医大学东方肝胆外科医院 | Foreign gene-carrying recombinant virus vector efficiently produced in packaging cell and construction method and application thereof |
| CN103614416A (en) * | 2013-09-30 | 2014-03-05 | 中国人民解放军第二军医大学东方肝胆外科医院 | Recombinant oncolytic adenovirus carrying human cell-penetrating peptide p53 and GM-CSF gene, and uses thereof |
| CN104212802A (en) * | 2014-09-25 | 2014-12-17 | 中国人民解放军第二军医大学东方肝胆外科医院 | Cancer cell broad spectrum high-activity promoter and usage thereof |
Non-Patent Citations (1)
| Title |
|---|
| Cloning vector pTAL7A;Frank,S et al;《GenBank: HG530137.1》;20131025;origin * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104745581A (en) | 2015-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104745581B (en) | A kind of promoter and application thereof of T cell high activity | |
| Squadrito et al. | EVIR: chimeric receptors that enhance dendritic cell cross-dressing with tumor antigens | |
| US11091779B2 (en) | Methods and compositions useful in generating non canonical CD8+ T cell responses | |
| Cronin et al. | Efficient transduction and optogenetic stimulation of retinal bipolar cells by a synthetic adeno‐associated virus capsid and promoter | |
| Nagai et al. | PRMT5 associates with the FOXP3 homomer and when disabled enhances targeted p185erbB2/neu tumor immunotherapy | |
| Okamoto et al. | Improved expression and reactivity of transduced tumor-specific TCRs in human lymphocytes by specific silencing of endogenous TCR | |
| CN104212802B (en) | A kind of tumour cell wide spectrum high activity promoter and application thereof | |
| US20180265890A1 (en) | Efficient and safe transposon integration system and use thereof | |
| WO2019226941A1 (en) | Shared antigens | |
| CN110612116A (en) | Novel alphavirus antigen vector | |
| CN110545810A (en) | Viral delivery of novel antigens | |
| JP7457733B2 (en) | modified adenovirus | |
| CN111989108A (en) | Coordination of gene expression using RNA destabilization elements | |
| US20140017668A1 (en) | COMPOSITIONS AND METHODS FOR DETECTING AND QUANTIFYING CIRCULATING TUMOR CELLS (CTCs) | |
| KR102249982B1 (en) | Transposon system, kit containing same, and uses thereof | |
| JP6961788B2 (en) | Programmable oncolytic virus vaccine system and its application | |
| Liu et al. | Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy | |
| CN113106094B (en) | Enhanced skeletal muscle cell efficient specific promoter, screening method and application | |
| US11298408B2 (en) | Methods of treating hypertension | |
| JP2021510080A (en) | Chimeric promoter with high transcriptional activity on T cells | |
| Van den Plas et al. | Efficient removal of LoxP-flanked genes by electroporation of Cre-recombinase mRNA | |
| JP2022513347A (en) | How to Treat Disease Using Nucleic Acid Vectors Encoding Highly Compact Multi-Input Logic Gates | |
| Moreau et al. | Efficient intrathymic gene transfer following in situ administration of a rAAV serotype 8 vector in mice and nonhuman primates | |
| Wei et al. | Construction of recombinant adenovirus vector containing a modified gene that codes for human hypoxia-inducible factor-1α without oxygen-dependent degradation domain | |
| Larsen et al. | Lymphoproliferative disorders: prospects for gene therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 201805 Shanghai Jiading District City Garden Road No. 1585 Applicant after: Shanghai cell therapy research institute Applicant after: Eastern Hepatobiliary Hospital, the Second Military Medical University of Chines Applicant after: Shanghai cell therapy Engineering Technology Research Center Group Co., Ltd. Address before: 201805 Shanghai Jiading District City Garden Road No. 1585 Applicant before: Shanghai cell therapy research institute Applicant before: Eastern Hepatobiliary Hospital, the Second Military Medical University of Chines Applicant before: Shanghai Cell Therapy Engineering Technology Research Center Co., Ltd. |
|
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: No. 1585 Yuanguo Road, Jiading District, Shanghai, 201805 Applicant after: Shanghai cell therapy research institute Applicant after: Eastern Hepatobiliary Hospital, the Second Military Medical University of Chines Applicant after: Shanghai Cell Therapy Group Co., Ltd. Address before: No. 1585 Yuanguo Road, Jiading District, Shanghai, 201805 Applicant before: Shanghai cell therapy research institute Applicant before: Eastern Hepatobiliary Hospital, the Second Military Medical University of Chines Applicant before: Shanghai cell therapy Engineering Technology Research Center Group Co., Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |