CN107523548A

CN107523548A - A kind of T cell of high efficiency stable expression antibody and application thereof

Info

Publication number: CN107523548A
Application number: CN201610445647.4A
Authority: CN
Inventors: 钱其军; 金华君; 胥阶英; 李林芳; 叶真龙; 王超; 江芏青; 吴红平
Original assignee: Shanghai Cell Therapy Engineering Technology Research Center Group Co Ltd; Shanghai Cell Therapy Research Institute
Current assignee: Shanghai Cell Therapy Engineering Technology Research Center Group Co Ltd; Shanghai Cell Therapy Research Institute
Priority date: 2016-06-20
Filing date: 2016-06-20
Publication date: 2017-12-29
Also published as: WO2017219933A1

Abstract

The present invention relates to a kind of T cell of high efficiency stable expression antibody and application thereof.Specifically, the present invention provides a kind of transgenic T cells, the stable integration expression cassette of the coded sequence of the antibody comprising people's Fc sections in the genome of the T cell, and the both ends of expression cassette include the inverted terminal repeat of transposons.The enough high levels of the transgenic T cells of present invention and can while cell killing toxic action is kept, stably express the antibody for including people's Fc sections.In addition, in order to prevent the immunocyte of stable expression antibody from constantly breeding in vivo, cause antibody excess to be expressed, in turn result in systemic toxicity and autoimmunity disease, the present invention also introduces molecule brake system.The lethal cell for being integrated with antibody expression frame can be quickly removed using listing monoclonal antibody medicine, effectively increases the security of its treatment.

Description

A kind of T cell of high efficiency stable expression antibody and application thereof

Technical field

The invention belongs to cell biology and oncology, be related to a kind of high efficiency stable expression antibody T cell and its Purposes.

Background technology

Cancer turns into the number one killer of human health now, quick rhythm of life, huge operating pressure, unhealthy Eating habit, bad environment be all accomplice that cancer occurs so that the rate occurred frequently and rejuvenation trend of cancer are also increasingly Substantially.Traditional treatment means curative effect has arrived bottleneck at present, needs badly and explores a significantly more efficient treatment method, suffers to improve cancer The survival rate and life quality of person.Immunization therapy for malignant tumour is quickly grown in recent years, obtains the clinic to attract people's attention Curative effect.2011, Nature and the most top magazine JCO of clinical tumor delivered the same title " epoch of immunotherapy of tumors respectively Arrived " comment (Nature.2011；480(7378):480；J Clin Oncol.2011；29(36):4828), Tumor vaccine cells treat the research climax for welcoming a new round, and future is possible to occupy considerablely in oncotherapy Position.

" immunization " can be divided into cellular immunity and humoral immunity, and both have the side of completely different killing tumour or virus Formula.Cellular immunity is that effect is directly played with cell to remove foreign matter, and it is the participant of immune response, and immune work( The executor of energy.Effect immunocyte currently used for clinical treatment mainly includes cytokine induced kill cell (cytokine activated killer cells, CIK), NK (NK), Tumor-infiltrating lymphocytes The cytokine induced kill cell that (lymphokine activated killer cell, LAK), BMDC stimulate (DC-CIK), cytotoxic T lymphocyte (CTL), gamma delta T cells, tumor infiltrating lymphocyte (tumor infiltrating Lymphocyte, TIL), CD3AK cells (the killing cell of anti-CD49d McAb) etc., these cells do not express antibody, and they are straight Meet cell-mediated cytotoxic cell effect (the antibody dependent cell- for killing or passing through antibody-dependant Mediated cytotoxicity, ADCC) work.

T cell is the key component of lymphocyte, has various biological function, such as direct killing target cell, auxiliary or Suppress B cell and produce antibody, the responsing reaction former to specific antigen and mitogenesis and generation cell factor etc., are to exempt from Epidemic disease system resists disease infection, the core force of tumour.Two quantum jumps in Current cancer immunization therapy：1st, immunologic test point monoclonal antibody It is that the tumor specific T cells remained by activation patient in situ play a role；2nd, transgenosis CAR-T/TCR-T is by vitro After the means of genetic modification quickly obtain tumor specific T cells, feedback of adopting is treated.Thus, activation, enhancing T cell Function it is most important to tumour, treatment of viral infections.Many types are segmented into according to function by T cell, are mainly included：

1. cytotoxic T cell (cytotoxic T cell)：Eliminate infected cell.The function of these cells is just as one Individual " killer " or cytotoxin, because they can be killed to producing special antigen reactive target cell.Cytotoxic T is thin The major surfaces mark of born of the same parents is CD8, also referred to as killer T cell.

2. helper cell (helper T cell) plays the part of the role of pilot process in immune response：It can be expanded with hyperplasia Dissipate to activate the immunocyte of other types of generation direct immunization reaction.The major surfaces mark of helper cell is CD4.T is thin Born of the same parents regulate and control or " auxiliary " other lymphocytes play function.They are known HIV target cells, the meeting when AIDS is fallen ill Drastically reduce.

3. regulation/suppression T cell (regulatory/suppressor T cell)：It is responsible for regulation organism immune response. Generally play the important function for maintaining self tolerance and avoiding immune response excessive damage body.Regulation/suppression T cell has a lot Kind, it is CD25+CD4+T cells to study at present most active.

The abundant activation of T cell needs dual signal.First signal：Antigentic specificity signal TCR-- Antigenic Peptide-MHC-I classes Molecular complex；CD8-MHC-I quasi-molecules；Secondary signal：Costimulatory signal CD28--B7 (CD80, CD86)；CD2(LFA- 2)-CD58(LFA-3)；LFA-1--ICAM-1.Immune response caused by T cell is cellular immunity, the effect form of cellular immunity Mainly there are two kinds：Combined with target cell specificity, destroy target cell membrane, direct killing target cell；Another kind be release lymph because Son, immunological effect is finally set to expand and strengthen.

Humoral immunity is to be mediated to act by antibody, and the antibody in human body is produced by bone-marrow-derived lymphocyte.1997, First monoclonal antibody for being used for clinical cancer therapy --- anti-humen CD 20 (rituximab) obtains FDA approvals.With antibody technique Development, the antibody that the whole world has been reported so far have more than 10 ten thousand kinds, and wherein genetic engineering antibody has kind more than 1000, humanized antibody 200 It is a variety of.End in March, 2016, FDA 50 antibody listings of approved so far, wherein 26 are used for oncotherapy, these antibody were both Act on tumour cell directly to play a role in itself, also act on immunocyte and play a role indirectly.

However, although T cell still deposits defect with certain antitumor action, its clinical therapeutic efficacy；And macromolecular Antibody is insufficient to the penetration power of solid tumor, and systemic administration is possible to cause systemic adverse reaction.For example, HER2 monoclonal antibodies have Cardiac toxic, and PD1 antibody breaks immunity of organism balance, can cause autoimmune disease.Antibody drug is additionally, since to be related to again Miscellaneous produced in vitro and preparation technology, purity requirement is high and dosage is big, causes drug cost high.Thus, if exempted from cell On the premise of epidemic disease effector cell keeps cell killing toxicity, there can be the antibody of antitumor activity by its high efficient expression, will simultaneously The difficulty for overcoming cellular immunotherapy effect deficiency to be difficult to macromolecular antibody into inside solid tumor, while treatment can be reduced Cost.These both have cell killing toxicity, the cell of and can high level expression antibody, under chemotactic factor (CF) effect, through meticulous Born of the same parents' deformation actively enters inside tumor tissues, so that in tumor tissues part high level expression antibody, can avoid systemic use The side effect that medicine is brought.Meanwhile act on the antibody (such as HER2 antibody Herceptin) of immunocyte itself, due to antibody with The dual presence of cell killing toxic immune cell, strong ADCC effects and CDC effects can be produced, efficiently kills tumour cell； And the antibody (such as PD1 antibody Keytruda) of T cell itself is acted on, responsiveness T of the tumor microenvironment to feedback can be avoided The inhibitory action of cell, and the tumor specific T cells remained in vivo are activated, efficiently play therapeutic action.

Foreign gene is transduceed into the report of T cell although having had, conventional Gene transfer vector system is to tool at present Have that the T cell transfection efficiency of cell killing toxicity is low, or be difficult to make foreign gene express at a high level into the cell at it.Utilize gland Viral vector (circles) can be with the expression in short-term of mediate foreign gene more efficient in T cell, but the T cell activated is bred Speed is very fast, and the exogenous gene expression frame of carrying will quickly be lost in passage, and expression is difficult to persistently；Utilize reverse transcription Virus or slow virus can be with mediate foreign gene in T cell genome integration, stable expression, but antibody can be realized in theory Comprising light chain and heavy chain, coded sequence is long, molecular weight is big, causes retrovirus or the slow virus for carrying full length antibody expression cassette There is larger difficulty with preparation, be difficult to high efficient expression antibody in packaging, be typically only used for the simple single-chain antibody of expression structure and (lack Weary Fc sections fragment, insufficiency and half-life short).Thus before this, it there is no with cell killing toxicity and can stablize, high Flatly express the report of the transgenic T cells of the antibody of the sections of Fc containing someone.

The content of the invention

First aspect present invention provides a kind of transgenic T cells, and stable integration includes people in the genome of the T cell The expression cassette of the coded sequence of the antibody of Fc sections, and the both ends of expression cassette include the inverted terminal repeat of transposons.

In one or more embodiments, the amount of antibody that every million T cells were expressed in 48 hours is higher than 2 μ g。

In one or more embodiments, the transposons is selected from：piggybac、sleeping beauty、frog Prince, Tn5 and Ty；Preferably, the transposons is piggybac.

In one or more embodiments, the T cell is selected from：Periphery blood T lymphocyte, cell toxicant killer T cell (CTL), helper cell, suppression/regulatory T cells, gamma delta T cells and from cytokine induced kill cell (CIK), The T cell of tumor infiltrating lymphocyte (TIL), or its mixture；Preferably, the T cell is periphery blood T lymphocyte or source From TIL T cell.

In one or more embodiments, for the T cell also comprising brake molecule, the brake molecule is to have been listed The membranous antigen of antibody drug identification；Preferably, the membranous antigen be selected from CD11a, CD15, CD19, CD20, CD25, CD44, The integrin of CD47, CD52, EGFR, ERBB2, ERBB3, ERBB4, VEGFR1, VEGFR2, EpCAM, MSLN, GPIIb/IIIa, α 4 With the integrins of 4 β of α 7；Preferably, the membranous antigen is CD20.

In one or more embodiments, the antibody is antitumor or antiviral antibody, preferably is selected from：Immunologic test Point antibody, T cell costimulatory signal antibody, the antibody of Cancer therapy, antitumor cell growth factor receptors antibody, The antibody and antiviral antibody of antitumor cell membranous antigen.

In one or more embodiments, the antibody is directed to the one or more in following antigen：PD-1、CTLA4、 PDL1, PDL2, PDL3, TIM3, LAG3, CD28, CD137, CD40, CD40L, CD47, CD19, CD20, CEA, GD2 are (also known as B4GALNT1, β Isosorbide-5-Nitrae-acetyl group-galactosaminyl transferase 1), FR (Flavin reductases), PSMA (prostate specifics Membranous antigen, gp100 (PMEL premelanosomes albumen), CA9 (carbonic anhydrase IX), CD171/L1-CAM, IL-13R α 2, MART-1 (also known as mucoprotein-A), ERBB2, NY-ESO-1 (also known as CTAG1B, cancer/testis antigen 1B), MAGE (melanoma associated antigens E1) family protein, BAGE (B melanoma antigens family) family protein, GAGE (somatotropin releasing factor) family protein, AFP (α-fetoprotein), MUC1 (MUC-1, cell surface related), CD22, CD23, CD30, CD33, CD44v7/8, CD70, VEGFR1, VEGFR2, IL-11R α, EGP-2, EGP-40, FBP, GD3 (also known as ST8SIA1, ST8 α-N- acetyl group-ceramide α -2,8- sialyltransferase 1), PSCA (prostate stem cell antigen), FSA (also known as KIAA1109), PSA (also known as KLK3, swash The related peptase 3 of peptide release enzyme), HMGA2, fetal type acetylcholinergic receptor, LeY (also known as FUT3), EpCAM, MSLN (mesothelium Element), IGFR1, EGFR, EGFRvIII, ERBB3, ERBB4, CA125 (also known as MUC16, MUC-1 6, cell surface are related), CA15-3, CA19-9, CA72-4, CA242, CA50, CYFRA21-1, SCC (also known as SERPINB3), AFU (also known as FUCA1), EBV-VCA, POA (also known as VDR, vitamin D (1,25- dihydrovitamin D3) acceptor), β 2-MG (beta-2-microglobulin) and PROGRP (GRP gastrin releasing peptides), hepatitis B, AIDS virus；Preferably, the antibody is PD-1 antibody.

In one or more embodiments, the transgenic T cells have been transferred to following nucleic acid constructs A and B：

Nucleic acid constructs A：The volume of antibody containing the inverted terminal repeat of transposons 5 ' (5 ' ITR), comprising people's Fc sections Code sequence and the promoter, polyA tailing signals sequence and the opposing end of transposons 3 ' that control the nucleotide sequence to express repeat sequence Arrange (3 ' ITR)；

Nucleic acid constructs B：Nucleic acid sequence containing the inverted terminal repeat of transposons 5 ' (5 ' ITR), coding brake molecule Arrange and control the promoter, polyA tailing signals sequence, the inverted terminal repeat of transposons 3 ' (3 ' of nucleotide sequence expression ITR), transposase coding sequence and the promoter of optional control transposase coding sequence expression.

In one or more embodiments, using viral transduction, microinjection, particle bombardment, via Particle Bombardment Transformation and electricity The nucleic acid constructs is transferred in the cell by one or more methods in turning, and is turned preferably by electricity.

Second aspect of the present invention provides a kind of pharmaceutical composition, and described pharmaceutical composition contains transgenosis T as described herein Cell and pharmaceutically acceptable auxiliary material.

Third aspect present invention provides the purposes of transgenic T cells as described herein or pharmaceutical composition, it is characterised in that The purposes is selected from：

Prepare for suppress growth of tumour cell medicine, prepare for suppress viral growth medicine, prepare for controlling Treat the medicine of tumour, prepare for treat disease of viral infection medicine, prepare medicine for treating bacterial infection disease Thing and prepare the medicine for treating autoimmune disease.

In one or more embodiments, the tumour is selected from：Liver cancer, lung cancer, colon cancer, cancer of pancreas, stomach cancer, mammary gland Cancer, nasopharyngeal carcinoma, lymthoma, oophoroma, carcinoma of urinary bladder, prostate cancer and head and neck neoplasm.

Fourth aspect present invention provides a kind of method of transfecting T cells, and methods described carries including the use of two kinds of recombination expressions T cell described in body cotransfection；Wherein, a kind of recombinant expression carrier contains the expression cassette of nucleotide sequence interested, in the expression cassette Both ends include the inverted terminal repeat of transposons, and the recombinant expression carrier does not contain the coded sequence of transposase；Separately A kind of recombinant expression carrier contains the expression cassette of optional brake molecule, and the reverse of transposons is being included at the both ends of the expression cassette Terminal repeat, and the recombinant expression carrier contains the coded sequence of transposase.

In one or more embodiments, described two recombinant expression carriers are respectively that recombination expression as described herein carries Body A and B.

Brief description of the drawings

Fig. 1：The expression cassette ideograph of antibody.ITR is transposon ends repetitive sequence, and HyPB is piggybac transposases.

Fig. 2A -2C：The ELISA detection figures of the PIK-T cells expression PD1 antibody levels of different donor sources.Compare to be non- The same source T cell of transgenosis.

Fig. 3：The Western blotting detection figures of the PIK-T cells expression PD1 antibody of different donor sources.

Fig. 4：Detection of the PD1 antibody expressions frame in PIK-T cellular genomes.

Fig. 5：The flow cytometer detection of PIK-T cell surface PD1 molecules.

Fig. 6：The propagation detection of PIK-T cells.

Fig. 7：PIK-T cells secrete IL-2, IL-4, IL-6, IL-10, the detection of TNF α and IFN-γ cell factor.In figure For each cell factor, the post on the left side is the result of PIK-T cells, and the post on the right is the result of control cell.

Fig. 8：PIK-T cells detect to the killing activity of tumour cell in vitro.

Fig. 9：PIK-T cells detect to inhibitory action inside transplantable tumor.

Figure 10：The Function detection of PIK-T cellular elements brake system.

Embodiment

Part term of the present invention is explained below.

In the present invention, term " expression cassette " refers to express the completed element needed for a gene, including promoter, gene Coded sequence and PolyA tailing signal sequences.

Term " coded sequence " is defined as directly determining in the text the amino acid sequence of its protein product in nucleotide sequence Part.The border of coded sequence is typically by holding the ribosome bind site of opening code-reading frame upstream close to mRNA 5 ' (for original Nucleus) and close to mRNA 3 ' hold the transcription terminator in opening code-reading frame downstream to determine.Coded sequence can include, but not It is limited to DNA, cDNA and recombinant nucleic acid sequence.

Term " antigen-binding fragment " (antigen-binding fragment, Fab) refers to tie positioned at antibody molecule " Y " Structure two-arm end, is made up of hypervariable region amino acid sequence, determines the specific peptide fragment of antibodies bind antigen.

Term " Fc " is the crystallizable fragment (fragment crystallizable, Fc) of antibody, is referred to positioned at antibody point The shank end of sub " Y " structure, include the peptide fragment of heavy chain constant region CH2 and CH3 domain, be antibody with effector molecule or The position of person's cell interaction.

Term " epitope ", also known as antigenic determinant (antigenic determinant, AD), refer in antigen molecule Determine the special chemical group of antigentic specificity.Generally, a polypeptide epitope contains 5~6 amino acid residue antigen tables Position, can be identified by specific antibody.Property, number and the steric configuration of epitope determine the specificity of antigen.And according to The successional difference of amino acid of epitope, can be divided into linear epitope and predicting space epitope, and linear epitope is one section of sequence phase The epitope of adjacent amino acid composition, and predicting space epitope is several non-conterminous, but the composition of adjacent amino acid on space structure Epitope.

Term " joint " or hinge are the polypeptide fragments between the different albumen of connection or polypeptide, and the purpose is to make what is connected Albumen or polypeptide keep respective space conformation, to maintain the function of albumen or polypeptide or activity.

Term " specific binding " refers to the reaction between antibody or antigen-binding fragment and its targeted antigen. In some embodiments, the antibody (or having specific antibody to certain antigen) for specifically binding certain antigen refers to, antibody with Less than about 10^-5M, it is, for example, less than about 10^-6M、10^-7M、10^-8M、10^-9M or 10^-10M or smaller affinity (K_D) combine and be somebody's turn to do Antigen." specific recognition " has similar implication.

Term " pharmaceutically acceptable auxiliary material " refer in pharmacology and/or physiologically with subject and active component phase The carrier and/or excipient of appearance, it is well known in the art (see, for example, Remington's Pharmaceutical Sciences, Gennaro AR are compiled, the 19th edition, Pennsylvania:Mack Publishing Company, 1995), and Including but not limited to：PH adjusting agent, surfactant, adjuvant, ionic strength reinforcing agent.For example, pH adjusting agent includes but unlimited In phosphate buffer；Surfactant includes but is not limited to cation, anion or nonionic surface active agent, such as Tween-80；Ionic strength reinforcing agent includes but is not limited to sodium chloride.

Term " effective dose ", which refers to realize in subject, treats, prevents, mitigates and/or alleviates disease of the present invention Or the dosage of illness.

Term " disease and/or illness " refers to a kind of condition of the subject, the condition and institute of the present invention State disease and/or illness is relevant.

Term " subject " can refer to patient or it is other receive pharmaceutical composition of the present invention with treat, prevent, mitigate and/ Or alleviate the animal of disease or illness of the present invention, particularly mammal, such as people, dog, monkey, ox, horse etc..

Provided herein is a kind of nucleic acid constructs (herein also referred to as " nucleic acid constructs A "), such nucleic acid constructs, which contains, to be turned The inverted terminal repeat of stand 5 ' (5 ' ITR), nucleotide sequence interested and optional control nucleotide sequence interested Promoter, polyA tailing signals sequence and the inverted terminal repeat of transposons 3 ' (3 ' ITR) of expression.

Another kind of nucleic acid constructs (herein also referred to as " nucleic acid constructs B ") is also provided herein, such nucleic acid constructs contains There are the inverted terminal repeat of transposons 5 ' (5 ' ITR), the nucleotide sequence of optional coding brake molecule and optional control should The promoter of nucleotide sequence expression, polyA tailing signals sequence, the inverted terminal repeat of transposons 3 ' (3 ' ITR), transposase Coded sequence and the promoter of optional control transposase coding sequence expression.

Herein, " nucleotide sequence interested " can be the nucleic acid sequence of coding various functions albumen well known in the art Row.This kind of functional protein includes constant section and/or the variable region of each antibody-like, especially antibody, including but not limited to heavy chain Constant section, chain constant section, weight chain variable district and light chain variable district.In certain embodiments, the core interested The full length sequence or its functional fragment of the Fc sections of sequences code antibody.In certain embodiments, the core interested The light chain constant section (such as Fc) and light chain of sequences code antibody.In certain embodiments, the nucleic acid sequence interested The heavy chain full length sequence and light chain full length sequence of row encoding antibody.In certain embodiments, encoding heavy chain section and light chain area The nucleotide sequence of section can be connected by joint sequence (such as Furin 2A coded sequence) commonly used in the art." section " is herein The infrastructure element of middle finger antibody, such as the C of antibody_H1、C_H2、C_H3、C_L、V_L、V_HDeng part.

Antibody interested can be human antibody, including human mouse chimeric antibody and humanized antibody.Antibody interested can It is selected from：Immunologic test point antibody, T cell costimulatory signal antibody, the antibody of Cancer therapy, antitumor cell growth because The antibody of sub- acceptor, the antibody of antitumor cell membranous antigen and antiviral antibody.

In certain embodiments, antibody interested can be the one or more antibody being directed in following antigen： PD-1、CTLA4、PDL1、PDL2、PDL3、TIM3、LAG3、CD28、CD137、CD40、CD40L、CD47、CD19、CD20、CEA、 GD2 (also known as B4GALNT1, β Isosorbide-5-Nitraes-acetyl group-galactosaminyl transferase 1), FR (Flavin reductases), PSMA (forefront Gland specific membrane antigen, gp100 (PMEL premelanosomes albumen), CA9 (carbonic anhydrase IX), CD171/L1-CAM, IL-13R α 2nd, MART-1 (also known as mucoprotein-A), ERBB2, NY-ESO-1 (also known as CTAG1B, cancer/testis antigen 1B), MAGE (melanoma phases Close antigen E1) family protein, BAGE (B melanoma antigens family) family protein, GAGE (somatotropin releasing factor) family egg In vain, AFP (α-fetoprotein), MUC1 (MUC-1, cell surface related), CD22, CD23, CD30, CD33, CD44v7/8, CD70, VEGFR1, VEGFR2, IL-11R α, EGP-2, EGP-40, FBP, GD3 (also known as ST8SIA1, ST8 α-N- acetyl group-god Through acid amides α -2,8- sialyltransferases 1), PSCA (prostate stem cell antigen), FSA (also known as KIAA1109), PSA (also known as KLK3, the related peptase 3 of kallikrein), HMGA2, fetal type acetylcholinergic receptor, LeY (also known as FUT3), EpCAM, MSLN (mesothelin), IGFR1, EGFR, EGFRvIII, ERBB3, ERBB4, CA125 (also known as MUC16, MUC-1 6, cell surface phase Close), CA15-3, CA19-9, CA72-4, CA242, CA50, CYFRA21-1, SCC (also known as SERPINB3), AFU (also known as FUCA1), EBV-VCA, POA (also known as VDR, vitamin D (1,25- dihydrovitamin D3) acceptor), β 2-MG (β -2- microballoon eggs In vain) and PROGRP (GRP gastrin releasing peptides), hepatitis B and AIDS virus.

In certain embodiments, antibody is the antibody for acting on T cell itself, and after T cell expresses antibody, protection is certainly Body is not suppressed by tumor microenvironment, lowers toxic side effect in tumor by local expression antibody.In certain embodiments, antibody is Circulating antibody.In other embodiments, antibody is film anchor type antibody.It is described anti-in one or more embodiments Body is PD-1 antibody.

Herein, " PD1 " refers to programmed death acceptor 1, and it is PDCD1, ID in NCBI GeneBank official name Number be 5133, its cDNA sequence/protein sequence is NM_005018.2/NP_005009.2.

" CD20 " refers to human leukocytes differentiation antigen 20, and it is MS4A1 in NCBI GeneBank official name, ID number For 931, there are 2 isomers (cDNA sequence/protein sequence), respectively NM_021950.3/NP_068769.2, NM_ 152866.2/NP_690605.1.When referring to CD20 amino acid sequence, it includes the total length of CD20 albumen or had The CD20 of CD20 functions fragment；Also include the fusion protein of the total length or fragment.Also, it will be appreciated by those skilled in the art that In CD20 amino acid sequence, can it is naturally-produced or be artificially introduced mutation or variation (including but not limited to replace, missing and/ Or addition), without influenceing its biological function.Also, when describing CD20 protein sequence fragments, in addition to its natural or people Corresponding sequence fragment in work variant.

Corresponding promoter sequence can be selected according to selected nucleotide sequence interested.The example of this kind of promoter include but It is not limited to EF1 α promoters.(entire contents are included to this by reference herein as described in CN201510021408.1 Text), promoter upstream may also include enhancer, such as one in mCMV enhancers, hCMV enhancers and CD3e enhancers, arbitrarily Two or all three.

Therefore, in certain embodiments, the various promoter sequences announced herein using CN201510021408.1, Including but not limited to this application SEQ ID NO:The CCEF of enhancer containing mCMV, hCMV enhancers and EF1 α promoters shown in 1 Promoter；SEQ ID NO:The TEF promoters of enhancer containing CD3e and EF1 α promoters shown in 2；SEQ ID NO:Shown in 3 Enhancer containing CD3e, mCMV enhancers, the TCEF promoters of hCMV enhancers and EF1 α promoters；SEQ ID NO:Shown in 4 The CCEFI promoters of enhancer containing mCMV, hCMV enhancers and the EF1 α promoters containing introne；SEQ ID NO:Shown in 5 The TEFI promoters of enhancer containing CD3e and the EF1 α promoters containing introne；And SEQ ID NO:Increasing containing CD3e shown in 5 Hadron, mCMV enhancers, the TCEFI promoters of hCMV enhancers and the EF1 α promoters containing introne.

Herein, transposase can be turned from piggybac, sleeping beauty, frog prince, Tn5 or Ty The transposase of base system.When using the transposase from different transposon systems, the 5 ' ITR and 3 ' in nucleic acid constructs of the present invention ITR sequence also accordingly changes into the sequence being adapted to the transposon system, and this can be readily determined by those skilled in the art.

In certain embodiments, transposase is the transposase from piggybac transposon systems.Therefore, implement at these In scheme, the inverted terminal repeat of transposons 5 ' and 3 ' inverted terminal repeats are respectively that piggybac transposons 5 ' is anti- Terminad repetitive sequence and 3 ' inverted terminal repeats.In certain embodiments, the inverted terminal repeat of transposons 5 ' As CN 201510638974.7 (herein includes its content herein) SEQ ID NO by reference:Shown in 1.In some realities Apply in scheme, the inverted terminal repeat of transposons 3 ' such as SEQ ID NO of CN 201510638974.7:Shown in 4.In some realities Apply in scheme, piggybac transposases are the transposase of the coded sequence of nuclear localization signal containing c-myc.In certain embodiments, The coded sequence of the piggybac transposases such as SEQ ID NO of CN 201510638974.7:Shown in 5.

The promoter of transposase coding sequence can be known in the art for controlling transposase coding sequence to express Various promoters.In certain embodiments, the expression of transposase coding sequence is controlled using CMV promoter.CMV promoter Sequence can be such as the SEQ ID NO of CN 201510638974.7:Shown in 6.

PolyA tailing signal sequences well known in the art can be used.In certain embodiments, the polyA comes from SV40.In some embodiments, the SEQ ID NO of CN 201510638974.7 can be used:Sequence shown in 3.

" brake molecule " used herein or " molecule brake " is used interchangeably, and refers to the film that can have been listed antibody drug identification Antigen.The antibody drug of " brake molecule " is somebody's turn to do by adding identification, the cell that " brake molecule " is somebody's turn to do in carrying can be removed quickly, from And improve Therapeutic safety.Suitable brake molecule (membranous antigen) may be selected from：CD11a、CD15、CD19、CD20、CD25、CD44、 CD47, CD52, EGFR, ERBB2, ERBB3, ERBB4, VEGFR1, VEGFR2, EpCAM, MSLN (mesothelin), GPIIb/IIIa, The integrins of α 4 and the integrins of 4 β of α 7.In certain embodiments, membranous antigen CD20.In certain embodiments, institute can be used State the linear epitope or predicting space epitope of membranous antigen.

Selected membranous antigen can be directed to and select suitable promoter, to control the expression of membranous antigen.In some embodiments In, promoter is EF1 α promoters.In certain embodiments, the sequence of EF1 α promoters such as CN 201510638974.7 SEQ ID NO:Shown in 8.

In certain embodiments, this paper nucleic acid constructs A contains the opposing end of transposons 5 ' being sequentially connected and repeated Promoter, nucleotide sequence interested, the polyA tailing signal sequences of sequence (5 ' ITR), control nucleotide sequence expression interested Row and the inverted terminal repeat of transposons 3 ' (3 ' ITR).

In certain embodiments, this paper nucleic acid constructs B contains the opposing end of transposons 5 ' being sequentially connected and repeated Sequence (5 ' ITR), control coding brake molecule nucleotide sequence expression promoter, coding brake molecule nucleotide sequence, PolyA tailing signals sequence, the inverted terminal repeat of transposons 3 ' (3 ' ITR), transposase coding sequence and control this turn The promoter of seat enzyme coded sequence expression.

In certain embodiments, the nucleic acid constructs A contains SEQ ID NO:Nucleotide sequence shown in 3.Some In embodiment, the nucleic acid constructs B contains SEQ ID NO:Nucleotide sequence shown in 4.

This paper nucleic acid constructs A and B can be each kind of a recombinant expression carrier (recombinant expression carrier A and B), for table Up to nucleotide sequence interested and the nucleotide sequence of the optional coding brake molecule.Preferably, expression vector is swivel base Subcarrier.In certain embodiments, carrier is the one or more in following transposon vector：piggybac、 Sleeping beauty, frog prince, Tn5 and Ty.In addition to the nucleotide sequence contained by nucleic acid constructs A, B and C, expression carries Generally also containing the generally contained other elements of carrier, such as multiple cloning sites, resistant gene, replication origin etc. in body. It should be understood that generally, nucleic acid constructs A/ recombinant expression carriers A of the invention does not contain the coded sequence of transposase.

In certain embodiments, the recombinant expression carrier uses pUC18, pUC19, pMD18-T, pMD19-T, pGM- Carrier T, pUC57, pMAX or pDC315 serial carrier are as skeleton.In other embodiments, the recombinant expression carrier is adopted With pCDNA3 serial carriers, pCDNA4 serial carriers, pCDNA5 serial carriers, pCDNA6 serial carriers, pRL serial carriers, PUC57 carriers, pMAX carriers or pDC315 serial carriers are as skeleton.In certain embodiments, the present invention uses CN The pSN carriers of 201510638974.7 structures, its carrier structure is as shown in this application Fig. 1.

The nucleic acid constructs A/ recombinant expression carriers A of the present invention and nucleic acid constructs B/ recombinant expression carriers B can be transferred to In cell interested.The method being transferred to is the conventional method in this area, is included but is not limited to：Viral transduction, microinjection, grain Son bombardment, via Particle Bombardment Transformation and electricity turn etc..In certain embodiments, turned using electricity by the nucleic acid constructs or recombination expression Carrier.

Cell interested can be various T cells well known in the art.Exemplary T cell includes but is not limited to：Outside All blood T lymphocytes, cell toxicant killer T cell (CTL), helper cell, suppression/regulatory T cells, gamma delta T cells, cell because Killing cell (CIK) and tumor infiltrating lymphocyte (TIL) of son induction etc..T cell can also be any mixed of above-mentioned cell Compound.In one embodiment of the invention, the T cell is periphery blood T lymphocyte or the T cell from TIL.

Because nucleic acid constructs A/ recombinant expression carriers A contains the ITR elements needed for swivel base but does not contain transposase, and core Acid construct thing B/ recombinant expression carriers B contains the transposase needed for exogenous origin gene integrator, therefore, has only transfected nucleic acid structure simultaneously Building in thing A/ recombinant expression carriers A and nucleic acid constructs B/ recombinant expression carriers B cell could realize and contain nucleic acid sequence interested The expression cassette of row is integrated.Further, the opposing end of transposons 5 ' repeats sequence in nucleic acid constructs A or recombinant expression carrier A Nucleotide sequence between row and the inverted terminal repeat of transposons 3 ', including 5 ' and 3 ' inverted terminal repeats are in itself, all It is incorporated into the genome of cell.When nucleic acid constructs B/ recombinant expression carriers B contains the nucleotide sequence of coding brake molecule, Cell will further express brake molecule.Similarly, the opposing end of transposons 5 ' in nucleic acid constructs B or recombinant expression carrier B Nucleotide sequence between repetitive sequence and the inverted terminal repeat of transposons 3 ', including 5 ' and 3 ' inverted terminal repeat sheets Body, also all it is incorporated into the genome of cell.

Therefore, a kind of transgenic T cells are also provided herein, stable integration bag in the genome of the transgenic T cells Expression cassette containing the nucleotide sequence interested.Further, stable integration connects successively in the genome of the T cell It is the promoter of the inverted terminal repeat of transposons 5 ' (5 ' ITR) that connects, control nucleotide sequence expression interested, interested Nucleotide sequence, polyA tailing signals sequence and the inverted terminal repeat of transposons 3 ' (3 ' ITR).In preferred embodiment In, the inverted terminal repeat of transposons 5 ' being sequentially connected also further is integrated with the genome of the transgenic T cells The promoter of the nucleotide sequence expression of (5 ' ITR), control coding brake molecule, nucleotide sequence, the polyA of coding brake molecule add Tail signal sequence and the inverted terminal repeat of transposons 3 ' (3 ' ITR).

In certain embodiments, this paper transgenic T cells stably express the full length sequence or its function of antibody Fc section Property fragment.In certain embodiments, this paper transgenic T cells stably express the light chain constant section (such as Fc) of antibody and light Chain.In certain embodiments, this paper transgenic T cells stably express the heavy chain and light chain of antibody.In some embodiments In, this paper transgenic T cells have been transferred to nucleic acid constructs A/ recombinant expression carriers A and nucleic acid constructs B/ weight as described herein Group expression vector B.In other embodiments, every million this paper transgenic T cells are expressed within the time of 48 hours Amount of antibody is higher than 2 μ g.

According to the biological function of expressed antibody, this paper transgenic T cells can have different biological activities, Including but not limited to suppress tumour, suppress virus, suppress bacterium etc..Therefore, this paper transgenic T cells can be used for suppressing tumour The growth of cell, the growth for suppressing virus, treatment tumour, treatment disease of viral infection, treatment bacterial infection disease and Treat autoimmune disease.Herein, tumour includes but is not limited to：Liver cancer, lung cancer, colon cancer, cancer of pancreas, stomach cancer, breast cancer, Nasopharyngeal carcinoma, lymthoma, oophoroma, carcinoma of urinary bladder, prostate cancer and head and neck neoplasm.

Therefore, a kind of pharmaceutical composition is also provided herein, the pharmaceutical composition contains this paper transgenic T cells and pharmaceutically Acceptable carrier or excipient.Transgenic T cells as described herein are also provided herein to prepare for suppressing tumour cell life Long medicine, prepare for suppress viral growth medicine, prepare for treat tumour medicine, prepare for treating viral sense The medicine of infectious diseases, prepare the medicine for treating bacterial infection disease or prepare for treating autoimmune disease Purposes in medicine.

The present invention also provides a kind of method of transfecting T cells, and methods described is including the use of two kinds of recombinant expression carrier corotation Contaminate the T cell；Wherein, a kind of recombinant expression carrier contains the expression cassette of nucleotide sequence interested, at the both ends of the expression cassette Inverted terminal repeat comprising transposons, and the recombinant expression carrier does not contain the coded sequence of transposase；Another kind weight Group expression vector contains the expression cassette of optional brake molecule, and the opposing end weight of transposons is being included at the both ends of the expression cassette Complex sequences, and the recombinant expression carrier contains the coded sequence of transposase.It is described two heavy in one or more embodiments Group expression vector is respectively recombinant expression carrier A and B as described herein.The method of transfection is method known herein, including but The one or more being not limited to during viral transduction, microinjection, particle bombardment, via Particle Bombardment Transformation and electricity turn.During transfection, two kinds of weights The dosage of group expression vector can adjust according to actual conditions, and the recombinant expression carrier for being typically free of transposase coding sequence turns with containing The consumption proportion of the expression vector of seat enzyme coded sequence can be 1~5：Within the scope of 1.

Therefore, present invention also offers a kind of kit, the kit contains two kinds of recombinant expression carriers：One kind restructuring Expression vector contains the expression cassette of nucleotide sequence interested, and the opposing end that transposons is included at the both ends of the expression cassette repeats sequence Row, and the recombinant expression carrier does not contain the coded sequence of transposase；Another recombinant expression carrier contains optional brake point The expression cassette of son, the inverted terminal repeat of transposons is being included at the both ends of the expression cassette, and the recombinant expression carrier contains There is the coded sequence of transposase.In one or more embodiments, described two recombinant expression carriers are respectively described herein Recombinant expression carrier A and B.Kit also contains the various examinations suitable for being transfected into the recombinant expression carrier cell Agent, and optional instruct the specification that the recombinant expression carrier is transfected into cell by those skilled in the art.In kit, Two kinds of recombinant expression carriers can independent packaging, can also the form of mixture be packaged in same container.

Therefore, in certain embodiments, the present invention also relates to a kind of composition of recombinant expression carrier, said composition is extremely Contain two kinds of recombinant expression carriers less：A kind of recombinant expression carrier contains the expression cassette of nucleotide sequence interested, in the expression cassette Both ends include the inverted terminal repeat of transposons, and the recombinant expression carrier does not contain the coded sequence of transposase；Separately A kind of recombinant expression carrier contains the expression cassette of optional brake molecule, and the reverse of transposons is being included at the both ends of the expression cassette Terminal repeat, and the recombinant expression carrier contains the coded sequence of transposase.It is described in one or more embodiments Two kinds of recombinant expression carriers are respectively recombinant expression carrier A and B as described herein.In composition can also contain corresponding solvent or Carrier.

Instant invention overcomes current conventional Gene transfer vector system is low to T cell transfection efficiency, mediate antibody expression The defects of low, T cell high level is stably expressed the antibody from people's Fc section total lengths, overcome cellular immunotherapy effect not Foot is difficult to the difficulty into inside solid tumor with macromolecular antibody.Transgenic T cells produced by the present invention are keeping cell killing The enough high levels of and can, stabilization express the full length antibody for including people's Fc sections while toxic action, and there is cellular immunity to exempt from body fluid Epidemic disease dual-use function, its one side can play antitumor cell and (mainly being mediated by T cell) are immunized, and on the other hand then play body fluid and exempt from Epidemic disease (mainly by antibody-mediated), it can effectively suppress the propagation of tumour and virus.

In addition, in order to prevent the T cell of stable expression antibody from constantly breeding in vivo, antibody excess is caused to be expressed, and then Systemic toxicity and autoimmunity disease are caused, can be by introducing molecule brake system (such as CD20- Mabtheras molecule brake system (CD20BR)).Using corresponding listing monoclonal antibody medicine (such as Mabthera), the ADCC effects and CDC effects of its mediation, energy can be passed through It is quick to remove the T cell for being integrated with full length antibody expression cassette, effectively increase the security of its treatment.Moreover, according to expressed Antibody, transgenic T cells produced by the present invention can be used in Several Kinds of Malignancy as previously described with virus treatment.

Embodiment involved in the present invention is described in detail below in conjunction with case study on implementation.Those skilled in the art It will be understood that case study on implementation below is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.In case study on implementation Unreceipted particular technique or condition person, according to the technology described by document in the art or condition (such as with reference to J. Pehanorm cloth Luke etc. writes, what Huang Peitang etc. was translated《Molecular Cloning:A Laboratory guide》, the third edition, Science Press) or according to product description Carry out.Agents useful for same or the unreceipted production firm person of instrument, being can be by the conventional products of acquisition purchased in market.

Embodiment 1：Recombinant plasmid pS838-AntiPD1 and pNB328-CD20BR structure

Shanghai Jie Rui biotech firms are entrusted to synthesize two segment DNA sequences, sequence is as follows：

Seq1：CGATAGGACGCTGATCTTAAT(SEQ ID NO:1)；

Seq2：TACCTGCGACTAGAAT(SEQ ID NO:2).

98 DEG C are denatured 5 minutes, subsequent Temperature fall, and form upstream and downstream has ClaI and PacI cohesive ends double-strand respectively DNA joints.

PNB carriers load above-mentioned double-strand through CalI and PacI double digestions (building process refers to CN201510638974.7) DNA, obtain pS carriers.

The CCEF promoter sequences announced by CN201510021408.1, the synthesis of commission Shanghai Jie Rui biotech firms, and XbaI and EcoRI restriction enzyme sites are introduced respectively in upstream and downstream, load the pS carriers through XbaI Yu EcoRI double digestions.Obtain pS838 Carrier.

By SEQ ID NO:PD1 antibody coding sequences shown in 3, the synthesis of commission Shanghai Jie Rui biotech firms, and above and below it Trip introduces EcoRI and SalI restriction enzyme sites respectively, loads pS838 carriers, is named as pS838-AntiPD1.

AntiPD1 coded sequences：

GCCACCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACC ACCGGACAGGTGTACTTGGTAGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGC GTCTGGATTCACCTTCAGTAACTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAC TTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCC AAGAACACGCTGTATCTGCAAATGACCAGTCTGAGAGTCGAGGACACGGCTGTGTATTATTGTGCGAGCAACGTTGA CCATTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGCTTCCACCAAGGGCCCATCCGTCTTCCCCCTGGCGCCCT GCTCCAGGAGCACCTCCGAGAGCACAGCCGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTG TCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCT CAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACGAAGACCTACACCTGCAACGTAGATCACAAGCCCAGCA ACACCAAGGTGGACAAGAGAGTTGAGTCCAAATATGGTCCCCCATGCCCACCATGCCCAGCACCTGAGTTCCTGGGG GGACCATCAGTCTTCCTGTTCCCCCCAAAACCCAAGGACACTCTCATGATCTCCCGGACCCCTGAGGTCACGTGCGT GGTGGTGGACGTGAGCCAGGAAGACCCCGAGGTCCAGTTCAACTGGTACGTGGATGGCGTGGAGGTGCATAATGCCA AGACAAAGCCGCGGGAGGAGCAGTTCAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGG CTGAACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGGCCTCCCGTCCTCCATCGAGAAAACCATCTCCAAAGC CAAAGGGCAGCCCCGAGAGCCACAGGTGTACACCCTGCCCCCATCCCAGGAGGAGATGACCAAGAACCAGGTCAGCC TGACCTGCCTGGTCAAAGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAAC TACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAGGCTAACCGTGGACAAGAGCAG GTGGCAGGAGGGGAATGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACACAGAAGAGCCTCT CCCTGTCTCTGGGTAAACGTAAAAGGCGAGCTCCTGTTAAACAGACTTTGAATTTTGACCTTCTCAAGTTGGCGGGA GACGTCGAGTCCAACCCTGGGCCCATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATAC CACCGGAGAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCA GGGCCAGTCAGAGTGTTAGTAGTTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTAT GATGCATCCAACAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCAT CAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGAGTAGCAACTGGCCTCGGACGTTCGGCCAAG GGACCAAGGTGGAAATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAA TCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAA CGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCA CCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCG CCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTGATAA (SEQ ID NO:3), wherein double underline table Show restriction enzyme site, single underscore represents Furin 2A coded sequence.

By SEQ ID NO:The coded sequence of CD20BR shown in 4, the synthesis of commission Shanghai Jie Rui biotech firms, and above and below it Trip introduces EcoRI and SalI restriction enzyme sites respectively, loads pNB328 carriers (building process refers to CN201510638974.7), life Entitled pNB328-CD20BR.

CD20BR coded sequences：

GCCACCATGGAGTTTTGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGTCCAG TGTAACATATACAACTGTGAACCAGCTAATCCCTCTGAGAAAAACTCCCCATCTACCCAATACTGTTACAGCATACA ATCTCTGGGTGGAGGTGGAGGTGGAGGTGGAGGTATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTC TCCTGTCACTGGTTATCACCCTTTACTGCAACCACAGGAACCGTAAAAGGCGAGCTCCTGTTAAACAGACTTTGAAT TTTGACCTTCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCTGGGCCCATGGTGAGCAAGCAGATCCTGAAGAACAC CGGCCTGCAGGAGATCATGAGCTTCAAGGTGAACCTGGAGGGCGTGGTGAACAACCACGTGTTCACCATGGAGGGCT GCGGCAAGGGCAACATCCTGTTCGGCAACCAGCTGGTGCAGATCCGCGTGACCAAGGGCGCCCCCCTGCCCTTCGCC TTCGACATCCTGAGCCCCGCCTTCCAGTACGGCAACCGCACCTTCACCAAGTACCCCGAGGACATCAGCGACTTCTT CATCCAGAGCTTCCCCGCCGGCTTCGTGTACGAGCGCACCCTGCGCTACGAGGACGGCGGCCTGGTGGAGATCCGCA GCGACATCAACCTGATCGAGGAGATGTTCGTGTACCGCGTGGAGTACAAGGGCCGCAACTTCCCCAACGACGGCCCC GTGATGAAGAAGACCATCACCGGCCTGCAGCCCAGCTTCGAGGTGGTGTACATGAACGACGGCGTGCTGGTGGGCCA GGTGATCCTGGTGTACCGCCTGAACAGCGGCAAGTTCTACAGCTGCCACATGCGCACCCTGATGAAGAGCAAGGGCG TGGTGAAGGACTTCCCCGAGTACCACTTCATCCAGCACCGCCTGGAGAAGACCTACGTGGAGGACGGCGGCTTCGTG GAGCAGCACGAGACCGCCATCGCCCAGCTGACCAGCCTGGGCAAGCCCCTGGGCAGCCTGCACGAGTGGGTGTGA(SEQ ID NO:4), wherein double underline represents restriction enzyme site, and single line represents anti-Rituximab antibodies identification CD20 epitopes.

PNB328-CD20BR is shown in Fig. 1 with pS838-antiPD1 carrier mode figures.

Embodiment 2：The genetic modification of periphery blood T lymphocyte

Prepare 1 × 10⁷PMNC (the Peripheral blood mononuclear that fresh separated obtains Cell, PBMC), by Lonza 2b-Nucleofector instruments, by 1:2 ratio is by pNB328-CD20BR and pS838- AntiPD1 cotransfections put 37 DEG C, 5%CO into nucleus₂Incubator culture；AntiCD3 McAb containing 30ng/mL is transferred to after 6 hours to resist Body, 3000IU/mL IL-2 (being purchased from Novoprotein companies) 6 orifice plates in, put 37 DEG C, 5%CO₂Incubator culture.Treat cell After healthy growth, that is, obtain the multipotency T cell of expression PD1 antibody, abbreviation PIK-T.The PBMC of untransfected contains 30ng/ by being layered on ML anti-cd 3 antibodies, 3000IU/mL IL-2 (being purchased from Novoprotein companies) culture plate, put 37 DEG C, 5%CO₂Incubator culture, As control.Due to only having in pNB328 carriers containing the transposase needed for exogenous origin gene integrator, containing only swivel base in pS838 carriers Required ITR elements, pNB328-CD20BR has only been transfected simultaneously with that could be realized in the cell of pS838-antiPD1 carriers The integration of PD1 antibody expression frames, it ensure that in PIK-T cells and braked comprising CD20 molecules.

Embodiment 3：The quantitative detection of PD1 antibody expressions amount in PIK-T cells

The PIK-T and control T cell that embodiment 2 is prepared are by 1:3 dilution ratio Secondary Culture, after two weeks, is pressed 1.0×10⁶Cells/well is layered in 6 orifice plates added with 4ml AIM-V training liquid (being purchased from Gibco companies), is placed in 37 DEG C, 5%CO₂Training Case culture is supported, and 800 μ l cell conditioned mediums are collected after cultivating 24 hours, 48 hours, 72 hours, 96 hours, -20 DEG C of preservations are standby With.Using the PD1 recombinant proteins coated elisa plate (being purchased from SinoBiological companies) in people source, the mouse with HRP marks is anti-human IgG mAb (being purchased from Abcam companies) are detected, using the anti-PD1 antibody (being purchased from Merck companies) of commercialization as standard items, with double Sandwich ELISA method detects the expression quantity of PD1 antibody.

As a result find, the PIK-T cells of 3 different donor sources are capable of the expression PD1 antibody of high level stabilization, specifically As shown in Figure 2.

Embodiment 4：The qualitative detection of PD1 antibody expressions amount in PIK-T cells

The PIK-T that embodiment 2 is prepared is by 1.0 × 10⁶Cells/well is layered on 6 orifice plates added with 4ml AIM-V training liquid In, 37 DEG C are placed in, 5%CO₂Incubator culture, and cell conditioned medium is collected after 48h, 72h, 96h is cultivated, each time point respectively takes 120ul cell conditioned medium, 100 DEG C of 5X SDS-PAGE Loading buffer solutions for adding 30ul boil 10min, by -20 DEG C of sample Save backup.Western blotting (uses goat anti-human igg (H+L) to be used as primary antibody, HRP- rabbit-antis sheep is secondary antibody, and primary antibody and secondary antibody are all Buy in Jackson ImmunoResearch companies) test the expression for detecting anti-PD1 antibody.As a result find, the expression of PIK cells Anti- PD1 antibody include correct heavy chain (50kD) and light chain (25kD), it is specific as shown in Figure 3.

Embodiment 5：The detection of PD1 antibody expressions frame in PIK-T cellular genomes.

The PIK-T cells and the genomic DNA of control T cell that extraction embodiment 2 is prepared, experimental procedure is with reference to reagent Subsidiary specification in box, measure PIK-T cells and the concentration for compareing T cell DNA, detected using fluorescence real-time quantitative PCR anti- The expression of PD1 antibody gene groups, response procedures are：95 DEG C, 15s；95 DEG C, 5s；60 DEG C, 15s；40 circulations.As a result send out Existing, PD1 antibody expression frames are integrated into T cell genome, specific as shown in Figure 4.

Primer sequence：

F:ATCTCCAAAGCCAAAGGGCA(SEQ ID NO:5)；

R:CGATGTCGCTGGGGTAGAAG(SEQ ID NO:6)。

Embodiment 6：The flow cytometer detection of PIK-T cell surface PD1 molecules

PIK-T cells and the control T cell that the embodiment 2 to suspend is prepared are collected, with 1 × 10 after counting⁶Individual cell/ Pipe is separately added into 2 1.5ml EP pipes, twice of PBS, 1200rpm centrifugation 5min, abandons supernatant；It is separately added into the same of 2 μ l Type control antibodies IgG1-PE, anti-CD279-PE antibody (being purchased from BD companies), flicking precipitation makes it well mixed, and room temperature is kept away Light is incubated 30min, PBS one time, and 1200rpm centrifuges 5min, and cell is transferred to by the physiological saline for abandoning 400 μ l of supernatant addition In streaming pipe, upper machine testing.Experimental result is found, is significantly reduced, is shown relative to control cell PIK-T cell PD1 molecules PIK-T cells by autocrine or paracrine PD1 antibody, can effective closing cell surface PD1 molecules, it is specific as shown in Figure 5.

Embodiment 7：The propagation detection of PIK-T cells

The PIK-T cells and control T cell that embodiment 2 is prepared are by 4 × 10⁴/ hole is layered in 96 orifice plates, Mei Zhongxi Born of the same parents spread 3 multiple holes, and cumulative volume is 200 μ l, is placed in 37 DEG C, 5%CO₂Incubator culture, respectively in culture 24h, 48h, 72h, 96h 20 μ l CCK8 reagents are added afterwards, and 37 DEG C of lucifuges are incubated 6h, and 450nm surveys OD values on ELIASA.As a result find, PIK-T cells For growth rate apparently higher than control T cell, the propagation of T cell can be promoted by illustrating the antibody of PIK-T cells secretion, specific as schemed Shown in 6.

Embodiment 8：The cytokine secretion detection of PIK-T cells

24 orifice plates are coated with 5 μ g/ml CD3 antibody (being purchased from Novoprotein companies), 4 DEG C of coatings are stayed overnight, PBS 3 Time, add 3 × 10⁵The PIK-T cells that are prepared of embodiment 2 and control T cell, collect cell conditioned medium after cultivating 24h.With BD^TMCBA Human Th1/Th2Cytokine Kit II (being purchased from BD companies) detect PIK-T cells and control T cell by CD3 The secretion situation of cell factor after antibody stimulates.As a result find, the IL-4 of PIK-T cells secretion, IL-6, TNF α and IFN-γ phase Significantly increased for control T cell, and the secretory volume no significant difference of two kinds of cell factors of IL-2, IL-10, specifically such as Fig. 7 institutes Show.

Embodiment 9：The PIK-T cells in TIL sources are in vitro to the killing experiments of tumour cell

The lung cancer specimen that fresh cut is removed is collected, is aseptically handled immediately.Specific method is as follows：Remove lung cancer mark Normal structure and necrotic zone around this, it is 1-2mm to remove size from the different zones of sample³Small tissue blocks, 24 orifice plates Each hole place one piece.Add 2mL complete mediums (the GT-T551 culture mediums containing 10%FBS) and 3000IU/mL per hole IL-2.24 orifice plates are placed in 37 DEG C, 5%CO₂Cultivated in incubator.Half is carried out for all holes and is measured within the 5-6 days after culture starting Change liquid.Afterwards, according to tumor infiltrating lymphocyte (tumor infiltrating lymphocyte, TIL) growing state, often Once half amount was carried out every 1-2 days and changes liquid.Once TIL is covered with hole, and all attached cells have removed, and are just covered with each in hole TIL collect.Then, 1 × 10⁶TIL is resuspended in complete medium containing 150mL, 30ng/mL anti-cd 3 antibodies, is no less than The T175 trainings of 200 times of TIL irradiated feeder cells (PBMC from 3 different Healthy Peoples) and 6000IU/mL IL-2 Support in bottle, blake bottle is cultivated vertically.Culture was to the 5th day, and 65% liquid is changed to new complete medium and IL-2 in bottle.Culture To the 7th day, the cell suspension in 2 T175 blake bottles was transferred in cell culture bags, added 300mL complete mediums and IL- 2.Since the 6th day, a Trypan Blue was carried out every 1 day and is counted, controlled by adding new complete medium and IL-2 Cell density is to 0.5-2 × 10⁶/mL.Then, by the method for embodiment 2, pNB328-CD20BR and pS838- is transfected AntiPD1 plasmids, obtain the PIK-T cells in TIL sources.

Choose the matching of MHC class I partings lung cancer cell line NCI-H460 (be purchased from U.S. typical case thing collection, ATCC), hole is spread in the ratio in 10000/hole on RTCA cells propagation plate (being purchased from ACEA Biosciences companies of the U.S.), Then according to operational manual, the cytotoxicity of cell is detected using real-time n cell functional analysis instrument (RTCA), Effect target ratio is respectively set to 8:1、4:1、2:1, using the til cell of untransfected plasmid as control, (effect target is than 8:1) cell, is observed Growth curve.As a result find, PIK-T cells are relative to control cell, the more efficient killing H446 tumour cells of energy.It is specific such as to scheme Shown in 8.

Embodiment 10：The PIK-T cells in TIL sources are used to treat to test inside transplantable tumor

5 × 10 are subcutaneously injected in NOD-SCID mouse (being purchased from Shanghai Slac Experimental Animal Co., Ltd.)⁶H446 Pernicious lung carcinoma cell, inject PIK-T cells, the control in the TIL sources that embodiment 9 is prepared after 10 days respectively through tail vein Til cell (injection dosage 2 × 10⁵) or PBS, determine the upgrowth situation of transplantable tumor.As a result show, relative to control Group, the inhibitory action of PIK-T Cells on Lung Cancer have significant difference (Fig. 9).

Embodiment 11：Clearance test (checking of molecule brake function) inside PIK-T cells

It is prepared in BABL/c nude mices (being purchased from Shanghai Slac Experimental Animal Co., Ltd.) tail vein injection embodiment 2 PIK-T cells (injection dosage 5 × 10⁶), 100 μ g anti-Rituximab antibodies (Rituxan) or human IgG pair are injected intravenously after 3 days According to antibody.After 12 hours, gather blood and bone marrow specimens, with the ratios of flow cytomery PIK-T cells (CD20 with CD3 double positive cells).

As a result show, relative to the control group of injection human IgG antibody, after anti-Rituximab antibodies are injected, the PIK-T of infusion is thin Ratio of the born of the same parents in blood and marrow significantly reduces (Figure 10).It can be seen that the brake of CD20 molecules can effectively play a role in vivo, can With by ADCC and CDC effects by the PIK-T cell clearances containing CD20 epitopes.

Although the embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.Root According to disclosed all teachings, those details can be carried out with various modifications and replacement, these change in the guarantor of the present invention Within the scope of shield.The four corner of the present invention is provided by appended claims and its any equivalent.

Claims

1. a kind of transgenic T cells, it is characterised in that stable integration is anti-comprising people Fc sections in the genome of the T cell The expression cassette of the coded sequence of body, and the both ends of expression cassette include the inverted terminal repeat of transposons.

2. transgenic T cells as claimed in claim 1, it is characterised in that every million T cell was expressed in 48 hours Amount of antibody be higher than 2 μ g.

3. transgenic T cells as claimed in claim 1, it is characterised in that the transposons is selected from：piggybac、 Sleeping beauty, frog prince, Tn5 and Ty；Preferably, the transposons is piggybac.

4. transgenic T cells as claimed in claim 1, it is characterised in that the T cell is selected from：Periphery blood T lymphocyte, Cell toxicant killer T cell (CTL), helper cell, suppression/regulatory T cells, gamma delta T cells and from cytokine induction Killing cell (CIK), the T cell of tumor infiltrating lymphocyte (TIL), or its mixture；Preferably, the T cell is outer All blood T lymphocytes or the T cell from TIL.

5. transgenic T cells as claimed in claim 1, it is characterised in that the T cell is also comprising brake molecule, the brake Molecule is the membranous antigen that can have been listed antibody drug identification；Preferably, the membranous antigen be selected from CD11a, CD15, CD19, CD20、CD25、CD44、CD47、CD52、EGFR、ERBB2、ERBB3、ERBB4、VEGFR1、VEGFR2、EpCAM、MSLN、 The integrin of GPIIb/IIIa, α 4 and the integrins of 4 β of α 7；Preferably, the membranous antigen is CD20.

6. transgenic T cells as claimed in claim 1, it is characterised in that the antibody is antitumor or antiviral antibody, excellent It is selected from：Immunologic test point antibody, T cell costimulatory signal antibody, the antibody of Cancer therapy, antitumor cell growth because The antibody of sub- acceptor, the antibody and antiviral antibody of antitumor cell membranous antigen.

7. transgenic T cells as claimed in claim 1, it is characterised in that the antibody be directed to following antigen in one kind or It is a variety of：PD-1、CTLA4、PDL1、PDL2、PDL3、TIM3、LAG3、CD28、CD137、CD40、CD40L、CD47、CD19、 CD20, CEA, GD2 (also known as B4GALNT1, β Isosorbide-5-Nitraes-acetyl group-galactosaminyl transferase 1), FR (Flavin reductases), PSMA (PSMA, gp100 (PMEL premelanosomes albumen), CA9 (carbonic anhydrase IX), CD171/L1- CAM, IL-13R α 2, MART-1 (also known as mucoprotein-A), ERBB2, NY-ESO-1 (also known as CTAG1B, cancer/testis antigen 1B), MAGE (melanoma associated antigen E1) family protein, BAGE (B melanoma antigens family) family protein, GAGE (release by growth hormone Put the factor) family protein, AFP (α-fetoprotein), MUC1 (MUC-1, cell surface related), CD22, CD23, CD30, CD33, CD44v7/8, CD70, VEGFR1, VEGFR2, IL-11R α, EGP-2, EGP-40, FBP, GD3 (also known as ST8SIA1, ST8 α-N- Acetyl group-ceramide α -2,8- sialyltransferases 1), PSCA (prostate stem cell antigen), FSA (also known as KIAA1109), PSA (also known as KLK3, the related peptase 3 of kallikrein), HMGA2, fetal type acetylcholinergic receptor, LeY (also known as FUT3), EpCAM, MSLN (mesothelin), IGFR1, EGFR, EGFRvIII, ERBB3, ERBB4, CA125 (also known as MUC16, MUC-1 6, Cell surface is related), CA15-3, CA19-9, CA72-4, CA242, CA50, CYFRA21-1, SCC (also known as SERPINB3), AFU (also known as FUCA1), EBV-VCA, POA (also known as VDR, vitamin D (1,25- dihydrovitamin D3) acceptor), (β -2- are micro- by β 2-MG Globulin) and PROGRP (GRP gastrin releasing peptides), hepatitis B, AIDS virus；Preferably, the antibody is PD-1 antibody.

8. such as the transgenic T cells any one of claim 1-7, it is characterised in that the transgenic T cells are transferred to Following nucleic acid constructs A and B：

Nucleic acid constructs A：The code sequence of antibody containing the inverted terminal repeat of transposons 5 ' (5 ' ITR), comprising people's Fc sections Promoter, polyA tailing signals sequence and the inverted terminal repeat of transposons 3 ' (3 ' for arranging and controlling the nucleotide sequence to express ITR)；

Nucleic acid constructs B：Containing the inverted terminal repeat of transposons 5 ' (5 ' ITR), coding brake molecule nucleotide sequence and Control the nucleotide sequence express promoter, polyA tailing signals sequence, the inverted terminal repeat of transposons 3 ' (3 ' ITR), Transposase coding sequence and the promoter of optional control transposase coding sequence expression；

Optionally, one or more methods in being turned using viral transduction, microinjection, particle bombardment, via Particle Bombardment Transformation and electricity The nucleic acid constructs is transferred in the cell, turned preferably by electricity.

9. a kind of pharmaceutical composition, it is characterised in that described pharmaceutical composition contains to be turned any one of claim 1-8 Transgenic T cells and pharmaceutically acceptable auxiliary material.

10. the purposes of the pharmaceutical composition described in transgenic T cells or claim 9 any one of claim 1-8, Characterized in that, the purposes is selected from：

Prepare for suppress growth of tumour cell medicine, prepare for suppress viral growth medicine, prepare for treat it is swollen The medicine of knurl, prepare for treat disease of viral infection medicine, prepare medicine for treating bacterial infection disease and Prepare the medicine for treating autoimmune disease；

Preferably, the tumour is selected from：Liver cancer, lung cancer, colon cancer, cancer of pancreas, stomach cancer, breast cancer, nasopharyngeal carcinoma, lymthoma, ovum Nest cancer, carcinoma of urinary bladder, prostate cancer and head and neck neoplasm.